JBC INTERFERin siRNA transfection reagent

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M301635200 on March 28, 2003

J. Biol. Chem., Vol. 278, Issue 23, 20652-20658, June 6, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/23/20652    most recent
M301635200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, Z.
Right arrow Articles by Wang, C. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, Z.
Right arrow Articles by Wang, C. C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

A PHO80-like Cyclin and a B-type Cyclin Control the Cell Cycle of the Procyclic Form of Trypanosoma brucei*

Ziyin Li and Ching C. Wang {ddagger}

From the Department of Pharmaceutical Chemistry, University of California, San Francisco, California 94143-0446

Received for publication, February 14, 2003
    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cyclins bind and activate cyclin-dependent kinases that regulate cell cycle progression in eukaryotes. Cell cycle control in Trypanosoma brucei was analyzed in the present study. Genes encoding four PHO80 cyclin homologues and three B-type cyclin homologues but no G1 cyclin homologues were identified in this organism. Through knocking down expression of the seven cyclin genes with the RNA interference technique in the procyclic form of T. brucei, we demonstrated that one PHO80 homologue (CycE1/CYC2) and a B-type cyclin homologue (CycB2) are the essential cyclins regulating G1/S and G2/M transitions, respectively. This lack of overlapping cyclin function differs significantly from that observed in the other eukaryotes. Also, PHO80 cyclin is known for its involvement only in phosphate signaling in yeast with no known function in cell cycle control. Both observations thus suggest the presence of simple and novel cell cycle regulators in trypanosomes. T. brucei cells deficient in CycE1/CYC2 displayed a long slender morphology, whereas those lacking CycB2 assumed a fat stumpy form. These cells apparently still can undergo cytokinesis generating small numbers of anucleated daughter cells, each containing a single kinetoplast known as a zoid. Two different types of zoids were identified, the slender zoid derived from reduced CycE1/CYC2 expression and the stumpy zoid from CycB2 deficiency. This observation indicates an uncoupling between the kinetoplast and the nuclear cycle, resulting in cell division driven by kinetoplast segregation with neither a priori S phase nor mitosis in the trypanosome.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The eukaryotic cell cycle is governed by multiple regulatory proteins, such as the cyclins, cyclin-dependent kinases (CDKs),1 and CDK inhibitors. By the well controlled periodic synthesis and destruction of the cyclins, the corresponding CDK activities go through a corresponding sequential activation and inactivation, which provide the primary means of cell cycle control (1).

The cyclins first were identified as the proteins for which levels oscillate during the progression of the eukaryotic cell cycle. In the budding yeast Saccharomyces cerevisiae, three cyclins (CLN1–CLN3) were found to function in controlling the G1 phase, whereas six closely related B-type cyclins (CLB1–CLB6) were identified in driving the cell cycle from S phase to mitosis (2). These cyclins perform apparently redundant functions because it requires a deletion of all three G1 cyclins to arrest the yeast cells at G1 (3) and a deletion of CLB2 coupled with a deletion of CLB1, CLB3, or CLB4 for an arrest at G2/M (4). These cyclins all bind to the same CDK, CDC28, in a sequential manner to activate CDC28 for regulating yeast cell cycle progression (2). Two other cyclins, PCL1 and PCL2 (5, 6), associate with another CDK, PHO85, for which the primary function is to transduce the phosphate starvation signal in yeast (7), and also are involved in the yeast G1/S transition. However, cyclin PHO80, which binds to PHO85 in transducing the phosphate starvation pathway, apparently is not involved in cell cycle regulation (7). In mammals, at least 16 cyclin-like proteins have been identified, although only 9 of them were found to associate with different CDKs in cell cycle control (1). The cyclin proteins are significantly divergent in structure, but they all share a common region known as the cyclin box domain, which binds and activates the CDKs.

Trypanosoma brucei is a parasitic protozoan and a causative agent of sleeping sickness in Africa. It also generally is regarded as a deeply branched and relatively primitive eukaryote further removed from mammals than yeast. The trypanosome cell division cycle has the usual sequential G1, S, G2, and M phases, but there is a periodic S phase for the unit mitochondrial genome, the kinetoplast, prior to the nuclear S phase, suggesting a well coordinated replication and segregation between the nucleus and the kinetoplast (8). However, treatment of trypanosome cells with the nuclear DNA synthesis inhibitor aphidicolin or the antimicrotubule agent rhizoxin resulted in blocking nuclear DNA synthesis or mitosis without an inhibitory effect on cytokinesis or kinetoplast segregation (9). There is apparently little connection between the nucleus and the kinetoplast in their propagation, which makes the regulation of the trypanosome cell cycle an interesting subject to pursue.

Little is known about how the trypanosome cell cycle is regulated at the molecular level. Two cyclin-like genes, CYC2 and CYC3, were identified recently in T. brucei by rescuing a yeast G1 cyclin deletion mutant (10), and three cdc2-like protein kinase genes also have been cloned from T. brucei (11). However, their roles in cell cycle control have not been determined. CYC2 is a homologue of PHO80 (10). Attempts to disrupt the second allele of the CYC2 gene in T. brucei were unsuccessful, which led to the conclusion that the CYC2 gene is essential for T. brucei viability with little additional information available (10). The trypanosome genome sequence data base, however, has provided us the opportunity to identify potential protein components of the cell cycle regulatory complex, and the recently discovered RNA interference technique has allowed us to knock down individually the expression of these components in T. brucei to assess from the phenotypes of the knock-down cells their potential functions.

