![]()
|
|
||||||||
J. Biol. Chem., Vol. 278, Issue 23, 20708-20715, June 6, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


From the Department of Bacteriology, University of Wisconsin-Madison, Madison, Wisconsin 53706
Received for publication, February 13, 2003
, and in revised form, March 28, 2003.
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
)
and hydroxyl radicals (OH), which are generated during normal
aerobic metabolism (1).
Superoxide mediates the oxidation of labile [4Fe-4S] cluster-containing
proteins (2), with the release
of ferrous iron (Fe(II)) and H2O2. In addition to
inactivating the enzyme, this process generates two substrates for the Fenton
reaction (Fe(II) + H2O2 + H+
Fe(III) +
H2O + OH), the biggest generator of hydroxyl
radicals in the cell. Unlike the oxygen species H2O2 and
,
hydroxyl radicals have sufficient redox potential to oxidize both sugar and
base residues in DNA (3,
4,
5,
6). Left unchecked, this
reactivity results in a high level of specific mutagenic lesions in the cell.
Although bacterial cells have evolved several ways to eliminate toxic oxygen
species (reviewed in Refs. 1
and 7) or to repair damage when
it occurs (8,
9), there is a need to
sequester the cellular Fe(II) that can participate in Fenton chemistry to
prevent excessive damage to DNA and other macromolecules. The control of Fenton chemistry and the resulting damage is complicated by the multiple roles of iron in cellular metabolism. Although iron exists in two stable oxidation states, Fe(II) and Fe(III), nearly all non-biological iron is in the highly insoluble ferric (Fe(III)) form. Bacteria circumvent solubility problems by the use of extracellular Fe(III)-specific siderophores. Siderophore-Fe(III) complexes are transported into the cell where the iron is reduced to Fe(II) and released from the siderophore (reviewed in Ref. 10). Additionally, Fe(II) in the environment can be directly transported (11). The Fe(II) in the cell that is readily available for metabolic activity has been referred to by a variety of names, including transit, low molecular weight, or "free" iron pool (2, 12, 13). Processes such as regulation, cofactor biosynthesis, and iron storage draw from this pool. An unresolved question in iron trafficking in bacteria focuses on what the iron in this transit pool is liganded to (10). It has been suggested that ATP, GTP, pyrophosphate, polypeptides, and others may be liganded to the free iron and thus facilitate trafficking between siderophores and cellular processes requiring Fe(II) (12). Studies of the status of the free iron pool have been limited by the techniques available, most of which rely to some extent on chelation. Results of these experiments necessarily reflect the affinities of the chelators employed, making it difficult to obtain general insights on the number and/or species of the ligands involved (13). However, the chelatable nature of this iron suggests that, unlike iron bound to storage proteins or in functional proteins, free iron can have a cytotoxic effect. Therefore, a major challenge the cell faces in maintaining iron homeostasis is to (i) sequester Fe(II) from participating in detrimental Fenton chemistry and (ii) make Fe(II) easily available for the cellular processes in which it is required.
The ferric uptake regulator (Fur)1 protein is responsible for sensing Fe(II) levels inside the cell and regulating gene expression accordingly (reviewed in Refs. 14 and 15). It was recently suggested that a central function of Fur is sequestration of Fe(II). Various phenotypes associated with null mutations in fur have been attributed to a concomitant increase in cellular Fe(II) levels, one being increased mutagenesis (16, 17). It has been suggested that, at least in part, the increased mutagenesis is due to the lack of Fur to sequester the free iron (18).
Previously we reported that accumulation of the YggX protein resulted in (i) increased resistance to superoxide, (ii) decreased in spontaneous mutation frequency, and (iii) restoration of aconitase activity in various mutant backgrounds (i.e. gshA) (19). The work presented herein was initiated to determine the mechanism of decreased mutagenesis caused by accumulation of the YggX protein. The results are consistent with a model in which the YggX protein has a role in sequestering cellular Fe(II), making it available for Fe-dependent cellular processes while keeping it removed from Fenton chemistry. We suggest that YggX is a component of the iron-trafficking machinery in Salmonella enterica and other bacteria.
| EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
|
Genetic Methods: Transduction Methods
The high frequency generalized transducing mutant of bacteriophage P22
(HT105/1, int-201)
(23) was used in all
transductional crosses. The method for transduction and subsequent
purification of transductants has been previously described
(24). Isogenic strains were
constructed with standard genetic techniques utilizing linked markers.
