![]()
|
|
||||||||
J. Biol. Chem., Vol. 278, Issue 23, 20652-20658, June 6, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

From the Department of Pharmaceutical Chemistry, University of California, San Francisco, California 94143-0446
Received for publication, February 14, 2003
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
The cyclins first were identified as the proteins for which levels oscillate during the progression of the eukaryotic cell cycle. In the budding yeast Saccharomyces cerevisiae, three cyclins (CLN1CLN3) were found to function in controlling the G1 phase, whereas six closely related B-type cyclins (CLB1CLB6) were identified in driving the cell cycle from S phase to mitosis (2). These cyclins perform apparently redundant functions because it requires a deletion of all three G1 cyclins to arrest the yeast cells at G1 (3) and a deletion of CLB2 coupled with a deletion of CLB1, CLB3, or CLB4 for an arrest at G2/M (4). These cyclins all bind to the same CDK, CDC28, in a sequential manner to activate CDC28 for regulating yeast cell cycle progression (2). Two other cyclins, PCL1 and PCL2 (5, 6), associate with another CDK, PHO85, for which the primary function is to transduce the phosphate starvation signal in yeast (7), and also are involved in the yeast G1/S transition. However, cyclin PHO80, which binds to PHO85 in transducing the phosphate starvation pathway, apparently is not involved in cell cycle regulation (7). In mammals, at least 16 cyclin-like proteins have been identified, although only 9 of them were found to associate with different CDKs in cell cycle control (1). The cyclin proteins are significantly divergent in structure, but they all share a common region known as the cyclin box domain, which binds and activates the CDKs.
Trypanosoma brucei is a parasitic protozoan and a causative agent of sleeping sickness in Africa. It also generally is regarded as a deeply branched and relatively primitive eukaryote further removed from mammals than yeast. The trypanosome cell division cycle has the usual sequential G1, S, G2, and M phases, but there is a periodic S phase for the unit mitochondrial genome, the kinetoplast, prior to the nuclear S phase, suggesting a well coordinated replication and segregation between the nucleus and the kinetoplast (8). However, treatment of trypanosome cells with the nuclear DNA synthesis inhibitor aphidicolin or the antimicrotubule agent rhizoxin resulted in blocking nuclear DNA synthesis or mitosis without an inhibitory effect on cytokinesis or kinetoplast segregation (9). There is apparently little connection between the nucleus and the kinetoplast in their propagation, which makes the regulation of the trypanosome cell cycle an interesting subject to pursue.
Little is known about how the trypanosome cell cycle is regulated at the molecular level. Two cyclin-like genes, CYC2 and CYC3, were identified recently in T. brucei by rescuing a yeast G1 cyclin deletion mutant (10), and three cdc2-like protein kinase genes also have been cloned from T. brucei (11). However, their roles in cell cycle control have not been determined. CYC2 is a homologue of PHO80 (10). Attempts to disrupt the second allele of the CYC2 gene in T. brucei were unsuccessful, which led to the conclusion that the CYC2 gene is essential for T. brucei viability with little additional information available (10). The trypanosome genome sequence data base, however, has provided us the opportunity to identify potential protein components of the cell cycle regulatory complex, and the recently discovered RNA interference technique has allowed us to knock down individually the expression of these components in T. brucei to assess from the phenotypes of the knock-down cells their potential functions.