In the present study, we identified from the T. brucei genome data base five new cyclin-like genes other than CYC2 and CYC3 and cloned the full-length cDNAs of four of them. RNAi experiments on the procyclic form of T. brucei showed that a single PHO80 homologue, CycE1/CYC2, played an essential role in the G1/S transition and that a single B-type cyclin homologue CycB2 was indispensable for passing the G2/M boundary (see below). Two different types of anucleated zoid cells, the slender zoid and the stumpy zoid, each containing a single kinetoplast, were derived from these arrested cells; a slender form was produced from a G1/S block, and a stumpy form resulted from a G2/M inhibition. These findings point to not only a simple and novel mechanism of cell cycle regulation but also the occurrence of cell division driven by kinetoplast segregation and cytokinesis in the absence of either nuclear DNA replication or mitosis in T. brucei.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell Culture—The procyclic form of T. brucei strain 29-13 (12) was cultivated at 26 °C in Cunningham's medium supplemented with 10% fetal bovine serum (Atlanta Biological). G418 (15 µg/ml) and hygromycin B (50 µg/ml) were added to the culture medium to maintain the T7 RNA polymerase and tetracycline repressor gene constructs within the cells.

Identification of Cyclin-like cDNAs from T. brucei—Partial genomic sequences of the cyclin-like genes were identified from The Institute for Genomic Research (TIGR) trypanosome genome project sequence data base by the BLAST search program using yeast CLN1CLN3 and CLB1CLB6 genes and T. brucei CYC2 and CYC3 genes as the queries. Gene-specific primers then were designed according to the partial sequence information (available upon request) and employed in reverse transcription-PCR (RT-PCR) for rapid amplification of cDNA ends (RACE). First-strand cDNAs were generated from the total RNA of T. brucei with an oligo(dT)15 adaptor primer and Moloney murine leukemia virus reverse transcriptase. The 5'-RACE was performed using a gene-specific antisense primer in combination with the splice leader sequence (TTAGAACAGTTTCTGTACTATATTG) known as the common 5'-end of all mRNAs in T. brucei (13). The 3'-RACE was carried out using a gene-specific sense primer in combination with the adaptor primer, which was introduced into cDNA during reverse transcription. The PCR fragments thus synthesized were cloned into pGEM-T easy vector (Promega) for sequencing. A pair of specific primers was designed to amplify the full-length cDNA, which then was sequenced for complete open reading frame identification.

RNA Interference—Partial cDNA fragments (300–500 bp in length) of the putative cyclin genes (sequence available upon request) each were amplified by PCR using gene-specific primers with XhoI and HindIII linkers and were subcloned into the pZJM vector (14) by replacing the {alpha}-tubulin fragment in it. The resulting RNAi construct was linearized with NotI so that it could be integrated into the rDNA spacer region of the T. brucei chromosome. Transfection of the procyclic form of T. brucei by electroporation was performed essentially according to our previously described procedures (15, 16). The transfectants were selected under 2.5 µg/ml phleomycin and cloned by limiting dilutions. To induce RNAi, the stable transfectants were cultured in the presence of 1.0 µg/ml tetracycline. Cell numbers were counted under a microscope at different time intervals using a hemocytometer.

Semiquantitative RT-PCR—Total RNA was extracted from T. brucei cells using the TRIzol reagent (Amersham Biosciences). First-strand cDNAs were generated from DNase I-treated total RNA samples using oligo(dT)15 primer and Moloney murine leukemia virus reverse transcriptase (Promega). PCR was performed using first-strand cDNAs and gene-specific primers that are different from the primer pair used in generating the RNAi construct (sequences available upon request). The PCR cycling program is 30 cycles at 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 45 s followed by a final elongation time at 72 °C for 5 min.

Fluorescence-activated Cell Sorting (FACS) Analysis—The FACS analysis of propidium iodide-stained trypanosome cells was carried out as previously described (16). Briefly, T. brucei cells were washed twice with phosphate-buffered saline (PBS) and fixed in ethanol for 1 h at 4 °C. The cells were washed twice again with PBS and suspended in PBS. DNase-free RNase (10 µg/ml) and propidium iodide (20 µg/ml) were added to the suspension and incubated for 30 min at room temperature before FACS analysis. The DNA content of propidium iodide-stained cells was analyzed with a fluorescence-activated cell sorting scan (FACScan) analytical flow cytometer (BD Biosciences). Percentages of cells in each phase of the cell cycle (G1, S, and G2/M) were determined by the ModFitLT V3.1 software (BD Biosciences).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Identification of Cyclin-like Genes from T. brucei—By searching the trypanosome genome sequence data base using the yeast G1 cyclin genes CLN1CLN3, yeast B-type cyclin genes CLB1CLB6, and the two previously identified T. brucei putative cyclin genes CYC2 and CYC3 as queries, five distinct cyclin-like sequences were identified in addition to the existing CYC2 and CYC3. Based on the partial sequences, gene-specific primers were designed and employed in 5'- and 3'-RACE to amplify the 5'- and 3'-sequences, resulting in successful cloning of the full-length cDNA sequences among four of these five cyclin-like genes. CYC2 and three of the five newly found cyclin homologues contain the cyclin box domain homologous to that of yeast PHO80 cyclin. We renamed CYC2 as CycE1 (CycE1/CYC2) in our present study and named the other three new cyclins CycE2, CycE3, and CycE4, respectively. CYC3 and the two other newly identified cyclin homologues bear sequences very similar to those of the B-type cyclins from a variety of other organisms. Thus, we propose to rename CYC3 as CycB1 (CycB1/CYC3) and to name the other two cyclins CycB2 and CycB3.