Presence of the yggX* mutation was confirmed by Western analysis
showing accumulation of YggX protein
(19,
25).
Quantitative Western Analysis
A standard curve was generated using purified YggX in concentrations from
0.4 to 8 ng of protein, visualized by Western analysis with anti-YggX antibody
(19). Whole cells were
harvested from LB overnight and mid-log phase cultures
(A650 = 0.550). Aliquots (216 µl for overnight
and 20100 µl for mid log) were loaded directly into SDS-PAGE gels
and transferred to a nitrocellulose membrane for visualization through Western
analysis (26). Colony forming
units (CFUs) were determined for both overnight and mid-log cultures by
dilution plating, and 1 CFU was assumed to equal one cell. Molarity and amount
of YggX per cell were determined using the standard curve generated from pure
protein, with the number of cells loaded into the SDS-PAGE gel, and with the
calculated volume of a single cell being 3.2 x
1015 liter
(27).
Quantification of DNA Damage
Measurement of Polymerase-blocking DNA LesionsDamaged
template in a PCR reaction results in less product compared with undamaged
template by blocking DNA polymerase
(28). This correlation has
been previously used to quantify DNA damage by PCR
(29,
30). Genomic DNA was purified
using an Easy-DNA kit (Invitrogen). Template DNA concentrations were
calculated using A260 spectroscopic readings and were as
stated in Fig. 1. 100 pmol of
each primer was used in all reactions. Primer sequences (5' to 3')
and expected product sizes are as follows: CGTAATTCGGGATCCGCG and
TCCACGTCAGCGGCGGTTTTAC, 4470-bp product (thiC-thiG);
CATCGCAGGTAAAGTCGTCTCTAAA and TCCCGCGTAAACAATCAATAAAACA, 8301-bp product
(rpoB-thiH). Amplification products were generated using the
Z-Taq enzyme (TaKaRa Bio Inc.) according to specifications.
Me2SO (2%) and glycerol (1%) were present and required for the
reactions. Reactions were performed in a GeneAmp 2400 PCR system (PerkinElmer
Life Sciences) using the following conditions for PCR. For the 4.5-kb product:
94 °C for 2 min; 33 cycles of 94 °C for 10 s and 68 °C for 1 min
20 s; and final extension at 70 °C for 7 min. For the 8.3-kb product: 92
°C for 2 min; 35 cycles of 92 °C for 20 s and 68 °C for 2 min and
20 s; and final extension at 70 °C for 7 min. Amplification products were
run on a 1% agarose gel, stained with ethidium bromide, visualized using a
Fotodyne gel documentation system, and quantified using Gel-Pro Analyzer
software package (Media Cybernetics). The amount of PCR product was
proportional to the amount of DNA template from DM5105 over the concentrations
used in these experiments (data not shown).
|
DNA Damage Quantification Kit, AP Site CountingGenomic DNA was isolated as described above. Abasic (AP) lesions in the genomic DNA were quantified using a DNA damage quantification kit (Dojindo Molecular Technologies) following the protocol provided. Data reported are the average and standard deviation of results with genomic DNA isolated from three independent cultures.
Mutagenesis Constructs
Fusion ConstructionConstruction of lacZ mutations
based on the observation of Cupples and Miller of codon invariance at position
461 (31) into a cassette
transducible in S. enterica serovar Typhimurium as described
elsewhere (32). Strains
provided by H. Ochman contained MudF insertions at minute 40.2 in the S.
enterica genome (tre-152::MudF), representing
constructs CC103 (GC:CG reporter) and CC104 (GC:TA reporter). These constructs
were transduced via P22 into strains DM5104 and DM5105, resulting in strains
DM6222, DM6223, DM6911, and DM6912, respectively.
Lac+ Revertant AnalysisAliquots (20 µl) of LB cultures, started from single colonies and incubated overnight at 37 °C, were used to inoculate 10-ml cultures of minimal glucose media. For each strain, ten independent cultures were grown overnight at 37 °C and plated in the following ways: For CC103 reporter strains, 10 ml (109 CFU) of culture was centrifuged and resuspended in 0.4 ml of 1x NCE and plated onto a single minimal medium plate with lactose as the sole carbon and energy source. Plates were incubated for 12 days at 37 °C, and colonies that arose were scored as one Lac+ CFU. Prior to centrifugation, a small volume (10 µl) from the 10-ml overnight culture was dilution-plated onto minimal glucose plates to determine total CFU/ml. The procedure for CC104 reporter strains was the same as above except that 250 µl (2.5 x 107 CFU) was plated from each independent overnight culture onto five minimal lactose plates.