In the present study, we identified from the T. brucei genome data base five new cyclin-like genes other than CYC2 and CYC3 and cloned the full-length cDNAs of four of them. RNAi experiments on the procyclic form of T. brucei showed that a single PHO80 homologue, CycE1/CYC2, played an essential role in the G1/S transition and that a single B-type cyclin homologue CycB2 was indispensable for passing the G2/M boundary (see below). Two different types of anucleated zoid cells, the slender zoid and the stumpy zoid, each containing a single kinetoplast, were derived from these arrested cells; a slender form was produced from a G1/S block, and a stumpy form resulted from a G2/M inhibition. These findings point to not only a simple and novel mechanism of cell cycle regulation but also the occurrence of cell division driven by kinetoplast segregation and cytokinesis in the absence of either nuclear DNA replication or mitosis in T. brucei.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Identification of Cyclin-like cDNAs from T. bruceiPartial genomic sequences of the cyclin-like genes were identified from The Institute for Genomic Research (TIGR) trypanosome genome project sequence data base by the BLAST search program using yeast CLN1CLN3 and CLB1CLB6 genes and T. brucei CYC2 and CYC3 genes as the queries. Gene-specific primers then were designed according to the partial sequence information (available upon request) and employed in reverse transcription-PCR (RT-PCR) for rapid amplification of cDNA ends (RACE). First-strand cDNAs were generated from the total RNA of T. brucei with an oligo(dT)15 adaptor primer and Moloney murine leukemia virus reverse transcriptase. The 5'-RACE was performed using a gene-specific antisense primer in combination with the splice leader sequence (TTAGAACAGTTTCTGTACTATATTG) known as the common 5'-end of all mRNAs in T. brucei (13). The 3'-RACE was carried out using a gene-specific sense primer in combination with the adaptor primer, which was introduced into cDNA during reverse transcription. The PCR fragments thus synthesized were cloned into pGEM-T easy vector (Promega) for sequencing. A pair of specific primers was designed to amplify the full-length cDNA, which then was sequenced for complete open reading frame identification.
RNA InterferencePartial cDNA fragments (300500 bp in
length) of the putative cyclin genes (sequence available upon request) each
were amplified by PCR using gene-specific primers with XhoI and
HindIII linkers and were subcloned into the pZJM vector
(14) by replacing the
-tubulin fragment in it. The resulting RNAi construct was linearized
with NotI so that it could be integrated into the rDNA spacer region
of the T. brucei chromosome. Transfection of the procyclic form of
T. brucei by electroporation was performed essentially according to
our previously described procedures
(15,
16). The transfectants were
selected under 2.5 µg/ml phleomycin and cloned by limiting dilutions. To
induce RNAi, the stable transfectants were cultured in the presence of 1.0
µg/ml tetracycline. Cell numbers were counted under a microscope at
different time intervals using a hemocytometer.
Semiquantitative RT-PCRTotal RNA was extracted from T. brucei cells using the TRIzol reagent (Amersham Biosciences). First-strand cDNAs were generated from DNase I-treated total RNA samples using oligo(dT)15 primer and Moloney murine leukemia virus reverse transcriptase (Promega). PCR was performed using first-strand cDNAs and gene-specific primers that are different from the primer pair used in generating the RNAi construct (sequences available upon request). The PCR cycling program is 30 cycles at 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 45 s followed by a final elongation time at 72 °C for 5 min.
Fluorescence-activated Cell Sorting (FACS) AnalysisThe FACS analysis of propidium iodide-stained trypanosome cells was carried out as previously described (16). Briefly, T. brucei cells were washed twice with phosphate-buffered saline (PBS) and fixed in ethanol for 1 h at 4 °C. The cells were washed twice again with PBS and suspended in PBS. DNase-free RNase (10 µg/ml) and propidium iodide (20 µg/ml) were added to the suspension and incubated for 30 min at room temperature before FACS analysis. The DNA content of propidium iodide-stained cells was analyzed with a fluorescence-activated cell sorting scan (FACScan) analytical flow cytometer (BD Biosciences). Percentages of cells in each phase of the cell cycle (G1, S, and G2/M) were determined by the ModFitLT V3.1 software (BD Biosciences).
