JBC Transcription and Nuclear Factor Monoclonals

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M301577200 on March 31, 2003

J. Biol. Chem., Vol. 278, Issue 23, 20708-20715, June 6, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/23/20708    most recent
M301577200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gralnick, J. A.
Right arrow Articles by Downs, D. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gralnick, J. A.
Right arrow Articles by Downs, D. M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

The YggX Protein of Salmonella enterica Is Involved in Fe(II) Trafficking and Minimizes the DNA Damage Caused by Hydroxyl Radicals

RESIDUE CYS-7 IS ESSENTIAL FOR YggX FUNCTION*

Jeffrey A. Gralnick {ddagger} and Diana M. Downs §

From the Department of Bacteriology, University of Wisconsin-Madison, Madison, Wisconsin 53706

Received for publication, February 13, 2003 , and in revised form, March 28, 2003.
    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Previous work from our laboratory identified YggX as a protein whose accumulation increased the resistance of Salmonella enterica to superoxide stress, reversed defects attributed to oxidized [Fe-S] clusters, and decreased the spontaneous mutation frequency of the cells. Here we present work aimed at determining why the accumulation of YggX correlates with reduced mutation frequency. Genetic and biochemical data showed that accumulation of YggX reduced the damage to DNA by hydroxyl radicals. The ability of purified YggX to protect DNA from Fenton chemistry mediated damage in vitro and to decrease the concentration of Fe(II) ions in solution available for chelation provided a framework for the interpretation of data obtained from in vivo experiments. The interpretation of in vitro assay results, within the context of the in vivo phenotypes, was validated by a mutant variant of YggX (C7S) that was unable to function in vivo or in vitro. We propose a model, based on data presented here and reported earlier, that suggests YggX is a player in Fe(II) trafficking in bacteria.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell physiology is characterized by the integration of numerous metabolic and biochemical processes. This integration provides the efficiency and adaptability that are associated with microbial metabolisms. For instance, organisms that utilize molecular oxygen must minimize the potential consequences of toxic oxygen species, including hydrogen peroxide (H2O2) and superoxide () and hydroxyl radicals (OH), which are generated during normal aerobic metabolism (1). Superoxide mediates the oxidation of labile [4Fe-4S] cluster-containing proteins (2), with the release of ferrous iron (Fe(II)) and H2O2. In addition to inactivating the enzyme, this process generates two substrates for the Fenton reaction (Fe(II) + H2O2 + H+ -> Fe(III) + H2O + OH), the biggest generator of hydroxyl radicals in the cell. Unlike the oxygen species H2O2 and , hydroxyl radicals have sufficient redox potential to oxidize both sugar and base residues in DNA (3, 4, 5, 6). Left unchecked, this reactivity results in a high level of specific mutagenic lesions in the cell. Although bacterial cells have evolved several ways to eliminate toxic oxygen species (reviewed in Refs. 1 and 7) or to repair damage when it occurs (8, 9), there is a need to sequester the cellular Fe(II) that can participate in Fenton chemistry to prevent excessive damage to DNA and other macromolecules.

The control of Fenton chemistry and the resulting damage is complicated by the multiple roles of iron in cellular metabolism. Although iron exists in two stable oxidation states, Fe(II) and Fe(III), nearly all non-biological iron is in the highly insoluble ferric (Fe(III)) form. Bacteria circumvent solubility problems by the use of extracellular Fe(III)-specific siderophores. Siderophore-Fe(III) complexes are transported into the cell where the iron is reduced to Fe(II) and released from the siderophore (reviewed in Ref. 10). Additionally, Fe(II) in the environment can be directly transported (11). The Fe(II) in the cell that is readily available for metabolic activity has been referred to by a variety of names, including transit, low molecular weight, or "free" iron pool (2, 12, 13). Processes such as regulation, cofactor biosynthesis, and iron storage draw from this pool. An unresolved question in iron trafficking in bacteria focuses on what the iron in this transit pool is liganded to (10). It has been suggested that ATP, GTP, pyrophosphate, polypeptides, and others may be liganded to the free iron and thus facilitate trafficking between siderophores and cellular processes requiring Fe(II) (12). Studies of the status of the free iron pool have been limited by the techniques available, most of which rely to some extent on chelation. Results of these experiments necessarily reflect the affinities of the chelators employed, making it difficult to obtain general insights on the number and/or species of the ligands involved (13). However, the chelatable nature of this iron suggests that, unlike iron bound to storage proteins or in functional proteins, free iron can have a cytotoxic effect. Therefore, a major challenge the cell faces in maintaining iron homeostasis is to (i) sequester Fe(II) from participating in detrimental Fenton chemistry and (ii) make Fe(II) easily available for the cellular processes in which it is required.

The ferric uptake regulator (Fur)1 protein is responsible for sensing Fe(II) levels inside the cell and regulating gene expression accordingly (reviewed in Refs. 14 and 15). It was recently suggested that a central function of Fur is sequestration of Fe(II). Various phenotypes associated with null mutations in fur have been attributed to a concomitant increase in cellular Fe(II) levels, one being increased mutagenesis (16, 17). It has been suggested that, at least in part, the increased mutagenesis is due to the lack of Fur to sequester the free iron (18).

Previously we reported that accumulation of the YggX protein resulted in (i) increased resistance to superoxide, (ii) decreased in spontaneous mutation frequency, and (iii) restoration of aconitase activity in various mutant backgrounds (i.e. gshA) (19). The work presented herein was initiated to determine the mechanism of decreased mutagenesis caused by accumulation of the YggX protein. The results are consistent with a model in which the YggX protein has a role in sequestering cellular Fe(II), making it available for Fe-dependent cellular processes while keeping it removed from Fenton chemistry. We suggest that YggX is a component of the iron-trafficking machinery in Salmonella enterica and other bacteria.