Alignment of the conserved cyclin box domains of the cyclins from trypanosomes and those of other eukaryotes showed that trypanosome CycE1/CYC2, CycE2, CycE3, and CycE4 exhibit significant sequence homology to the PHO80 cyclin of S. cerevisiae (Fig. 1A). CycE1/CYC2 bears a 34% sequence identity with PHO80 in the cyclin box domain. The yeast PHO80 cyclin mainly is involved in the phosphate signaling pathway through its association with another CDK, PHO85, and has no known role in cell cycle control (7). Another yeast cyclin subfamily, the PCL cyclins, is known to associate also with PHO85 (7), and the PCL1-PHO85 and PCL2-PHO85 complexes have been shown to play some roles in controlling the G1/S transition in yeast in addition to the CLN1–CLN3 and CDC28 complexes (5, 6). However, the cyclin box domain of trypanosome CycE1–CycE4 exhibits only a very low level of sequence identity with the cyclin box domain of the PCLs (16% between CycE1 and PCL1). Thus it is not possible to determine from the cyclin box domain of trypanosome CycE1–CycE4 whether they function as PHO80 or G1 cyclins.



View larger version (138K):
[in this window]
[in a new window]
 
FIG. 1.
Multiple sequence alignments among the conserved cyclin box domains of the cyclins from T. brucei and those from other organisms. A, T. brucei putative G1 cyclins CycE1–CycE4 versus the S. cerevisiae phosphate cyclin PHO80 (GenBankTM/EBI accession number P20052 [GenBank] ). B, T. brucei putative B-type cyclin CycB2 versus several plant G2/M-specific mitotic cyclins, the G. max cyclin cyc5Gm (GenBankTM/EBI accession number BAA09467 [GenBank] ), the C. roseus cyclin CYM (GenBankTM/EBI accession number BAA20411 [GenBank] ), and the A. majus cyclin 1 (GenBankTM/EBI accession number P34800 [GenBank] ). C, T. brucei putative B-type cyclin CycB3 versus the B-type cyclins from S. pombe cyclin CDC13 (GenBankTM/EBI accession number P10815 [GenBank] ), A. thaliana cyclin CYC1 (GenBankTM/EBI accession number P30183 [GenBank] ), and Drosophila B-type cyclin CycB (GenBankTM/EBI accession number CAA07238 [GenBank] ). Numbers on the right indicate the residue positions in the protein.

 

Trypanosome CycB2 showed, surprisingly, significant sequence homology (~50% identity) to the B-type cyclins from plant species such as Glycine max (cyclin cyc5Gm) (17), Catharanthus roseus (cyclin CYM) (18), and Antirrhinum majus (cyclin 1) (Fig. 1B) (19) as well as many B-type cyclin homologues from Arabidopsis thaliana and rice (data not shown). CycB2 exhibited a lower (31–39%) sequence identity to the cyclin box domains of yeast B-type cyclins CLB1–CLB6. Trypanosome CycB3 exhibited, however, a very low level of sequence identity with plant B-cyclins but a moderate level of sequence identity (~25%) and similarity (~45%) to the B-type cyclins from a variety of other organisms such as Schizosaccharomyces pombe (cyclin CDC13) (20), Drosophila (cyclin CycB) (21), and A. thaliana (cyclin CYC1) (22). The three trypanosomal putative B-type cyclins CycB1/CYC3, CycB2, and CycB3 exhibited a low level of sequence homology (~20% identity) to one another, suggesting that they may have originated from different subfamilies. This is in sharp contrast to CycE1–CycE4, which bear close sequence similarities with one another and could be derived from the same subfamily. Consequently, CycE1–CycE4 could be functionally redundant, whereas the three B-cyclins may perform non-overlapping functions. A functional analysis of each of these seven cyclin homologues by RNAi may shed some light on these uncertainties.

RNA Interference of Expression of Individual Cyclin Genes in the Procyclic Form of T. brucei—We employed the RNAi technique to selectively knock down expression of the seven individual cyclin genes in the procyclic form of T. brucei so that we could explore the potential roles that they each may play during the trypanosome cell cycle. A 300–500-bp DNA fragment of a unique sequence from the coding region of each cyclin gene was amplified by PCR and subcloned into the RNAi vector pZJM (14). The resulting construct then was introduced by electroporation into the procyclic form cells of T. brucei strain 29-13, expressing both tetracycline repressor and T7 RNA polymerase. The stable transfectants were selected under phleomycin and cloned by limiting dilution. Transcription of the DNA insert into double-stranded RNA was induced by adding tetracycline to the culture medium to switch on the T7 promoters. Double-stranded RNA thus synthesized is known to lead to specific degradations of its corresponding mRNA in T. brucei (14, 15, 16, 23, 24, 25, 26).