Biochemical Assays
A/G-specific Adenine Glycosylase (MutY)
ActivityA/G-specific adenine glycosylase (MutY) activity was
assayed using conditions reported by Lu et al.
(33) and oligonucleotide
substrates (Chang-68 and Chang-69) described by Gu and Lu
(34). Oligonucleotides were
purchased and PAGE-purified by Integrated DNA Technologies. Protocols for
substrate generation using 32P-labeled dCTP and assay procedure
were followed as described previously
(33,
34) with the exception that
reductant was not used in the assay buffer. Cell extracts were prepared from
overnight LB cultures via sonication (two 10-s pulses consisting of 0.5-s
bursts, with
1 min incubation on ice between pulses), clarified by
centrifugation (10,000 x g for
5 min), transferred to new
microcentrifuge tubes, and then frozen at 20 °C until used. Protein
was quantified via Bradford assay
(35). The Escherichia coli
mutY null strain (CSH117) was obtained from the E. coli Genetic
Stock Center (available at
cgsc.biology.yale.edu).
-Galactosidase ActivityOvernight LB cultures of
strains DM6762 and DM6763 were used as inoculum (1:100) into 5 ml of fresh LB
containing various concentrations of FeCl3. Resulting cultures were
grown with shaking at 37 °Cto
0.4 A650, pelleted,
resuspended in 5 ml of minimal 1x NCE, and placed on ice until assayed.
The assay was performed and quantified as described by Miller
(36).
Construction of YggXC7S Overexpression Plasmid
The yggX gene from S. enterica was amplified from a
plasmid containing the wild-type gene (pYGGX3A)
(19) using primers that were
designed to (i) eliminate the stop codon, (ii) introduce an NdeI
restriction site that overlaps the start codon, and (iii) change the amino
acid at position seven from cysteine to serine. The sequence of the PCR
primers used (5' to 3') was as follows: YggX-NoTerm,
TTTTTTATCTTCCGGCGT and YggX-C7S, CATATGAGCAGAACGATTTTTTCTACTT. The
amplification product was then digested with NdeI, gel-purified, and
ligated into the NdeI and SmaI sites of the pTYB2 vector
(New England BioLabs). The resulting clone (pTYB2-YggX-C7S) was verified by
restriction analysis and sequencing (data not shown).
YggX and YggXC7S Overexpression and Purification
Vectors containing both mutant and wild-type gene sequences were
electroporated into strain BL21(
DE3) of E. coli. Proteins
were purified using chitin affinity chromatography with the IMPACT T7 Kit (New
England BioLabs). Overexpression and purification were performed as described
by the manufacturer using 30 mM dithiothreitol in the on-column
cleavage step. The elution and cleavage process was performed twice,
increasing the yield. Protein was concentrated using an Amicon Stirred
Ultrafiltration Cell (Millipore) with a 3000 molecular weight cutoff filter
then dialyzed into 10 mM Tris (pH 7.8) overnight with three buffer
changes. The carboxyl terminus of proteins isolated in this manner contain a
single glycine residue not present in the native protein.
In Vitro Assay for DNA Damage Caused by Hydroxyl Radicals
Assay conditions similar to those used by Zhao et al.
(37) to demonstrate protection
of DNA from oxidative damage by the Dps protein were used. The assay mixture
contained Tris buffer (pH 7.8, 20 mM), ferrous sulfate
(FeSO4, 50 µM), DNA (pVJS1, 1.8 µM),
YggX protein (as indicated in Fig.