    EXPERIMENTAL PROCEDURES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Strains, Media, and Chemicals
All strains used in this study are derivatives of DM1, an S. enterica serovar Typhimurium LT2 isolate and are described in Table I. MudJ refers to the Mud1734 insertion element (20), and Tn10d(Tc) refers to the transposition-defective mini-Tn10 described by Way et al. (21). NCE medium supplemented with MgSO4 (1 mM) (22) and glucose (11 mM) or lactose (6 mM) was used as minimal media. Luria-Bertani (LB) media was used as rich media. Difco BiTek agar was added to a final concentration of 1.5% for solid medium. All chemicals were purchased from Sigma-Aldrich (St. Louis, MO).


View this table:
[in this window]
[in a new window]
 
TABLE I
Characteristics of strains used in this study

 

Genetic Methods: Transduction Methods
The high frequency generalized transducing mutant of bacteriophage P22 (HT105/1, int-201) (23) was used in all transductional crosses. The method for transduction and subsequent purification of transductants has been previously described (24). Isogenic strains were constructed with standard genetic techniques utilizing linked markers. Presence of the yggX* mutation was confirmed by Western analysis showing accumulation of YggX protein (19, 25).

Quantitative Western Analysis
A standard curve was generated using purified YggX in concentrations from 0.4 to 8 ng of protein, visualized by Western analysis with anti-YggX antibody (19). Whole cells were harvested from LB overnight and mid-log phase cultures (A650 = 0.550). Aliquots (2–16 µl for overnight and 20–100 µl for mid log) were loaded directly into SDS-PAGE gels and transferred to a nitrocellulose membrane for visualization through Western analysis (26). Colony forming units (CFUs) were determined for both overnight and mid-log cultures by dilution plating, and 1 CFU was assumed to equal one cell. Molarity and amount of YggX per cell were determined using the standard curve generated from pure protein, with the number of cells loaded into the SDS-PAGE gel, and with the calculated volume of a single cell being 3.2 x 1015 liter (27).

Quantification of DNA Damage
Measurement of Polymerase-blocking DNA Lesions—Damaged template in a PCR reaction results in less product compared with undamaged template by blocking DNA polymerase (28). This correlation has been previously used to quantify DNA damage by PCR (29, 30). Genomic DNA was purified using an Easy-DNA kit (Invitrogen). Template DNA concentrations were calculated using A260 spectroscopic readings and were as stated in Fig. 1. 100 pmol of each primer was used in all reactions. Primer sequences (5' to 3') and expected product sizes are as follows: CGTAATTCGGGATCCGCG and TCCACGTCAGCGGCGGTTTTAC, 4470-bp product (thiC-thiG); CATCGCAGGTAAAGTCGTCTCTAAA and TCCCGCGTAAACAATCAATAAAACA, 8301-bp product (rpoB-thiH). Amplification products were generated using the Z-Taq enzyme (TaKaRa Bio Inc.) according to specifications. Me2SO (2%) and glycerol (1%) were present and required for the reactions. Reactions were performed in a GeneAmp 2400 PCR system (PerkinElmer Life Sciences) using the following conditions for PCR. For the 4.5-kb product: 94 °C for 2 min; 33 cycles of 94 °C for 10 s and 68 °C for 1 min 20 s; and final extension at 70 °C for 7 min. For the 8.3-kb product: 92 °C for 2 min; 35 cycles of 92 °C for 20 s and 68 °C for 2 min and 20 s; and final extension at 70 °C for 7 min. Amplification products were run on a 1% agarose gel, stained with ethidium bromide, visualized using a Fotodyne gel documentation system, and quantified using Gel-Pro Analyzer software package (Media Cybernetics). The amount of PCR product was proportional to the amount of DNA template from DM5105 over the concentrations used in these experiments (data not shown).



View larger version (32K):
[in this window]
[in a new window]
 
FIG. 1.
YggX-accumulating strains provide better DNA template for quantitative PCR. PCR reaction conditions are described under "Experimental Procedures." The reactions shown in lanes 1–8 are identical with the exception of the source and quantity of the template. Lanes 1–4 contain DNA isolated from strain DM5104; lanes 5–8 contain DNA from DM5105. Different amounts of template DNA were added as reflected on the figure with lanes 1 and 5 containing 1.1 ng, lanes 2 and 6 containing 0.74 ng, lanes 3 and 7 containing 0.37 ng, and lanes 4 and 8 containing 0.185 ng.

 

DNA Damage Quantification Kit, AP Site Counting—Genomic DNA was isolated as described above. Abasic (AP) lesions in the genomic DNA were quantified using a DNA damage quantification kit (Dojindo Molecular Technologies) following the protocol provided. Data reported are the average and standard deviation of results with genomic DNA isolated from three independent cultures.

Mutagenesis Constructs
Fusion Construction—Construction of lacZ mutations based on the observation of Cupples and Miller of codon invariance at position 461 (31) into a cassette transducible in S. enterica serovar Typhimurium as described elsewhere (32). Strains provided by H. Ochman contained MudF insertions at minute 40.2 in the S. enterica genome (tre-152::MudF), representing constructs CC103 (GC:CG reporter) and CC104 (GC:TA reporter). These constructs were transduced via P22 into strains DM5104 and DM5105, resulting in strains DM6222, DM6223, DM6911, and DM6912, respectively.

Lac+ Revertant Analysis—Aliquots (20 µl) of LB cultures, started from single colonies and incubated overnight at 37 °C, were used to inoculate 10-ml cultures of minimal glucose media. For each strain, ten independent cultures were grown overnight at 37 °C and plated in the following ways: For CC103 reporter strains, 10 ml (109 CFU) of culture was centrifuged and resuspended in 0.4 ml of 1x NCE and plated onto a single minimal medium plate with lactose as the sole carbon and energy source. Plates were incubated for 1–2 days at 37 °C, and colonies that arose were scored as one Lac+ CFU. Prior to centrifugation, a small volume (10 µl) from the 10-ml overnight culture was dilution-plated onto minimal glucose plates to determine total CFU/ml. The procedure for CC104 reporter strains was the same as above except that 250 µl (2.5 x 107 CFU) was plated from each independent overnight culture onto five minimal lactose plates.