The effect of RNAi on individual cyclin gene expression was examined first by semiquantitative RT-PCR analysis. The results, shown in the insets of Fig. 2, indicate that after initiating RNAi for 2 days, the levels of mRNA encoding individual cyclins decreased significantly and became undetectable by RT-PCR. This effective blockade of gene expression also turned out to be highly specific as the levels of the other six cyclin mRNAs were unaffected in each case (data not shown). Effects of individual cyclin mRNA depletion on trypanosome replication then were monitored by daily counting of the cultured transfected cells with or without tetracycline induction (Fig. 2). The results, presented as time courses of cell growth, indicated that among the four PHO80 homologue-deficient cell lines, only the growth of CycE1/CYC2-deficient cells was inhibited significantly (Fig. 2A). The growth of cells deficient in CycE2 or CycE4 assumes the same rate as the wild type cells, whereas the CycE3-deficient cells grow with an ~50% reduced rate compared with the wild type. Among the three B-type cyclin-deficient cell lines, a knock-down of CycB2 expression results in a complete arrest of cell growth, whereas loss of CycB1/CYC3 exerts no appreciable effect on the rate of growth (Fig. 2B). Deficiency in CycB3 led to slower cell growth at a rate of about 60% of the wild type.



View larger version (32K):
[in this window]
[in a new window]
 
FIG. 2.
Effects of RNAi of expression of putative cyclin genes on the growth of procyclic form T. brucei cells. Procyclic trypanosome cell lines harboring the RNAi plasmid constructs each were incubated in culture medium with (+Tet) or without (—Tet) 1.0 µg/ml tetracycline at 26 °C, and the rate of cell growth was monitored. The numbers of cells were counted under a microscope and plotted against incubation time (Days). The insets show the mRNA levels, which were detected by semiquantitative RT-PCR in the individual cell lines before (—) and after (+) tetracycline induction for 3 days.

 

This observation led to a tentative conclusion that CycE1/CYC2 and CycB2 each performs an essential function in promoting the progression of the cell cycle in the procyclic form of T. brucei. Inclusion of CycE3 and CycB3 accelerates the rate of cell cycle progression considerably, albeit neither protein is indispensable for maintaining the cycle. CycE2, CycE4, and CycB1/CYC3 probably are not involved in controlling the cell cycle. It is unlikely that the lack of effect from knocking down their expression could be attributed to their long protein half-lives because G1 cyclins and B-type cyclins are well known for their short half-lives due to rapid degradation by the 26 S proteasome (27, 28).

Cell Cycle Defects Identified in the Cyclin-deficient Trypanosome Cells—To ascertain the specific point of cell cycle arrest among the individual cyclin-deficient trypanosome cell lines, we stained the cells with propidium iodide and performed FAC-Scan to separate them by their DNA content. The results, which are presented in Fig. 3, show that among the CycE1/CYC2-deficient cells, those in the G1 phase are increased to comprise ~90% of the total population, whereas the G2/M phase cells are decreased to make up ~10% of the total population. The S phase cells are essentially undetectable after 9 days of induced RNAi (Fig. 3A). These data suggest that the transition from G1 to S phase is inhibited significantly. CycE1/CYC2 thus could be a bona fide G1 cyclin performing an essential role in promoting the G1/S transition in trypanosomes. When CycE3 is deficient (Fig. 3B), there is only a slight increase (~10%) in G1 phase cells, accompanied by a corresponding decrease in S phase cells without an appreciable change in the G2/M population over a period of 9 days. This observation suggests that the transition from G1 to S phase is slowed down slightly without arresting the progression of the cell cycle. CycE3 thus still may perform a role, albeit nonessential, in the G1/S transition. Consistent with their lack of effect on cell proliferation, a deficiency of CycE2 or CycE4 in trypanosome cells did not result in any apparent change in the profiles of the cells compared with wild type cells (data not shown). These two proteins probably are not involved in cell cycle regulation. We thus conclude that CycE1/CYC2 is the dominant as well as the essential G1 cyclin, whereas CycE3 plays an auxiliary role in the G1/S transition of T. brucei in procyclic form.



View larger version (35K):
[in this window]
[in a new window]
 
FIG. 3.
FACS analysis of four different cyclin-deficient procyclic form T. brucei cell lines. T. brucei cells harboring different RNAi plasmid constructs were incubated in culture medium in the presence of 1.0 µg/ml tetracycline. Time samples were collected, stained with propidium iodide, and subjected to FACS analysis. Percentages of cells in G1, S, and G2/M phases in three independent RNAi induction experiments were determined by the ModFitLT software and plotted on the right-hand side of each panel. The representative histograms from FACScan are presented on the left-hand side of each panel. A, CycE1/CYC2-deficient cells. B, CycE3-deficient cells. C, CycB2-deficient cells. D, CycB3-deficient cells. 2N, diploid; 4N, tetraploid; d, days.

 

Depletion of CycB2 resulted in the arrest of almost 90% of the cell population in the G2/M phase within a relatively short period of 24 h (Fig. 3C). This suggests that CycB2 is a highly essential mitotic cyclin in the procyclic form of T. brucei, mediating the progression through G2 to M phase. The CycB3-deficient cells showed a slight (~10%) increase in the number of G2/M phase cells with a corresponding decrease in the number of G1 phase cells after 9 days (Fig. 3D), suggesting an auxiliary role of CycB3 in promoting the cells through the G2/M boundary. Finally, depletion of CycB1/CYC3 had no detectable effect on the profile of cells in FACScan (data not shown), suggesting that CycB1/CYC3 likely is uninvolved in cell cycle control. The results derived from these experiments thus indicate once again only one essential/dominant mitotic cyclin, CycB2, and one auxiliary mitotic cyclin, CycB3, in the procyclic form of T. brucei. This scheme of cyclin-regulated G1/S and G2/M transition is perhaps the simplest among all those known to date.