3), and hydrogen peroxide (H2O2, 880
mM) in a final volume of 20 µl. FeSO4 was diluted
from a 100 mM stock made fresh in double-distilled water
(ddH2O) prior to every assay. Plasmid pVJS1 (10,850 bp) was
purified with a Wizard Plus SV Miniprep kit (Promega). Buffer, DNA,
FeSO4, and protein were mixed, with ddH2O added to make
a final volume of 18 µl. After incubation at room temperature for 5 min,
H2O2 (2 µlofan8.8 M solution) was added to
initiate the reaction. Following incubation at room temperature for 30 min, 3
µl of loading buffer was added, and 20 µl of the reaction mix was loaded
into a 1% agarose gel, stained with ethidium bromide, and visualized with a
Fotodyne gel documentation system.
|
Detection of Chelatable Fe(II) in Vitro
In a microtiter plate, Tris buffer (pH 7.8, 8.5 mM final
concentration), protein (concentrations as indicated in
Fig. 4), and FeSO4
(made fresh prior to each assay, 150 µM final concentration)
were added to a final volume of 180 µl and incubated at room temperature
for 10 min. Chelatable Fe(II) was detected by adding 20 µl of
1,10-phenanthroline (6 mg/ml in 50% EtOH), incubating for an additional 10 min
at room temperature, and measuring A510 using a SpectaMAX
Plus plate reader (Molecular Devices). The Bradford method of quantifying
protein can be inaccurate when detecting amounts of a single protein species
(38); therefore, no inferences
regarding stoichiometry have been made.
|
| RESULTS |
|---|
|
|
|---|
8,000 copies of the protein/cell); in stationary
phase cells,
12,000 copies of YggX/cell were present (data not
shown). It is worth noting that E. coli K12 and all the wild-type isolates of the S. enterica serovar Typhimurium LT series (#122) obtained from the Salmonella Genetic Stock Center accumulated YggX protein to levels qualitatively similar to that of strain DM5105 (19).2 Strain DM5104, rather than a strain lacking the yggX gene, was used for the work reported here, because (i) it contains the yggX allele from the LT2 isolate that is the progenitor of the majority of our laboratory strains and (ii) its use avoided possible detrimental consequences caused by a complete lack of the protein.3 In other words, the work described here utilizes two genetic backgrounds that differ only in the level of YggX accumulation. The physiological differences between these strains can thus be attributed to the level of YggX and used to probe the function of this protein in vivo.
Strains Expressing YggX Protein Accumulate Less DNA DamagePrevious genetic analyses showed that strains accumulating the YggX protein had a lower frequency of spontaneous mutations (19). To probe the basis for this difference, physical damage of the chromosomal DNA was determined.
The method of Van Houten et al. (29) was used to determine the relative number of polymerase-blocking lesions in the DNA of strains DM5104 and DM5105. Chromosomal DNA from each strain was used as reaction template for quantitative PCR reactions (28, 29). It is known that the concentration of polymerase-blocking lesions in the reaction template is inversely proportional to the quantity of amplified product (29). Two products from the 90-min region of the chromosome were amplified. One product was 4.5 kb (primers flanking thiC and thiG); the second one was 8.3 kb (primers in rpoB and thiH). Fig. 1 displays the results of this experiment when the 4.5-kb fragment was amplified. When equal amounts of template DNA were used, the quantity of amplified product from DM5104 DNA was significantly less than when DNA from strain DM5105 was used. Similar results were found when the larger PCR product was monitored (data not shown). These results were consistent with the presence of more polymerase-blocking lesions in the strain that failed to accumulate YggX.
Chromosomal damage was independently measured to determine the concentration of abasic (AP) sites in the DNA (DNA Damage Quantification kit, Dojindo Molecular Technologies, Inc.). AP sites are common lesions in DNA and are thought to be intermediates in mutagenesis. Genomic DNA from strains DM5104 or DM5105 was treated with aldehyde reactive probe reagent (a compound that reacts specifically with an aldehyde group in the open ring form of an AP site), resulting in biotin-tagged AP sites that are quantified using an avidin-biotin assay (39). In this assay, DNA from strain DM5104 consistently contained a higher concentration of AP lesions than that from DM5105. In a representative experiment, DM5105 DNA contained 3.7 ± 0.6 AP sites per 105 bp compared with 10.2 ± 2.6 sites per 105 bp found in DNA isolated from the isogenic strain (DM5104) that contained no detectable YggX. The results of these two independent approaches demonstrated that fewer lesions in the DNA were present when a strain accumulated YggX and provided an explanation for the genetic results previously reported (19).