Biochemical Assays
A/G-specific Adenine Glycosylase (MutY) Activity—A/G-specific adenine glycosylase (MutY) activity was assayed using conditions reported by Lu et al. (33) and oligonucleotide substrates (Chang-68 and Chang-69) described by Gu and Lu (34). Oligonucleotides were purchased and PAGE-purified by Integrated DNA Technologies. Protocols for substrate generation using 32P-labeled dCTP and assay procedure were followed as described previously (33, 34) with the exception that reductant was not used in the assay buffer. Cell extracts were prepared from overnight LB cultures via sonication (two 10-s pulses consisting of 0.5-s bursts, with ~1 min incubation on ice between pulses), clarified by centrifugation (10,000 x g for ~5 min), transferred to new microcentrifuge tubes, and then frozen at –20 °C until used. Protein was quantified via Bradford assay (35). The Escherichia coli mutY null strain (CSH117) was obtained from the E. coli Genetic Stock Center (available at cgsc.biology.yale.edu).

{beta}-Galactosidase Activity—Overnight LB cultures of strains DM6762 and DM6763 were used as inoculum (1:100) into 5 ml of fresh LB containing various concentrations of FeCl3. Resulting cultures were grown with shaking at 37 °Cto ~0.4 A650, pelleted, resuspended in 5 ml of minimal 1x NCE, and placed on ice until assayed. The assay was performed and quantified as described by Miller (36).

Construction of YggXC7S Overexpression Plasmid
The yggX gene from S. enterica was amplified from a plasmid containing the wild-type gene (pYGGX3A) (19) using primers that were designed to (i) eliminate the stop codon, (ii) introduce an NdeI restriction site that overlaps the start codon, and (iii) change the amino acid at position seven from cysteine to serine. The sequence of the PCR primers used (5' to 3') was as follows: YggX-NoTerm, TTTTTTATCTTCCGGCGT and YggX-C7S, CATATGAGCAGAACGATTTTTTCTACTT. The amplification product was then digested with NdeI, gel-purified, and ligated into the NdeI and SmaI sites of the pTYB2 vector (New England BioLabs). The resulting clone (pTYB2-YggX-C7S) was verified by restriction analysis and sequencing (data not shown).

YggX and YggXC7S Overexpression and Purification
Vectors containing both mutant and wild-type gene sequences were electroporated into strain BL21({lambda}DE3) of E. coli. Proteins were purified using chitin affinity chromatography with the IMPACT T7 Kit (New England BioLabs). Overexpression and purification were performed as described by the manufacturer using 30 mM dithiothreitol in the on-column cleavage step. The elution and cleavage process was performed twice, increasing the yield. Protein was concentrated using an Amicon Stirred Ultrafiltration Cell (Millipore) with a 3000 molecular weight cutoff filter then dialyzed into 10 mM Tris (pH 7.8) overnight with three buffer changes. The carboxyl terminus of proteins isolated in this manner contain a single glycine residue not present in the native protein.

In Vitro Assay for DNA Damage Caused by Hydroxyl Radicals
Assay conditions similar to those used by Zhao et al. (37) to demonstrate protection of DNA from oxidative damage by the Dps protein were used. The assay mixture contained Tris buffer (pH 7.8, 20 mM), ferrous sulfate (FeSO4, 50 µM), DNA (pVJS1, 1.8 µM), YggX protein (as indicated in Fig. 3), and hydrogen peroxide (H2O2, 880 mM) in a final volume of 20 µl. FeSO4 was diluted from a 100 mM stock made fresh in double-distilled water (ddH2O) prior to every assay. Plasmid pVJS1 (10,850 bp) was purified with a Wizard Plus SV Miniprep kit (Promega). Buffer, DNA, FeSO4, and protein were mixed, with ddH2O added to make a final volume of 18 µl. After incubation at room temperature for 5 min, H2O2 (2 µlofan8.8 M solution) was added to initiate the reaction. Following incubation at room temperature for 30 min, 3 µl of loading buffer was added, and 20 µl of the reaction mix was loaded into a 1% agarose gel, stained with ethidium bromide, and visualized with a Fotodyne gel documentation system.



View larger version (66K):
[in this window]
[in a new window]
 
FIG. 3.
YggX prevents Fenton chemistry-mediated DNA damage in vitro. Shown is a 1% agarose gel onto which was loaded various reaction mixtures. The components added are indicated above the relevant lanes, with protein increasing as indicated. When present, FeSO4 was at 50 µM and H2O2 was at 880 mM final concentration. The top half of the gel contained YggXC7S as the protein, and the bottom half of the gel included wild-type YggX. Concentration of both proteins increased from 2.6 to 25.7 µM. Bands I and II correspond to control plasmid pVJS1, and bands III and IV correspond to plasmid remaining after treatment with Fenton components. The mobility difference between these bands has not been addressed, but could be due to components (e.g. Fe(II)) present in the assay mixture but not in the control.

 

Detection of Chelatable Fe(II) in Vitro
In a microtiter plate, Tris buffer (pH 7.8, 8.5 mM final concentration), protein (concentrations as indicated in Fig. 4), and FeSO4 (made fresh prior to each assay, 150 µM final concentration) were added to a final volume of 180 µl and incubated at room temperature for 10 min. Chelatable Fe(II) was detected by adding 20 µl of 1,10-phenanthroline (6 mg/ml in 50% EtOH), incubating for an additional 10 min at room temperature, and measuring A510 using a SpectaMAX Plus plate reader (Molecular Devices). The Bradford method of quantifying protein can be inaccurate when detecting amounts of a single protein species (38); therefore, no inferences regarding stoichiometry have been made.



View larger version (8K):
[in this window]
[in a new window]
 
FIG. 4.
YggX decreases chelatable Fe(II) in solution. Varying concentrations of protein were incubated with 150 µM FeSO4 for 10 min. 1,10-Phenanthroline was then added, and the absorbance at {lambda}510 was used to measure chelated Fe(II). Panel A shows the results when YggX was used, and panel B shows the results when YggXC7S was used. Fe(II) concentrations reported were calculated from a standard curve using FeSO4 and 1,10-phenanthroline, with no added protein. Data presented are the combined results of three independent experiments.