Cellular Morphology of the Cyclin-deficient T. brucei Procyclic Form Cells—Microscopic examination of the CycE1/CyC2-deficient cells indicated an obvious morphological change from the original wild type. A long slender morphology of the cells became obvious after induction of RNAi for 3 days, becoming even longer and more slender after 9 days (Fig. 4A, middle panel). It was apparently the consequence of a blocked G1/S transition. Most of the population (80–90%) contained one nucleus and one kinetoplast (1N1K [PDB] ) in each cell as in the wild type cells. But, unlike the wild type cells, about 7% of the population (Fig. 4B, middle panel), appearing shorter and smaller in size, turned out to contain no nucleus but one kinetoplast in each cell upon staining with 4',6-diamidino-2-phenylindole and examination under a fluorescence microscope (Fig. 4A, middle panel). Apparently, an abortive cell division occurred with the parents of these cells, which had a blocked entry from G1 into S phase. This abnormal cell type, termed the "zoid," was observed previously among the trypanosome cells that were treated with aphidicolin or rhizoxin (9, 29) or were deficient in the function of an AAA-type ATPase (30). However, the previously observed zoids only appeared to be smaller than the wild type cells; they did not seem particularly long or slender. We thus named the zoids observed in Fig. 4A, middle panel, the slender zoids.



View larger version (58K):
[in this window]
[in a new window]
 
FIG. 4.
The morphological phenotypes of two cyclin-deficient T. brucei procyclic form cell lines. Two procyclic form T. brucei cell lines harboring the CycE1/CYC2 and CycB2 RNAi constructs were incubated under 1.0 µg/ml tetracycline, fixed with ethanol, stained with 1.0 µg/ml 4',6-diamidino-2-phenylindole (DAPI), and examined under a fluorescence microscope. A, left-hand panel, the control cells harvested after 9 days demonstrated the presence of all three types of cells (one nucleus and one kinetoplast (1N1K), one nucleus and two kinetoplasts (1N2K), and two nuclei and two kinetoplasts (2N2K)). Middle panel, the CycE1/CYC2-deficient cells 9 days after RNAi induction had the 1N1K [PDB] phenotype but became unusually slender with an average length twice as long as the control cells. Some of the slender cells were shorter in length but contained only one kinetoplast without a nucleus. They were named the "slender zoids." Right-hand panel, the CycB2-deficient cells harvested 2 days after RNAi induction each contained a significantly enlarged nucleus with only one kinetoplast. Some cells of the same size and with an equally fat and stumpy shape contained no nucleus and were designated the "stumpy zoids." Size bars, 3 µm. B, quantification of the different cell types in the three cell samples. Individual cells were scored under a fluorescence microscope for the number of kinetoplasts (K) and nuclei (N). Data are presented as the mean percent ± S.E. of total cells counted (>200) from three independent experiments.

 

After 24 h of induced RNAi, the CycB2-deficient cells became, however, fat and stumpy compared with the control cells, which had not undergone RNAi induction (Fig. 4A, left panel). The majority of the cells (70–80%) contained one kinetoplast and one significantly enlarged nucleus (Fig. 4A, right panel), suggesting that DNA replication occurred but that mitosis failed, leading to the arrest of cell growth. About 13% of the population also turned out to be zoids (Fig. 4B, right panel). However, in contrast to the slender phenotype of zoids observed among the CycE1/CYC2-deficient cells, the CycB2-deficient zoids seemed fat and stumpy, similar to the CycB2-deficient cells that contained both the kinetoplast and the enlarged nucleus (Fig. 4A, right panel). These stumpy zoids, which are apparently the daughters of cells blocked at the stage of mitosis, provided a clear indication that cell division of the procyclic form of T. brucei can occur without a priori nuclear mitotic division. This abortive cell division, which is driven most likely by the segregation of the kinetoplast, provides an intriguing example of cell division without nuclear mitosis.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In the present investigation, we performed molecular identification and functional analysis of seven cyclin homologues in the procyclic form of T. brucei as a first step to dissect the molecular mechanism of cell cycle control in this primitive eukaryote. One of the yeast PHO80 cyclin homologues, CycE1/CYC2, turned out to be an essential G1 cyclin, whereas a close homologue of plant B-type cyclin CycB2 was identified as an essential mitotic cyclin in trypanosomes. Although the complete spectrum of cyclin involvement in regulating the trypanosome cell cycle is not yet available, the apparent simple scheme reflected by the indispensability of only two individual cyclins suggests that T. brucei has a very primitive molecular mechanism in cell cycle regulation.