| RESULTS |
|---|
|
|
|---|
Alignment of the conserved cyclin box domains of the cyclins from trypanosomes and those of other eukaryotes showed that trypanosome CycE1/CYC2, CycE2, CycE3, and CycE4 exhibit significant sequence homology to the PHO80 cyclin of S. cerevisiae (Fig. 1A). CycE1/CYC2 bears a 34% sequence identity with PHO80 in the cyclin box domain. The yeast PHO80 cyclin mainly is involved in the phosphate signaling pathway through its association with another CDK, PHO85, and has no known role in cell cycle control (7). Another yeast cyclin subfamily, the PCL cyclins, is known to associate also with PHO85 (7), and the PCL1-PHO85 and PCL2-PHO85 complexes have been shown to play some roles in controlling the G1/S transition in yeast in addition to the CLN1CLN3 and CDC28 complexes (5, 6). However, the cyclin box domain of trypanosome CycE1CycE4 exhibits only a very low level of sequence identity with the cyclin box domain of the PCLs (16% between CycE1 and PCL1). Thus it is not possible to determine from the cyclin box domain of trypanosome CycE1CycE4 whether they function as PHO80 or G1 cyclins.
|
Trypanosome CycB2 showed, surprisingly, significant sequence homology
(
50% identity) to the B-type cyclins from plant species such as
Glycine max (cyclin cyc5Gm)
(17), Catharanthus
roseus (cyclin CYM) (18),
and Antirrhinum majus (cyclin 1)
(Fig. 1B)
(19) as well as many B-type
cyclin homologues from Arabidopsis thaliana and rice (data not
shown). CycB2 exhibited a lower (3139%) sequence identity to the cyclin
box domains of yeast B-type cyclins CLB1CLB6. Trypanosome CycB3
exhibited, however, a very low level of sequence identity with plant B-cyclins
but a moderate level of sequence identity (
25%) and similarity (
45%)
to the B-type cyclins from a variety of other organisms such as
Schizosaccharomyces pombe (cyclin CDC13)
(20), Drosophila
(cyclin CycB) (21), and A.
thaliana (cyclin CYC1)
(22). The three trypanosomal
putative B-type cyclins CycB1/CYC3, CycB2, and CycB3 exhibited a low level of
sequence homology (
20% identity) to one another, suggesting that they may
have originated from different subfamilies. This is in sharp contrast to
CycE1CycE4, which bear close sequence similarities with one another and
could be derived from the same subfamily. Consequently, CycE1CycE4
could be functionally redundant, whereas the three B-cyclins may perform
non-overlapping functions. A functional analysis of each of these seven cyclin
homologues by RNAi may shed some light on these uncertainties.
RNA Interference of Expression of Individual Cyclin Genes in the Procyclic Form of T. bruceiWe employed the RNAi technique to selectively knock down expression of the seven individual cyclin genes in the procyclic form of T. brucei so that we could explore the potential roles that they each may play during the trypanosome cell cycle. A 300500-bp DNA fragment of a unique sequence from the coding region of each cyclin gene was amplified by PCR and subcloned into the RNAi vector pZJM (14). The resulting construct then was introduced by electroporation into the procyclic form cells of T. brucei strain 29-13, expressing both tetracycline repressor and T7 RNA polymerase. The stable transfectants were selected under phleomycin and cloned by limiting dilution. Transcription of the DNA insert into double-stranded RNA was induced by adding tetracycline to the culture medium to switch on the T7 promoters. Double-stranded RNA thus synthesized is known to lead to specific degradations of its corresponding mRNA in T. brucei (14, 15, 16, 23, 24, 25, 26).
The effect of RNAi on individual cyclin gene expression was examined first
by semiquantitative RT-PCR analysis. The results, shown in the insets
of Fig. 2, indicate that after
initiating RNAi for 2 days, the levels of mRNA encoding individual cyclins
decreased significantly and became undetectable by RT-PCR. This effective
blockade of gene expression also turned out to be highly specific as the
levels of the other six cyclin mRNAs were unaffected in each case (data not
shown). Effects of individual cyclin mRNA depletion on trypanosome replication
then were monitored by daily counting of the cultured transfected cells with
or without tetracycline induction (Fig.
2). The results, presented as time courses of cell growth,
indicated that among the four PHO80 homologue-deficient cell lines, only the
growth of CycE1/CYC2-deficient cells was inhibited significantly
(Fig. 2A). The growth
of cells deficient in CycE2 or CycE4 assumes the same rate as the wild type
cells, whereas the CycE3-deficient cells grow with an
50% reduced rate
compared with the wild type. Among the three B-type cyclin-deficient cell
lines, a knock-down of CycB2 expression results in a complete arrest of cell
growth, whereas loss of CycB1/CYC3 exerts no appreciable effect on the rate of
growth (Fig. 2B).