 


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Accumulation of YggX Protein Is Strain-specific—Previous work described an isogenic pair of strains, DM5104 and DM5105, differing only in the level of YggX protein that accumulated (19). YggX was not detectable in strain DM5104 by immunoblot analysis with polyclonal antibodies, even though the complete wild-type yggX coding sequence was present in the chromosome. Control experiments showed that the antibodies used could detect as little as 50 pg of pure YggX protein. Quantitative immunoblot analysis performed with mid-log cultures showed that strain DM5105 accumulated 0.16 mM YggX (~8,000 copies of the protein/cell); in stationary phase cells, ~12,000 copies of YggX/cell were present (data not shown).

It is worth noting that E. coli K12 and all the wild-type isolates of the S. enterica serovar Typhimurium LT series (#1–22) obtained from the Salmonella Genetic Stock Center accumulated YggX protein to levels qualitatively similar to that of strain DM5105 (19).2 Strain DM5104, rather than a strain lacking the yggX gene, was used for the work reported here, because (i) it contains the yggX allele from the LT2 isolate that is the progenitor of the majority of our laboratory strains and (ii) its use avoided possible detrimental consequences caused by a complete lack of the protein.3 In other words, the work described here utilizes two genetic backgrounds that differ only in the level of YggX accumulation. The physiological differences between these strains can thus be attributed to the level of YggX and used to probe the function of this protein in vivo.

Strains Expressing YggX Protein Accumulate Less DNA Damage—Previous genetic analyses showed that strains accumulating the YggX protein had a lower frequency of spontaneous mutations (19). To probe the basis for this difference, physical damage of the chromosomal DNA was determined.

The method of Van Houten et al. (29) was used to determine the relative number of polymerase-blocking lesions in the DNA of strains DM5104 and DM5105. Chromosomal DNA from each strain was used as reaction template for quantitative PCR reactions (28, 29). It is known that the concentration of polymerase-blocking lesions in the reaction template is inversely proportional to the quantity of amplified product (29). Two products from the 90-min region of the chromosome were amplified. One product was 4.5 kb (primers flanking thiC and thiG); the second one was 8.3 kb (primers in rpoB and thiH). Fig. 1 displays the results of this experiment when the 4.5-kb fragment was amplified. When equal amounts of template DNA were used, the quantity of amplified product from DM5104 DNA was significantly less than when DNA from strain DM5105 was used. Similar results were found when the larger PCR product was monitored (data not shown). These results were consistent with the presence of more polymerase-blocking lesions in the strain that failed to accumulate YggX.

Chromosomal damage was independently measured to determine the concentration of abasic (AP) sites in the DNA (DNA Damage Quantification kit, Dojindo Molecular Technologies, Inc.). AP sites are common lesions in DNA and are thought to be intermediates in mutagenesis. Genomic DNA from strains DM5104 or DM5105 was treated with aldehyde reactive probe reagent (a compound that reacts specifically with an aldehyde group in the open ring form of an AP site), resulting in biotin-tagged AP sites that are quantified using an avidin-biotin assay (39). In this assay, DNA from strain DM5104 consistently contained a higher concentration of AP lesions than that from DM5105. In a representative experiment, DM5105 DNA contained 3.7 ± 0.6 AP sites per 105 bp compared with 10.2 ± 2.6 sites per 105 bp found in DNA isolated from the isogenic strain (DM5104) that contained no detectable YggX. The results of these two independent approaches demonstrated that fewer lesions in the DNA were present when a strain accumulated YggX and provided an explanation for the genetic results previously reported (19).

Accumulation of YggX Specifically Decreased the Frequency of GC to TA Transversion Mutations—The specificity of the spontaneous mutations absent when YggX accumulated was addressed using lacZ reporter constructs. Specific lacZ reporters, originally constructed in E. coli by Cupples and Miller (40) and reconstructed into a transposable element in S. enterica by Hudson et al. (32), were obtained. In otherwise Lac strains carrying these reporters, the appearance of Lac+ colony-forming units reflects a specific codon change (40). The choice of specific reporters was prompted by the effect of YggX on superoxide stress (19), the proximity of yggX to the DNA glycosylase encoded by mutY (41), and the induction of yggX expression by superoxide stress (42). Two constructs were used for these studies, one that monitored GC to TA transversion mutations (CC104) and one that detected GC to CG transversion mutations (CC103). The GC to TA transversions can be the result of hydroxyl radical attack and are preventable by MutY activity (31, 43), whereas GC to CG transversions are neither the result of oxidative damage nor prevented by MutY activity (31). Each of these constructs (located in the chromosomal tre locus (32)) was introduced by transduction into strains DM5104 and DM5105, generating four relevant strains. Each strain was grown overnight in minimal glucose medium and a sample was plated on medium with lactose as the sole carbon and energy source. The number of Lac+ colonies observed was determined as a function of colony-forming units (CFU). Ten independent cultures of each strain were analyzed; a summary of the results is presented in Table II. These data showed that the parent background (low level of YggX) accumulated significantly more GC to TA than GC to CG lesions. The number of GC to CG mutations recovered from the wild-type (DM6911) and the isogenic strain overproducing YggX protein (DM6222) were similar (Table II). However, the number of GC to TA transversions detected in the two strains (DM6912 and DM6223) differed significantly, with the accumulation of YggX protein correlating with a decrease of over 40-fold in this class of mutations (Table II). Interestingly, the strain with no detectable YggX displayed a mutation profile similar to that reported for mutY mutants, whereas the strain accumulating YggX produced a profile more similar to the wild-type strain in other studies (40). This mutant correlation was consistent with the previous demonstration that many laboratory wild-type strains, in particular E. coli K12, accumulate YggX (data not shown).