The first intriguing observation from our present study is that yeast PHO80, the closest homologue of trypanosome CycE1/CYC2, is a cyclin present at a constant level in yeast and is not involved in cell cycle regulation (7). It binds and activates a CDK, PHO85, in yeast in responding to phosphate starvation (7). PHO85 has another subfamily of cyclin partners, the PCLs, some of which (PCL1, PCL2, etc.) have a pattern of cell cycle-regulated expression (5, 6, 31, 32). Although deletion of PCL1 or PCL2 did not lead to any detectable phenotype, {Delta}cln1{Delta}cln2{Delta}pcl1 and {Delta}cln1{Delta}cln2{Delta}pcl2 caused arrest of yeast cells in the G1 phase, thus suggesting some roles for PCL1 and PCL2 in controlling the G1/S transition (5, 6). CycE1/CYC2 shares, however, only a very limited sequence identity with PCL1 (16%) and PCL2 (18%). This trypanosome cyclin was found previously to be associated with a cdc2-related kinase (CRK), CRK3, in T. brucei by Van Hellemond et al. (10) using immunoprecipitation and a yeast two-hybrid system. CRK3 shares 44% sequence identity with PHO85 and 48% identity with CDC28. It could perform the primary function of PHO85 and/or CDC28 in regulating the G1/S transition in trypanosomes with its kinase activity regulated primarily by a PHO80-like cyclin, CycE1/CYC2.

The cyclin box domain of CycB2, the essential mitotic cyclin in trypanosomes, has significant sequence identity with the cyclin box domains of the plant B-type cyclins (Fig. 1B). It is not known whether these plant B-type cyclins also play a dominant role in controlling G2/M transition in the respective plants, but the B-type cyclins in budding yeast are well known for their functional redundancy. Among CLB1, -2, -3, and -4, multiple deletions, which always include the deletion of CLB2, are required to arrest the yeast cell cycle (4). CLB2 shows the highest sequence similarity to the S. pombe B-cyclin homologue CDC13 (20), which bears significant sequence homology with CycB3 from T. brucei (Fig. 1C). However, the latter plays only an auxiliary role in regulating the trypanosome cell cycle through the G2/M transition. It thus has become a futile effort to try to compare the structures and functions of cyclins from different species to gain a more in-depth understanding of the cyclins newly identified in T. brucei. The cyclins may have evolved fairly rapidly in response to changes in a complex extracellular environment to maintain a robust cell cycle progression and metabolism of nutrients (7). The living environment for trypanosomes oscillating between mammalian bloodstreams and tsetse midguts can be relatively stable. A more conserved, and thus more simplistic, primitive, and ancient cyclin system thus still could be operating well in this organism ready to be explored as a model.

Another interesting observation resulting from our present study is the identification of two types of zoids from cell cycle arrest at two different checkpoints. The slender zoid produced from a blocked G1/S transition suggests the occurrence of cell division without an S phase, whereas the appearance of the stumpy zoid under an inhibited G2/M transition indicates cell division without mitosis. Thus trypanosome cells are capable of dividing without progressing through their regular cell cycle. This finding is in agreement with that of Ploubidou et al. (9), who indicated that the nucleus and the kinetoplast in T. brucei each have a distinct S phase followed by a segregation period prior to cell division. The segregation of nuclear DNA depends on the spindle, whereas the flagellum basal bodies are instrumental for kinetoplast DNA separation. T. brucei cytokinesis is apparently not dependent upon either nuclear DNA synthesis or mitosis. Thus among some aphidicolin-treated trypanosome cells, Ploubidou et al. (9) observed basal body segregation, which is apparently capable of dividing the cell into two daughter cells with one of the two forming the zoid. When the expression of an essential G1 cyclin CycE1/CYC2 was knocked down in our present study, kinetoplast segregation and cytokinesis proceeded apparently normally, leading to successful cell division to generate the zoids. However, because of the blocked S phase in these cells, daughter cells either with or without a nucleus assumed a slender appearance (Fig. 4A, middle panel). Conversely, in the absence of an essential mitotic cyclin, CycB2, the cells were blocked from mitosis; nonetheless, cytokinesis proceeded unhindered, and the kinetoplast went through its segregation resulting in cell division. Because the cells already had gone through a normal S phase, daughter cells with or without a nucleus appeared to have an equally full size with a stumpy shape (Fig. 4A, right panel).

This observation leads to an interesting elucidation that trypanosome cell division can be driven by the synthesis and segregation of the kinetoplast alone while the cell cycle is arrested. But, because the dyskinetoplastic bloodstream form of trypanosome cells are known to divide in a normal manner (33, 34), cell division apparently can occur after mitosis in the absence of the kinetoplast. There must be thus two separate schemes capable of driving the division of trypanosome cells. They are apparently independent of each other, and yet they are well coordinated in the wild type cells resulting in cell divisions in a synchronous manner. The molecular mechanisms underlying two different pathways for cell division and the coordination between them may constitute one of the most interesting aspects of trypanosome cell biology.


    FOOTNOTES
 
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EBI Data Bank with accession number(s) AY157028 [GenBank] , AY157029 [GenBank] , AY157030 [GenBank] , AY157031 [GenBank] , and AY157032 [GenBank] .

* This work was supported by National Institutes of Health R01 Grant AI-21786. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

{ddagger} To whom correspondence should be addressed. Tel.: 415-476-1321; Fax: 415-476-3382; E-mail: ccwang{at}cgl.ucsf.edu.

1 The abbreviations used are: CDK, cyclin-dependent kinase; RNAi, RNA interference; RT, reverse transcription; RACE, rapid amplification of cDNA ends; FACS, fluorescence-activated cell sorting; FACScan, FACS scan; 1N1K [PDB] , one nucleus and one kinetoplast; CRK, cdc2-related kinase. Back


    ACKNOWLEDGMENTS
 
We are grateful to Dr. George Cross of the Rockefeller University and Dr. Paul T. England of the Johns Hopkins University School of Medicine for providing the pZJM plasmid and T. brucei 29-13 strain and to Dr. Jeremy Mottram of the Glasgow University for the generous gift of cDNA clones of CYC2 and CYC3. We also thank Huiqing Hu for assistance in RNAi experiments and fluorescence microscopy.