Accumulation of YggX Specifically Decreased the Frequency of GC to TA Transversion MutationsThe specificity of the spontaneous mutations absent when YggX accumulated was addressed using lacZ reporter constructs. Specific lacZ reporters, originally constructed in E. coli by Cupples and Miller (40) and reconstructed into a transposable element in S. enterica by Hudson et al. (32), were obtained. In otherwise Lac strains carrying these reporters, the appearance of Lac+ colony-forming units reflects a specific codon change (40). The choice of specific reporters was prompted by the effect of YggX on superoxide stress (19), the proximity of yggX to the DNA glycosylase encoded by mutY (41), and the induction of yggX expression by superoxide stress (42). Two constructs were used for these studies, one that monitored GC to TA transversion mutations (CC104) and one that detected GC to CG transversion mutations (CC103). The GC to TA transversions can be the result of hydroxyl radical attack and are preventable by MutY activity (31, 43), whereas GC to CG transversions are neither the result of oxidative damage nor prevented by MutY activity (31). Each of these constructs (located in the chromosomal tre locus (32)) was introduced by transduction into strains DM5104 and DM5105, generating four relevant strains. Each strain was grown overnight in minimal glucose medium and a sample was plated on medium with lactose as the sole carbon and energy source. The number of Lac+ colonies observed was determined as a function of colony-forming units (CFU). Ten independent cultures of each strain were analyzed; a summary of the results is presented in Table II. These data showed that the parent background (low level of YggX) accumulated significantly more GC to TA than GC to CG lesions. The number of GC to CG mutations recovered from the wild-type (DM6911) and the isogenic strain overproducing YggX protein (DM6222) were similar (Table II). However, the number of GC to TA transversions detected in the two strains (DM6912 and DM6223) differed significantly, with the accumulation of YggX protein correlating with a decrease of over 40-fold in this class of mutations (Table II). Interestingly, the strain with no detectable YggX displayed a mutation profile similar to that reported for mutY mutants, whereas the strain accumulating YggX produced a profile more similar to the wild-type strain in other studies (40). This mutant correlation was consistent with the previous demonstration that many laboratory wild-type strains, in particular E. coli K12, accumulate YggX (data not shown).
|
MutY Activity Is Not Increased in Strains Accumulating YggXTaken together, the results above were consistent with fewer MutY-repairable lesions accumulating in strains with detectable levels of YggX protein. Two scenarios were considered to explain these results: (i) strains accumulating YggX protein had higher MutY enzyme activity resulting in an increased repair of the lesions, or (ii) less damage occurred to the DNA in a strain accumulating YggX protein. The first scenario was considered due to the physical proximity of yggX and mutY genes in the genomes of E. coli, S. enterica, and many other bacteria and because, at least under some conditions, yggX and mutY are co-transcribed (Ref. 41 and data not shown). To distinguish between the two possibilities, MutY enzymatic activity was assayed in crude cell-free extracts by providing A:G-mismatched double-stranded DNA substrate and monitoring MutY-dependent generation of cleaved product as described (33). Fig. 2 shows representative MutY enzyme activity assays using crude cell-free extracts of S. enterica strains DM5104 and DM5105 and an E. coli mutY null mutant strain (CSH117). When equal quantities of protein were added to the reaction mixture, no significant difference in MutY activity was found between the two S. enterica strains (lanes A and B), as reflected by the similar intensities of the resulting product bands (less than 10% difference based on quantification with a Cyclone Storage Phosphor System). Importantly, the E. coli mutY strain displayed no activity (lane C) nor did a sample without added cell extract (data not shown). The demonstration that MutY activity did not differ between the two strains suggested that less damage to the DNA was occurring due to the presence of elevated levels of YggX.
|
Variant Protein YggXC7S Is Nonfunctional in VivoDNA damage detected by both genetic and physical means could be explained by hydroxyl radical-mediated attack. In considering intracellular Fenton chemistry the primary source of these radicals (44, 45), residues of YggX that could be involved in this process were tentatively identified. The single cysteine residue present in YggX (Cys-7) was targeted for substitution, because it is conserved in all YggX homologs and cysteine residues are highly reactive and often involved in metal coordination. A plasmid containing the allele of yggX encoding the YggXC7S variant protein failed to eliminate the nutritional requirements of a gshA mutant strain (data not shown and Ref. 19). Immunoblot analysis determined that the YggXC7S protein was stable and accumulated to similar levels as the wild-type protein when the wild-type gene was provided on a plasmid (data not shown). On the basis of these data, it was concluded that residue Cys-7 in YggX was essential for function in vivo.