View this table:
[in this window]
[in a new window]
 
TABLE II
YggX accumulation decreases the frequency of GC to TA transversion mutations

 

MutY Activity Is Not Increased in Strains Accumulating YggX—Taken together, the results above were consistent with fewer MutY-repairable lesions accumulating in strains with detectable levels of YggX protein. Two scenarios were considered to explain these results: (i) strains accumulating YggX protein had higher MutY enzyme activity resulting in an increased repair of the lesions, or (ii) less damage occurred to the DNA in a strain accumulating YggX protein. The first scenario was considered due to the physical proximity of yggX and mutY genes in the genomes of E. coli, S. enterica, and many other bacteria and because, at least under some conditions, yggX and mutY are co-transcribed (Ref. 41 and data not shown). To distinguish between the two possibilities, MutY enzymatic activity was assayed in crude cell-free extracts by providing A:G-mismatched double-stranded DNA substrate and monitoring MutY-dependent generation of cleaved product as described (33). Fig. 2 shows representative MutY enzyme activity assays using crude cell-free extracts of S. enterica strains DM5104 and DM5105 and an E. coli mutY null mutant strain (CSH117). When equal quantities of protein were added to the reaction mixture, no significant difference in MutY activity was found between the two S. enterica strains (lanes A and B), as reflected by the similar intensities of the resulting product bands (less than 10% difference based on quantification with a Cyclone Storage Phosphor System). Importantly, the E. coli mutY strain displayed no activity (lane C) nor did a sample without added cell extract (data not shown). The demonstration that MutY activity did not differ between the two strains suggested that less damage to the DNA was occurring due to the presence of elevated levels of YggX.



View larger version (61K):
[in this window]
[in a new window]
 
FIG. 2.
Accumulation of YggX does not change MutY activity. Clarified cell-free extracts were assayed for MutY activity as described under "Experimental Procedures." Oligonucleotide substrate was labeled with 32P, and the assay mixture was run on a 14% denaturing acrylamide gel, detected by phosphorimaging analysis as shown. Substrate (S) and product (P) bands are indicated. Lanes A and B show reaction mixes that contained cell extract (16 µg) from strains DM5104 and DM5105, respectively. Lane C shows the reaction mix that contained cell extract (16 µg) from an E. coli strain lacking mutY (CSH117).

 

Variant Protein YggXC7S Is Nonfunctional in Vivo—DNA damage detected by both genetic and physical means could be explained by hydroxyl radical-mediated attack. In considering intracellular Fenton chemistry the primary source of these radicals (44, 45), residues of YggX that could be involved in this process were tentatively identified. The single cysteine residue present in YggX (Cys-7) was targeted for substitution, because it is conserved in all YggX homologs and cysteine residues are highly reactive and often involved in metal coordination. A plasmid containing the allele of yggX encoding the YggXC7S variant protein failed to eliminate the nutritional requirements of a gshA mutant strain (data not shown and Ref. 19). Immunoblot analysis determined that the YggXC7S protein was stable and accumulated to similar levels as the wild-type protein when the wild-type gene was provided on a plasmid (data not shown). On the basis of these data, it was concluded that residue Cys-7 in YggX was essential for function in vivo.

YggX Prevents Fenton Chemistry in Vitro—To determine whether the proposed effect of YggX on mutagenesis was due to a direct role in reducing Fenton chemistry, both the YggX and YggXC7S proteins were isolated. The YggXC7S protein served as control to determine the significance of in vitro results with respect to the role of the YggX protein in vivo. DNA damage by hydroxyl radicals was assessed in vitro by monitoring the degradation of supercoiled plasmid DNA in the presence of Fe(II), H2O2, and increasing amounts of YggX or YggXC7S protein. The data showed that YggX protected DNA from damage (Fig. 3). In contrast, the YggXC7S variant protein was significantly less effective than the YggX protein, providing only slight protection at high protein concentrations. Assay mixtures that containing heat-inactivated YggX protein failed to protect DNA from degradation (data not shown). The clear differences between the mutant and wild-type proteins in this assay were consistent with YggX directly reducing damage to DNA caused by Fenton chemistry.

YggX Masks Chelatable Fe(II) in Vitro—Protection of DNA against hydroxyl radical damage by YggX could be afforded by direct interactions between YggX and DNA, or indirectly by preventing hydroxyl radical formation, possibly by chelating Fe(II). YggX lacks any motifs suggestive of direct physical interactions with DNA, hence the ability of YggX to bind Fe(II) was considered. To address the hypothesis that YggX can bind/sequester Fe(II), the ability of both the YggX and YggXC7S proteins to decrease chelatable Fe(II) in solution was tested. For this experiment 1,10-phenanthroline (1,10-phen) was used to detect chelatable Fe(II). Complex formation of Fe(II) and 1,10-phen results in an increased absorbance at 510 nm. YggX, but not the YggXC7S variant, decreased the amount of Fe(II) in a solution that was available to bind 1,10-phen (Fig. 4). Furthermore, the amount of Fe(II) detectable with 1,10-phen decreased as a function of the amount of protein added. One interpretation of these results is that YggX binds Fe(II) and prevents it from binding to 1,10-phen. No absorption at 510 nm was detected when either protein was incubated with 1,10-phen in the absence of Fe(II), indicating that neither protein directly affected absorption of this compound at 510 nm.

Does Accumulation of YggX Alter the Accessible Level of Fe(II) in Cells?—The in vitro results above suggested a model in which accumulated YggX would alter the free pool of Fe(II) in the cell. If this idea were correct, the level of YggX protein would be predicted to have an effect on the transcription of genes whose expression depends on the Fe(II) pool in the cell through their regulation by the Fur protein. To probe the physiologically relevant level of Fe(II) in the cells, in vivo experiments were preformed. Fur protein binds Fe(II) and represses transcription of various target genes, among them entB (46). An entB::MudJ fusion was introduced into both DM5104 and DM5105 strains and used to indirectly measure the level of Fe(II) present in the cell. {beta}-Galactosidase activity was measured in the resulting two strains (DM6762 and DM6763) grown in rich medium with varying levels of additional FeCl3. Although entB encodes isochorismatase, an enzyme required for the synthesis of the siderophore enterobactin, other siderophores allow the FeCl3 provided in the medium to be taken up by the cells (47, 48). Data in Fig. 5 show the expected correlation between the expression of entB and the concentration of exogenous Fe(III). The data in Fig. 5 also show that accumulation of YggX protein lowered the levels of lacZ expression from the fusion. Introduction of a fur mutation in each of these strains resulted in constitutive expression (~300 Miller units), indicating that the differential regulation being observed was mediated by Fur. Taken together, these results show that, in a strain accumulating YggX, a lower level of exogenous iron was needed to repress the Fur regulon. A simple interpretation of this result is that more Fe(II) was available to bind Fur in the presence of accumulated YggX.