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Johnson, D. G., and Walker, C. L. (1999) Annu. Rev. Pharmacol. Toxicol. 39, 295–312[Medline] [Order article via Infotrieve]
  2. Küntzel, H., Schulz, A., and Ehbrecht, I. M. (1996) Biol. Chem. 377, 481–487[Medline] [Order article via Infotrieve]
  3. Richardson, H. E., Wittenberg, C., Cross, F., and Reed, R. I. (1989) Cell 59, 1127–1133[CrossRef][Medline] [Order article via Infotrieve]
  4. Richardson, H., Lew, D. J., Henze, M., Sugimoto, K., and Reed, S. I. (1992) Genes Dev. 6, 2021–2034[Abstract/Free Full Text]
  5. Espinoza, F. H., Ogas, J., Herskowitz, I., and Morgan, D. O. (1994) Science 266, 1388–1391[Abstract/Free Full Text]
  6. Measday, V., Moore, L., Ogas, J., Tyers, M., and Andrews, B. (1994) Science 266, 1391–1395[Abstract/Free Full Text]
  7. Carroll, A. S., and O'Shea, E. K. (2002) Trends Biochem. Sci. 27, 87–93[CrossRef][Medline] [Order article via Infotrieve]
  8. Woodward, R., and Gull, K. (1990) J. Cell Sci. 95, 49–57[Abstract/Free Full Text]
  9. Ploubidou, A., Robinson, D. R., Docherty, R. C., Ogbadoyi, E. O., and Gull, K. (1999) J. Cell Sci. 112, 4641–4650[Abstract]
  10. Van Hellemond, J. J., Neuville, P., Schwarz, R. T., Matthews, K. R., and Mottram, J. C. (2000) J. Biol. Chem. 275, 8315–8323[Abstract/Free Full Text]
  11. Mottram, J. C., and Smith, G. (1995) Gene (Amst.) 162, 147–152[CrossRef][Medline] [Order article via Infotrieve]
  12. Wirtz, E., Leal, S., Ochatt, C., and Cross, G. A. (1999) Mol. Biochem. Parasitol. 99, 89–101[CrossRef][Medline] [Order article via Infotrieve]
  13. Campbell, D. A., Thornton, D. A., and Boothroyd, J. C. (1984) Nature 311, 350–355[CrossRef][Medline] [Order article via Infotrieve]
  14. Wang, Z., Morris, J. C., Drew, M. E., and Englund, P. T. (2000) J. Biol. Chem. 275, 40174–40179[Abstract/Free Full Text]
  15. Li, Z., Zou, C.-B., Yao, Y., Hoyt, M. A., McDonough, S., Mackey, Z. B., Coffino, P., and Wang, C. C. (2002) J. Biol. Chem. 277, 15486–15498[Abstract/Free Full Text]
  16. Li, Z., and Wang, C. C. (2002) J. Biol. Chem. 277, 42686–42693[Abstract/Free Full Text]
  17. Kouchi, H., Sekine, M., and Hata, S. (1995) Plant Cell 7, 1143–1155[Abstract]
  18. Ito, M., Marie-Claire, C., Sakabe, M., Ohno, T., Hata, S., Kouchi, H., Hashimoto, J., Fukuda, H., Komamine, A., and Watanabe, A. (1997) Plant J. 11, 983–992[CrossRef][Medline] [Order article via Infotrieve]
  19. Fobert, P. R., Coen, E. S., Murphy, G. J., and Doonan, J. H. (1994) EMBO J. 13, 616–624[Medline] [Order article via Infotrieve]
  20. Booher, R., and Beach, D. (1988) EMBO J. 7, 2321–2327[Medline] [Order article via Infotrieve]
  21. Jacobs, H. W., Knoblich, J. A., and Lehner, C. F. (1998) Genes Dev. 12, 3741–3751[Abstract/Free Full Text]
  22. Hemerly, A., Bergounioux, C., Van Montagu, M., Inze, D., and Ferreira, P. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 3295–3299[Abstract/Free Full Text]
  23. Bastin, P., Ellis, K., Kohl, L., and Gull, K. (2000) J. Cell Sci. 113, 3321–3328[Abstract]
  24. Moreira-Leite, F. F., Sherwin, T., Kohl, L., and Gull, K. (2001) Science 294, 610–612[Abstract/Free Full Text]
  25. Klingbeil, M. M., Motyka, S. A., and Englund, P. T. (2002) Mol. Cell 10, 175–186[CrossRef][Medline] [Order article via Infotrieve]
  26. Timms, M. W., van Deursen, F. J., Hendriks, E. F., and Matthews, K. R. (2002) Mol. Biol. Cell 13, 3747–3759[Abstract/Free Full Text]
  27. Van Hellemond, J. J., and Mottram, J. C. (2000) Mol. Biochem. Parasitol. 111, 275–282[CrossRef][Medline] [Order article via Infotrieve]
  28. Koeep, D. M., Harper, J. W., and Elledge, S. J. (1999) Cell 97, 431–434[CrossRef][Medline] [Order article via Infotrieve]
  29. Robinson, D. R., Sherwin, T., Ploubidou, A., Byard, E. H., and Gull, K. (1995) J. Cell Biol. 128, 1163–1172[Abstract/Free Full Text]
  30. Lamb J. R., Fu V., Wirtz E., and Bangs J. D. (2001) J. Biol. Chem. 276, 21512–21520[Abstract/Free Full Text]
  31. Lee, M., O'Regan, S., Moreau, J. L., Johnson, A. L., Johnston, L. H., and Goding, C. R. (2000) Mol. Microbiol. 38, 411–422[CrossRef][Medline] [Order article via Infotrieve]
  32. Aerne, B. L., Johnson, A. L., Toyn, J. H., and Johnston, L. H. (1998) Mol. Biol. Cell 9, 945–956[Abstract/Free Full Text]