Deficiency in CycB3 led to slower cell growth at a rate of about 60% of the
wild type.
|
This observation led to a tentative conclusion that CycE1/CYC2 and CycB2 each performs an essential function in promoting the progression of the cell cycle in the procyclic form of T. brucei. Inclusion of CycE3 and CycB3 accelerates the rate of cell cycle progression considerably, albeit neither protein is indispensable for maintaining the cycle. CycE2, CycE4, and CycB1/CYC3 probably are not involved in controlling the cell cycle. It is unlikely that the lack of effect from knocking down their expression could be attributed to their long protein half-lives because G1 cyclins and B-type cyclins are well known for their short half-lives due to rapid degradation by the 26 S proteasome (27, 28).
Cell Cycle Defects Identified in the Cyclin-deficient Trypanosome
CellsTo ascertain the specific point of cell cycle arrest among
the individual cyclin-deficient trypanosome cell lines, we stained the cells
with propidium iodide and performed FAC-Scan to separate them by their DNA
content. The results, which are presented in
Fig. 3, show that among the
CycE1/CYC2-deficient cells, those in the G1 phase are increased to
comprise
90% of the total population, whereas the G2/M phase
cells are decreased to make up
10% of the total population. The S phase
cells are essentially undetectable after 9 days of induced RNAi
(Fig. 3A). These data
suggest that the transition from G1 to S phase is inhibited
significantly. CycE1/CYC2 thus could be a bona fide G1
cyclin performing an essential role in promoting the G1/S
transition in trypanosomes. When CycE3 is deficient
(Fig. 3B), there is
only a slight increase (
10%) in G1 phase cells, accompanied by
a corresponding decrease in S phase cells without an appreciable change in the
G2/M population over a period of 9 days. This observation suggests
that the transition from G1 to S phase is slowed down slightly
without arresting the progression of the cell cycle. CycE3 thus still may
perform a role, albeit nonessential, in the G1/S transition.
Consistent with their lack of effect on cell proliferation, a deficiency of
CycE2 or CycE4 in trypanosome cells did not result in any apparent change in
the profiles of the cells compared with wild type cells (data not shown).
These two proteins probably are not involved in cell cycle regulation. We thus
conclude that CycE1/CYC2 is the dominant as well as the essential
G1 cyclin, whereas CycE3 plays an auxiliary role in the
G1/S transition of T. brucei in procyclic form.
|
Depletion of CycB2 resulted in the arrest of almost 90% of the cell
population in the G2/M phase within a relatively short period of 24
h (Fig. 3C). This
suggests that CycB2 is a highly essential mitotic cyclin in the procyclic form
of T. brucei, mediating the progression through G2 to M
phase. The CycB3-deficient cells showed a slight (
10%) increase in the
number of G2/M phase cells with a corresponding decrease in the
number of G1 phase cells after 9 days
(Fig. 3D), suggesting
an auxiliary role of CycB3 in promoting the cells through the G2/M
boundary. Finally, depletion of CycB1/CYC3 had no detectable effect on the
profile of cells in FACScan (data not shown), suggesting that CycB1/CYC3
likely is uninvolved in cell cycle control. The results derived from these
experiments thus indicate once again only one essential/dominant mitotic
cyclin, CycB2, and one auxiliary mitotic cyclin, CycB3, in the procyclic form
of T. brucei. This scheme of cyclin-regulated G1/S and
G2/M transition is perhaps the simplest among all those known to
date.