View larger version (14K):
[in this window]
[in a new window]
 
FIG. 5.
Accumulation of YggX changes the level of exogenous iron required to repress entB transcription. Two strains carrying an entB::MudJ fusion but accumulating different levels of YggX, DM6762 (•, low YggX), and DM6763 ({circ}, high YggX) were grown in LB with the indicated concentrations of exogenous FeCl3. The cultures were assayed for {beta}-galactosidase as described under "Experimental Procedures." The activity is an average of three independent cultures, with standard deviation indicated by error bars.

 

In summary, strains with more YggX had a lower frequency of Fe(II)-mediated Fenton chemistry, suggesting less free Fe(II) was present in the cell. However, the in vivo results with the entB reporter suggested that high levels of YggX lead to more free Fe(II) available to mediate Fur repression.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Previous work showed that increased accumulation of the YggX protein in S. enterica altered several metabolic processes, resulting in three observable phenotypes. These phenotypes were (i) increased resistance to superoxide stress, (ii) restoration of enzymatic defects associated with oxidized [Fe-S] clusters, and (iii) decreased spontaneous mutation frequency (19). The work presented here was initiated to understand the mechanism of the correlation between YggX accumulation and mutation frequency. Results of both genetic and biochemical approaches indicated that, in cells accumulating YggX, fewer DNA lesions generated by hydroxyl radical attack occurred.

Working Model Suggests YggX Is Involved in Iron Trafficking—Fig. 6 shows a model that explains both the in vivo and in vitro data reported here. With this model we suggest that YggX is a player in iron trafficking and is a Fe(II) binding ligand in the free iron pool. This model is able to reconcile the two in vivo results that superficially suggested opposing levels of free Fe(II) in the cell when YggX accumulates. The reported decrease in mutagenesis could be interpreted to suggest there is a lower level of free Fe(II) in the cell, whereas the expression studies showing less entB transcription suggested an increased level of free Fe(II). We suggest YggX has many of the properties that have been proposed for a component of trafficking that binds the free iron pool (10, 12, 13). Although the in vitro results showed YggX could sequester Fe(II), no iron was associated with the purified, dialyzed protein (data not shown). This result is consistent with a low affinity association that might be expected for a ligand to allow the release of Fe(II) to relevant cellular processes such as Fur regulation and [Fe-S] cluster synthesis/repair.



View larger version (19K):
[in this window]
[in a new window]
 
FIG. 6.
Working model depicting the ability of YggX to affect the pool of free iron in the cell. The free iron pool depicted here includes Fe(II) from exogenous (i.e. siderophore) and endogenous (i.e. oxidation of labile [Fe-S] clusters) sources that is available for Fe(II)-dependent metabolic processes and able to undergo Fenton chemistry. In a cell with low levels (or completely lacking) of YggX, there is an increased frequency of Fenton chemistry, drawing some Fe(II) away from other cellular processes, thus damaging DNA and other macromolecules (A). However, in a cell that accumulates YggX, this protein is bound to the Fe(II). This association prevents the Fe(II) from causing DNA lesions via Fenton chemistry and thus shifts flux of Fe(II) to cellular processes that utilize it (B). Thus YggX serves as a shuttle to traffic free Fe(II) to the processes that productively utilize it without allowing it to present a danger to other cellular components via Fenton chemistry. Though not depicted in this model, other components may also influence trafficking of Fe(II).

 

YggX Can Sequester Fe(II) in Vitro—The demonstration that purified YggX could decrease the amount of Fe(II) detectable in solution by 1,10-phen (Fig. 4) was critical in developing the model presented for in vivo function. Results of this experiment were interpreted to mean that YggX can bind Fe(II), at least to the extent that it becomes unavailable to 1,10-phen. The model we propose for the role of YggX suggests an affinity that is necessarily less than that of other proteins and processes that require access to Fe(II) in the cell. Without additional experimentation it is not possible to determine an affinity for the association of YggX with iron nor suggest the stoichiometry of binding. Although the precise implications of the in vitro results cannot be determined, they provide biochemical support for the function of YggX that is proposed in the working model.

Cys-7 Is Essential for the Function of YggX—The validity of considering the in vitro activity of YggX described here as relevant to the in vivo situation is justified by the behavior of a mutant protein. When a single amino acid change was generated in the protein, the resulting YggXC7S variant was dramatically less active in both assays used to test function of YggX in vitro. Significantly, the mutant protein failed to generate the phenotypes associated with the wild-type protein in vivo (Ref. 19 and data not shown). Taken together these results allowed the conclusion that the in vitro activity reported was relevant to in vivo function and that the Cys-7 residue is essential for YggX function, possibly by serving as a ligand for Fe(II).

Lack of YggX Has Led to Detection of Subtle Effects on [Fe-S] Synthesis—To provide a ligand for the free Fe(II) pool, a protein would be expected to be abundant. The strains used herein that accumulate YggX, contained between 8,000 and ~12,000 copies per cell depending on growth stage. Significantly, a similar level of YggX was detected in other S. enterica serovar Typhimurium wild-type strains and the one strain of E. coli K12 that was tested (data not shown). This result suggests that high levels of YggX are more the norm and indicates that the LT2 strain isolate that we have utilized heavily in our work (DM1) is "mutant" with respect to levels of YggX.

The model presented suggests that a strain with low levels of YggX would be more sensitive to small changes in [Fe-S] cluster metabolism, because Fe(II) trafficking to biosynthetic enzymes and repair systems is not operating at full efficiency. Work from our laboratory has shown that mutations in apbC, apbE, and gshA result in [Fe-S] cluster defects in strains with low levels of YggX (19, 49, 50). Accumulation of YggX is sufficient to suppress both the nutritional and biochemical defects associated with these mutations (19).3 Thus, the serendipitous use of a strain with low YggX accumulation has been instrumental in our ability to identify new players in a central cellular process.