  33. Ono, T., and Inoki, S. (1975) Biken J. 18, 257–265[Medline] [Order article via Infotrieve]
  34. Ono, T., and Inoki, S. (1976) Biken J. 19, 63–69[Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Cell Sci.Home page
Z. Li, S. Gourguechon, and C. C. Wang
Tousled-like kinase in a microbial eukaryote regulates spindle assembly and S-phase progression by interacting with Aurora kinase and chromatin assembly factors
J. Cell Sci., November 1, 2007; 120(21): 3883 - 3894.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Boucher, D. Dacheux, C. Giroud, and T. Baltz
An Essential Cell Cycle-regulated Nucleolar Protein Relocates to the Mitotic Spindle Where It Is Involved in Mitotic Progression in Trypanosoma brucei
J. Biol. Chem., May 4, 2007; 282(18): 13780 - 13790.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
T. H. Harris, J. M. Mansfield, and D. M. Paulnock
CpG Oligodeoxynucleotide Treatment Enhances Innate Resistance and Acquired Immunity to African Trypanosomes
Infect. Immun., May 1, 2007; 75(5): 2366 - 2373.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
Z. Li and C. C. Wang
Changing Roles of Aurora-B Kinase in Two Life Cycle Stages of Trypanosoma brucei.
Eukaryot. Cell, July 1, 2006; 5(7): 1026 - 1035.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. Tu, P. Kumar, Z. Li, and C. C. Wang
An Aurora Kinase Homologue Is Involved in Regulating Both Mitosis and Cytokinesis in Trypanosoma brucei
J. Biol. Chem., April 7, 2006; 281(14): 9677 - 9687.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. G. Rothberg, D. L. Burdette, J. Pfannstiel, N. Jetton, R. Singh, and L. Ruben
The RACK1 Homologue from Trypanosoma brucei Is Required for the Onset and Progression of Cytokinesis
J. Biol. Chem., April 7, 2006; 281(14): 9781 - 9790.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Kulikowicz and T. A. Shapiro
Distinct Genes Encode Type II Topoisomerases for the Nucleus and Mitochondrion in the Protozoan Parasite Trypanosoma brucei
J. Biol. Chem., February 10, 2006; 281(6): 3048 - 3056.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
P. Kumar and C. C. Wang
Dissociation of Cytokinesis Initiation from Mitotic Control in a Eukaryote
Eukaryot. Cell, January 1, 2006; 5(1): 92 - 102.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
X. Tu, J. Mancuso, W. Z. Cande, and C. C. Wang
Distinct cytoskeletal modulation and regulation of G1-S transition in the two life stages of Trypanosoma brucei
J. Cell Sci., October 1, 2005; 118(19): 4353 - 4364.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Kumar and C. C. Wang
Depletion of Anaphase-promoting Complex or Cyclosome (APC/C) Subunit Homolog APC1 or CDC27 of Trypanosoma brucei Arrests the Procyclic Form in Metaphase but the Bloodstream Form in Anaphase
J. Biol. Chem., September 9, 2005; 280(36): 31783 - 31791.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
X. Tu and C. C. Wang
Pairwise Knockdowns of cdc2-Related Kinases (CRKs) in Trypanosoma brucei Identified the CRKs for G1/S and G2/M Transitions and Demonstrated Distinctive Cytokinetic Regulations between Two Developmental Stages of the Organism
Eukaryot. Cell, April 1, 2005; 4(4): 755 - 764.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
K. R. Matthews
The developmental cell biology of Trypanosoma brucei
J. Cell Sci., January 15, 2005; 118(2): 283 - 290.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
X. Tu and C. C. Wang
Coupling of Posterior Cytoskeletal Morphogenesis to the G1/S Transition in the Trypanosoma brucei Cell Cycle
Mol. Biol. Cell, January 1, 2005; 16(1): 97 - 105.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. C. Hammarton, M. Engstler, and J. C. Mottram
The Trypanosoma brucei Cyclin, CYC2, Is Required for Cell Cycle Progression through G1 Phase and for Maintenance of Procyclic Form Cell Morphology
J. Biol. Chem., June 4, 2004; 279(23): 24757 - 24764.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. Tu and C. C. Wang
The Involvement of Two cdc2-related Kinases (CRKs) in Trypanosoma brucei Cell Cycle Regulation and the Distinctive Stage-specific Phenotypes Caused by CRK3 Depletion
J. Biol. Chem., May 7, 2004; 279(19): 20519 - 20528.
[Abstract] [Full Text] [PDF]