Cellular Morphology of the Cyclin-deficient T. brucei Procyclic Form CellsMicroscopic examination of the CycE1/CyC2-deficient cells indicated an obvious morphological change from the original wild type. A long slender morphology of the cells became obvious after induction of RNAi for 3 days, becoming even longer and more slender after 9 days (Fig. 4A, middle panel). It was apparently the consequence of a blocked G1/S transition. Most of the population (8090%) contained one nucleus and one kinetoplast (1N1K [PDB] ) in each cell as in the wild type cells. But, unlike the wild type cells, about 7% of the population (Fig. 4B, middle panel), appearing shorter and smaller in size, turned out to contain no nucleus but one kinetoplast in each cell upon staining with 4',6-diamidino-2-phenylindole and examination under a fluorescence microscope (Fig. 4A, middle panel). Apparently, an abortive cell division occurred with the parents of these cells, which had a blocked entry from G1 into S phase. This abnormal cell type, termed the "zoid," was observed previously among the trypanosome cells that were treated with aphidicolin or rhizoxin (9, 29) or were deficient in the function of an AAA-type ATPase (30). However, the previously observed zoids only appeared to be smaller than the wild type cells; they did not seem particularly long or slender. We thus named the zoids observed in Fig. 4A, middle panel, the slender zoids.
|
After 24 h of induced RNAi, the CycB2-deficient cells became, however, fat and stumpy compared with the control cells, which had not undergone RNAi induction (Fig. 4A, left panel). The majority of the cells (7080%) contained one kinetoplast and one significantly enlarged nucleus (Fig. 4A, right panel), suggesting that DNA replication occurred but that mitosis failed, leading to the arrest of cell growth. About 13% of the population also turned out to be zoids (Fig. 4B, right panel). However, in contrast to the slender phenotype of zoids observed among the CycE1/CYC2-deficient cells, the CycB2-deficient zoids seemed fat and stumpy, similar to the CycB2-deficient cells that contained both the kinetoplast and the enlarged nucleus (Fig. 4A, right panel). These stumpy zoids, which are apparently the daughters of cells blocked at the stage of mitosis, provided a clear indication that cell division of the procyclic form of T. brucei can occur without a priori nuclear mitotic division. This abortive cell division, which is driven most likely by the segregation of the kinetoplast, provides an intriguing example of cell division without nuclear mitosis.
| DISCUSSION |
|---|
|
|
|---|
The first intriguing observation from our present study is that yeast
PHO80, the closest homologue of trypanosome CycE1/CYC2, is a cyclin present at
a constant level in yeast and is not involved in cell cycle regulation
(7). It binds and activates a
CDK, PHO85, in yeast in responding to phosphate starvation
(7). PHO85 has another
subfamily of cyclin partners, the PCLs, some of which (PCL1, PCL2, etc.) have
a pattern of cell cycle-regulated expression
(5,
6,
31,
32). Although deletion of PCL1
or PCL2 did not lead to any detectable phenotype,
cln1
cln2
pcl1 and
cln1
cln2
pcl2 caused arrest of
yeast cells in the G1 phase, thus suggesting some roles for PCL1
and PCL2 in controlling the G1/S transition
(5,
6). CycE1/CYC2 shares, however,
only a very limited sequence identity with PCL1 (16%) and PCL2 (18%). This
trypanosome cyclin was found previously to be associated with a cdc2-related
kinase (CRK), CRK3, in T. brucei by Van Hellemond et al.
(10) using immunoprecipitation
and a yeast two-hybrid system. CRK3 shares 44% sequence identity with PHO85
and 48% identity with CDC28. It could perform the primary function of PHO85
and/or CDC28 in regulating the G1/S transition in trypanosomes with
its kinase activity regulated primarily by a PHO80-like cyclin,
CycE1/CYC2.