YggX Homologs in Other Organisms—The gene encoding YggX has been found in over 40 bacterial genomes thus far (~20% of both complete and unfinished genome sequences). YggX is mainly distributed in pathogens from the {gamma}-proteobacteria (e.g. Salmonella, Escherichia, Pseudomonas, and Erwinia) division, with a few from the {beta}-proteobacteria (e.g. Neisseria and Ralstonia) division. A common obstacle both plant and animal pathogens face is iron deprivation due to the action of the host (reviewed in Refs. 10 and 51). Organisms with YggX may have an advantage under conditions of iron limitation by trafficking the metal more efficiently in addition to sequestering free Fe(II) from toxic oxygen species released as a defense by the host. Moreover, YggX is found in several symbiont isolates (Wigglesworthia, Buchnera, and Azotobacter) and in some bacteria with metal-oriented lifestyles (Shewanella onidensis and Acidithiobacillus ferrioxidans). It is tempting to speculate that YggX has evolved as a means to evade damage caused by oxidative bursts from the host or symbiont and/or protect organisms from the toxicity generated by redox-active metals.

In summary, this work has identified an additional protein involved in bacterial iron homeostasis. The biochemical and genetic data presented herein support the model that the YggX protein serves as a link between iron transport and cellular processes requiring iron and thus may be a missing link in iron trafficking.


    FOOTNOTES
 
* This work was supported in part by National Science Foundation Grant MCB0096513 and National Institutes of Health Grant GM47296. The J. S. McDonnell Foundation also provided funds from a 21st Century Scientist Scholars Award. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

{ddagger} Supported by the Jerome J. Stefaniak Predoctoral Fellowship from the Department of Bacteriology. Back

§ To whom correspondence should be addressed: Dept. of Bacteriology, 1550 Linden Dr., Madison, WI 53706. Tel.: 608-265-4630; Fax: 608-262-9865; E-mail: downs{at}bact.wisc.edu.

1 The abbreviations used are: Fur, ferric uptake regulator protein; CFU, colony-forming unit(s); AP, abasic; 1,10-phen, 1,10-phenanthroline; NCE, no carbon E medium. Back

2 J. A. Gralnick, D. M. Wolfe, and D. M. Downs, unpublished. Back

3 J. A. Gralnick and D. M. Downs, unpublished observations. Back


    ACKNOWLEDGMENTS
 
We acknowledge Vincent Starai for providing plasmid DNA used in the protection experiments shown in Fig. 3. We thank Dr. H. Beinert and Dr. J. Escalante-Semerena for helpful discussion and Dr. H. Ochman and Dr. J. Roth for providing bacterial strains.