The cyclin box domain of CycB2, the essential mitotic cyclin in trypanosomes, has significant sequence identity with the cyclin box domains of the plant B-type cyclins (Fig. 1B). It is not known whether these plant B-type cyclins also play a dominant role in controlling G2/M transition in the respective plants, but the B-type cyclins in budding yeast are well known for their functional redundancy. Among CLB1, -2, -3, and -4, multiple deletions, which always include the deletion of CLB2, are required to arrest the yeast cell cycle (4). CLB2 shows the highest sequence similarity to the S. pombe B-cyclin homologue CDC13 (20), which bears significant sequence homology with CycB3 from T. brucei (Fig. 1C). However, the latter plays only an auxiliary role in regulating the trypanosome cell cycle through the G2/M transition. It thus has become a futile effort to try to compare the structures and functions of cyclins from different species to gain a more in-depth understanding of the cyclins newly identified in T. brucei. The cyclins may have evolved fairly rapidly in response to changes in a complex extracellular environment to maintain a robust cell cycle progression and metabolism of nutrients (7). The living environment for trypanosomes oscillating between mammalian bloodstreams and tsetse midguts can be relatively stable. A more conserved, and thus more simplistic, primitive, and ancient cyclin system thus still could be operating well in this organism ready to be explored as a model.
Another interesting observation resulting from our present study is the identification of two types of zoids from cell cycle arrest at two different checkpoints. The slender zoid produced from a blocked G1/S transition suggests the occurrence of cell division without an S phase, whereas the appearance of the stumpy zoid under an inhibited G2/M transition indicates cell division without mitosis. Thus trypanosome cells are capable of dividing without progressing through their regular cell cycle. This finding is in agreement with that of Ploubidou et al. (9), who indicated that the nucleus and the kinetoplast in T. brucei each have a distinct S phase followed by a segregation period prior to cell division. The segregation of nuclear DNA depends on the spindle, whereas the flagellum basal bodies are instrumental for kinetoplast DNA separation. T. brucei cytokinesis is apparently not dependent upon either nuclear DNA synthesis or mitosis. Thus among some aphidicolin-treated trypanosome cells, Ploubidou et al. (9) observed basal body segregation, which is apparently capable of dividing the cell into two daughter cells with one of the two forming the zoid. When the expression of an essential G1 cyclin CycE1/CYC2 was knocked down in our present study, kinetoplast segregation and cytokinesis proceeded apparently normally, leading to successful cell division to generate the zoids. However, because of the blocked S phase in these cells, daughter cells either with or without a nucleus assumed a slender appearance (Fig. 4A, middle panel). Conversely, in the absence of an essential mitotic cyclin, CycB2, the cells were blocked from mitosis; nonetheless, cytokinesis proceeded unhindered, and the kinetoplast went through its segregation resulting in cell division. Because the cells already had gone through a normal S phase, daughter cells with or without a nucleus appeared to have an equally full size with a stumpy shape (Fig. 4A, right panel).
This observation leads to an interesting elucidation that trypanosome cell division can be driven by the synthesis and segregation of the kinetoplast alone while the cell cycle is arrested. But, because the dyskinetoplastic bloodstream form of trypanosome cells are known to divide in a normal manner (33, 34), cell division apparently can occur after mitosis in the absence of the kinetoplast. There must be thus two separate schemes capable of driving the division of trypanosome cells. They are apparently independent of each other, and yet they are well coordinated in the wild type cells resulting in cell divisions in a synchronous manner. The molecular mechanisms underlying two different pathways for cell division and the coordination between them may constitute one of the most interesting aspects of trypanosome cell biology.
| FOOTNOTES |
|---|
* This work was supported by National Institutes of Health R01 Grant
AI-21786. The costs of publication of this article were defrayed in part by
the payment of page charges. This article must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section 1734
solely to indicate this fact. ![]()
To whom correspondence should be addressed. Tel.: 415-476-1321; Fax:
415-476-3382; E-mail:
ccwang{at}cgl.ucsf.edu.
1 The abbreviations used are: CDK, cyclin-dependent kinase; RNAi, RNA
interference; RT, reverse transcription; RACE, rapid amplification of cDNA
ends; FACS, fluorescence-activated cell sorting; FACScan, FACS scan; 1N1K
[PDB]
, one
nucleus and one kinetoplast; CRK, cdc2-related kinase. ![]()
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
Z. Li, S. Gourguechon, and C. C. Wang Tousled-like kinase in a microbial eukaryote regulates spindle assembly and S-phase progression by interacting with Aurora kinase and chromatin assembly factors J. Cell Sci., November 1, 2007; 120(21): 3883 - 3894. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Boucher, D. Dacheux, C. Giroud, and T. Baltz An Essential Cell Cycle-regulated Nucleolar Protein Relocates to the Mitotic Spindle Where It Is Involved in Mitotic Progression in Trypanosoma brucei J. Biol. Chem., May 4, 2007; 282(18): 13780 - 13790. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. H. Harris, J. M. Mansfield, and D. M. Paulnock CpG Oligodeoxynucleotide Treatment Enhances Innate Resistance and Acquired Immunity to African Trypanosomes Infect. Immun., May 1, 2007; 75(5): 2366 - 2373. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Li and C. C. Wang Changing Roles of Aurora-B Kinase in Two Life Cycle Stages of Trypanosoma brucei. Eukaryot. Cell, July 1, 2006; 5(7): 1026 - 1035. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Tu, P. Kumar, Z. Li, and C. C. Wang An Aurora Kinase Homologue Is Involved in Regulating Both Mitosis and Cytokinesis in Trypanosoma brucei J. Biol. Chem., April 7, 2006; 281(14): 9677 - 9687. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. G. Rothberg, D. L. Burdette, J. Pfannstiel, N. Jetton, R. Singh, and L. Ruben The RACK1 Homologue from Trypanosoma brucei Is Required for the Onset and Progression of Cytokinesis J. Biol. Chem., April 7, 2006; 281(14): 9781 - 9790. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kulikowicz and T. A. Shapiro Distinct Genes Encode Type II Topoisomerases for the Nucleus and Mitochondrion in the Protozoan Parasite Trypanosoma brucei J. Biol. Chem., February 10, 2006; 281(6): 3048 - 3056. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Kumar and C. C. Wang Dissociation of Cytokinesis Initiation from Mitotic Control in a Eukaryote Eukaryot. Cell, January 1, 2006; 5(1): 92 - 102. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Tu, J. Mancuso, W. Z. Cande, and C. C. Wang Distinct cytoskeletal modulation and regulation of G1-S transition in the two life stages of Trypanosoma brucei J. Cell Sci., October 1, 2005; 118(19): 4353 - 4364. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Kumar and C. C. Wang Depletion of Anaphase-promoting Complex or Cyclosome (APC/C) Subunit Homolog APC1 or CDC27 of Trypanosoma brucei Arrests the Procyclic Form in Metaphase but the Bloodstream Form in Anaphase J. Biol. Chem., September 9, 2005; 280(36): 31783 - 31791. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Tu and C. C. Wang Pairwise Knockdowns of cdc2-Related Kinases (CRKs) in Trypanosoma brucei Identified the CRKs for G1/S and G2/M Transitions and Demonstrated Distinctive Cytokinetic Regulations between Two Developmental Stages of the Organism Eukaryot. Cell, April 1, 2005; 4(4): 755 - 764. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. R. Matthews The developmental cell biology of Trypanosoma brucei J. Cell Sci., January 15, 2005; 118(2): 283 - 290. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Tu and C. C. Wang Coupling of Posterior Cytoskeletal Morphogenesis to the G1/S Transition in the Trypanosoma brucei Cell Cycle Mol. Biol. Cell, January 1, 2005; 16(1): 97 - 105. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. C. Hammarton, M. Engstler, and J. C. Mottram The Trypanosoma brucei Cyclin, CYC2, Is Required for Cell Cycle Progression through G1 Phase and for Maintenance of Procyclic Form Cell Morphology J. Biol. Chem., June 4, 2004; 279(23): 24757 - 24764. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Tu and C. C. Wang The Involvement of Two cdc2-related Kinases (CRKs) in Trypanosoma brucei Cell Cycle Regulation and the Distinctive Stage-specific Phenotypes Caused by CRK3 Depletion J. Biol. Chem., May 7, 2004; 279(19): 20519 - 20528. [Abstract] [Full Text] [PDF] |
||||
|
|