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Storz, G., and Imlay, J. A. (1999) Curr. Opin. Microbiol. 2, 188–194[CrossRef][Medline] [Order article via Infotrieve]
  2. Keyer, K., and Imlay, J. A. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 13635–13640[Abstract/Free Full Text]
  3. Brawn, K., and Fridovich, I. (1981) Arch. Biochem. Biophys. 206, 414–419[CrossRef][Medline] [Order article via Infotrieve]
  4. Lesko, S. A., Lorentzen, R. J., and Ts'o, P. O. (1980) Biochemistry 19, 3023–3028[CrossRef][Medline] [Order article via Infotrieve]
  5. Hutchinson, F. (1985) Prog. Nucleic Acids Res. Mol. Biol. 32, 115–154[Medline] [Order article via Infotrieve]
  6. Aruoma, O. I., Halliwell, B., Gajewski, E., and Dizdaroglu, M. (1989) J. Biol. Chem. 264, 20509–20512[Abstract/Free Full Text]
  7. Demple, B., Hidalgo, E., and Ding, H. (1999) Biochem. Soc. Symp. 64, 119–128[Medline] [Order article via Infotrieve]
  8. Gardner, P. R., and Fridovich, I. (1993) Arch. Biochem. Biophys. 301, 98–102[CrossRef][Medline] [Order article via Infotrieve]
  9. Lu, A. L., Li, X., Gu, Y., Wright, P. M., and Chang, D. Y. (2001) Cell Biochem. Biophys. 35, 141–170[CrossRef][Medline] [Order article via Infotrieve]
  10. Ratledge, C., and Dover, L. G. (2000) Annu. Rev. Microbiol. 54, 881–941[CrossRef][Medline] [Order article via Infotrieve]
  11. Kammler, M., Schon, C., and Hantke, K. (1993) J. Bacteriol. 175, 6212–6219[Abstract/Free Full Text]
  12. Andrews, S. C. (1998) Adv. Microbiol. Physiol. 40, 281–351[Medline] [Order article via Infotrieve]
  13. Petrat, F., de Groot, H., Sustmann, R., and Rauen, U. (2002) Biol. Chem. 383, 489–502[CrossRef][Medline] [Order article via Infotrieve]
  14. Hantke, K. (2001) Curr. Opin. Microbiol. 4, 172–177[CrossRef][Medline] [Order article via Infotrieve]
  15. Braun, V. (1997) Biol. Chem. 378, 779–786[Medline] [Order article via Infotrieve]
  16. Touati, D., Jacques, M., Tardat, B., Bouchard, L., and Despied, S. (1995) J. Bacteriol. 177, 2305–2314[Abstract/Free Full Text]
  17. Nunoshiba, T., Obata, F., Boss, A. C., Oikawa, S., Mori, T., Kawanishi, S., and Yamamoto, K. (1999) J. Biol. Chem. 274, 34832–34837[Abstract/Free Full Text]
  18. Abdul-Tehrani, H., Hudson, A. J., Chang, Y. S., Timms, A. R., Hawkins, C., Williams, J. M., Harrison, P. M., Guest, J. R., and Andrews, S. C. (1999) J. Bacteriol. 181, 1415–1428[Abstract/Free Full Text]
  19. Gralnick, J., and Downs, D. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 8030–8035[Abstract/Free Full Text]
  20. Castilho, B. A., Olfson, P., and Casadaban, M. J. (1984) J. Bacteriol. 158, 488–495[Abstract/Free Full Text]
  21. Way, J. C., Davis, M. A., Morisato, D., Roberts, D. E., and Kleckner, N. (1984) Gene (Amst.) 32, 369–379[CrossRef][Medline] [Order article via Infotrieve]
  22. Davis, R. W., Botstein, D., and Roth, J. R. (1980) Advanced Bacterial Genetics: A Manual for Genetic Engineering, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  23. Schmieger, H. (1972) Mol. Gen. Genet. 119, 75–88[CrossRef][Medline] [Order article via Infotrieve]
  24. Downs, D. M. (1992) J. Bacteriol. 174, 1515–1521[Abstract/Free Full Text]
  25. Harlow, E., and Lane, D. (1988) Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  26. Boudsocq, F., Campbell, M., Devoret, R., and Bailone, A. (1997) J. Mol. Biol. 270, 201–211[CrossRef][Medline] [Order article via Infotrieve]
  27. Imlay, J. A., and Fridovich, I. (1991) J. Biol. Chem. 266, 6957–6965[Abstract/Free Full Text]
  28. Yakes, F. M., and Van Houten, B. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 514–519[Abstract/Free Full Text]
  29. Van Houten, B., Cheng, S., and Chen, Y. (2000) Mutat. Res. 460, 81–94[Medline] [Order article via Infotrieve]
  30. Woodmansee, A. N., and Imlay, J. A. (2002) J. Biol. Chem. 277, 34055–34066[Abstract/Free Full Text]
  31. Nghiem, Y., Cabrera, M., Cupples, C. G., and Miller, J. H. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 2709–2713[Abstract/Free Full Text]
  32. Hudson, R. E., Bergthorsson, U., Roth, J. R., and Ochman, H. (2002) Mol. Biol. Evol. 19, 85–92[Abstract/Free Full Text]
  33. Lu, A. L., Tsai-Wu, J. J., and Cillo, J. (1995) J. Biol. Chem. 270, 23582–23588[Abstract/Free Full Text]
  34. Gu, Y., and Lu, A. L. (2001) Nucleic Acids Res. 29, 2666–2674[Abstract/Free Full Text]
  35. Bradford, M. M. (1976) Anal. Biochem. 72, 248–254[CrossRef][Medline] [Order article via Infotrieve]
  36. Miller, J. H. (1972) Experiments in Molecular Genetics, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  37. Zhao, G., Ceci, P., Ilari, A., Giangiacomo, L., Laue, T. M., Chiancone, E., and Chasteen, N. D. (2002) J. Biol. Chem. 277, 27689–27696[Abstract/Free Full Text]
  38. Althaus, E. W., Outten, C. E., Olson, K. E., Cao, H., and O'Halloran, T. V. (1999) Biochemistry 38, 6559–6569[CrossRef][Medline] [Order article via Infotrieve]
  39. Nakamura, J., Walker, V. E., Upton, P. B., Chiang, S. Y., Kow, Y. W., and Swenberg, J. A. (1998) Cancer Res. 58, 222–225[Abstract/Free Full Text]
  40. Cupples, C. G., and Miller, J. H. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 5345–5349[Abstract/Free Full Text]
  41. Gifford, C. M., and Wallace, S. S. (1999) J. Bacteriol. 181, 4223–4236[Abstract/Free Full Text]
  42. Pomposiello, P. J., and Demple, B. (2000) J. Bacteriol. 182, 23–29[Abstract/Free Full Text]
  43. Michaels, M. L., Cruz, C., Grollman, A. P., and Miller, J. H. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 7022–7025[Abstract/Free Full Text]
  44. Keyer, K., Gort, A. S., and Imlay, J. A. (1995) J. Bacteriol. 177, 6782–6790[Abstract/Free Full Text]
  45. Liochev, S. I., and Fridovich, I. (1994) Free Radic. Biol. Med. 16, 29–33[CrossRef][Medline] [Order article via Infotrieve]
  46. Tsolis, R. M., Baumler, A. J., Stojiljkovic, I., and Heffron, F. (1995) J. Bacteriol. 177, 4628–4637[Abstract/Free Full Text]
  47. Luckey, M., Pollack, J. R., Wayne, R., Ames, B. N., and Neilands, J. B. (1972) J. Bacteriol. 111, 731–738[Abstract/Free Full Text]
  48. Hantke, K., Nicholson, G., Rabsch, W., and Winkelmann, G. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 3677–3682[Abstract/Free Full Text]
  49. Gralnick, J., Webb, E., Beck, B., and Downs, D. (2000) J. Bacteriol. 182, 5180–5187[Abstract/Free Full Text]
  50. Skovran, E., and Downs, D. M. (2003) J. Bacteriol. 185, 98–106[Abstract/Free Full Text]
  51. Expert, D. (1999) Annu. Rev. Phytopathol. 37, 307–334[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Bacteriol.Home page
J. M. Boyd, J. A. Lewis, J. C. Escalante-Semerena, and D. M. Downs
Salmonella enterica Requires ApbC Function for Growth on Tricarballylate: Evidence of Functional Redundancy between ApbC and IscU
J. Bacteriol., July 1, 2008; 190(13): 4596 - 4602.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. Layer, S. Ollagnier-de Choudens, Y. Sanakis, and M. Fontecave
Iron-Sulfur Cluster Biosynthesis: CHARACTERIZATION OF ESCHERICHIA COLI CYaY AS AN IRON DONOR FOR THE ASSEMBLY OF [2Fe-2S] CLUSTERS IN THE SCAFFOLD IscU
J. Biol. Chem., June 16, 2006; 281(24): 16256 - 16263.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
E. Vivas, E. Skovran, and D. M. Downs
Salmonella enterica Strains Lacking the Frataxin Homolog CyaY Show Defects in Fe-S Cluster Metabolism In Vivo
J. Bacteriol., February 1, 2006; 188(3): 1175 - 1179.
[Abstract] [Full Text] [PDF]


Home page
J. Bacteriol.Home page
J.-W. Chen, C.-M. Sun, W.-L. Sheng, Y.-C. Wang, and W.-J. Syu
Expression Analysis of Up-Regulated