YggX Prevents Fenton Chemistry in VitroTo determine whether the proposed effect of YggX on mutagenesis was due to a direct role in reducing Fenton chemistry, both the YggX and YggXC7S proteins were isolated. The YggXC7S protein served as control to determine the significance of in vitro results with respect to the role of the YggX protein in vivo. DNA damage by hydroxyl radicals was assessed in vitro by monitoring the degradation of supercoiled plasmid DNA in the presence of Fe(II), H2O2, and increasing amounts of YggX or YggXC7S protein. The data showed that YggX protected DNA from damage (Fig. 3). In contrast, the YggXC7S variant protein was significantly less effective than the YggX protein, providing only slight protection at high protein concentrations. Assay mixtures that containing heat-inactivated YggX protein failed to protect DNA from degradation (data not shown). The clear differences between the mutant and wild-type proteins in this assay were consistent with YggX directly reducing damage to DNA caused by Fenton chemistry.
YggX Masks Chelatable Fe(II) in VitroProtection of DNA against hydroxyl radical damage by YggX could be afforded by direct interactions between YggX and DNA, or indirectly by preventing hydroxyl radical formation, possibly by chelating Fe(II). YggX lacks any motifs suggestive of direct physical interactions with DNA, hence the ability of YggX to bind Fe(II) was considered. To address the hypothesis that YggX can bind/sequester Fe(II), the ability of both the YggX and YggXC7S proteins to decrease chelatable Fe(II) in solution was tested. For this experiment 1,10-phenanthroline (1,10-phen) was used to detect chelatable Fe(II). Complex formation of Fe(II) and 1,10-phen results in an increased absorbance at 510 nm. YggX, but not the YggXC7S variant, decreased the amount of Fe(II) in a solution that was available to bind 1,10-phen (Fig. 4). Furthermore, the amount of Fe(II) detectable with 1,10-phen decreased as a function of the amount of protein added. One interpretation of these results is that YggX binds Fe(II) and prevents it from binding to 1,10-phen. No absorption at 510 nm was detected when either protein was incubated with 1,10-phen in the absence of Fe(II), indicating that neither protein directly affected absorption of this compound at 510 nm.
Does Accumulation of YggX Alter the Accessible Level of Fe(II) in
Cells?The in vitro results above suggested a model in
which accumulated YggX would alter the free pool of Fe(II) in the cell. If
this idea were correct, the level of YggX protein would be predicted to have
an effect on the transcription of genes whose expression depends on the Fe(II)
pool in the cell through their regulation by the Fur protein. To probe the
physiologically relevant level of Fe(II) in the cells, in vivo
experiments were preformed. Fur protein binds Fe(II) and represses
transcription of various target genes, among them entB
(46). An entB::MudJ
fusion was introduced into both DM5104 and DM5105 strains and used to
indirectly measure the level of Fe(II) present in the cell.
-Galactosidase activity was measured in the resulting two strains
(DM6762 and DM6763) grown in rich medium with varying levels of additional
FeCl3. Although entB encodes isochorismatase, an enzyme
required for the synthesis of the siderophore enterobactin, other siderophores
allow the FeCl3 provided in the medium to be taken up by the cells
(47,
48). Data in
Fig. 5 show the expected
correlation between the expression of entB and the concentration of
exogenous Fe(III). The data in Fig.
5 also show that accumulation of YggX protein lowered the levels
of lacZ expression from the fusion. Introduction of a fur
mutation in each of these strains resulted in constitutive expression
(
300 Miller units), indicating that the differential regulation being
observed was mediated by Fur. Taken together, these results show that, in a
strain accumulating YggX, a lower level of exogenous iron was needed to
repress the Fur regulon. A simple interpretation of this result is that more
Fe(II) was available to bind Fur in the presence of accumulated YggX.
|
In summary, strains with more YggX had a lower frequency of Fe(II)-mediated Fenton chemistry, suggesting less free Fe(II) was present in the cell. However, the in vivo results with the entB reporter suggested that high levels of YggX lead to more free Fe(II) available to mediate Fur repression.
| DISCUSSION |
|---|
|
|
|---|
Working Model Suggests YggX Is Involved in Iron TraffickingFig. 6 shows a model that explains both the in vivo and in vitro data reported here. With this model we suggest that YggX is a player in iron trafficking and is a Fe(II) binding ligand in the free iron pool. This model is able to reconcile the two in vivo results that superficially suggested opposing levels of free Fe(II) in the cell when YggX accumulates. The reported decrease in mutagenesis could be interpreted to suggest there is a lower level of free Fe(II) in the cell, whereas the expression studies showing less entB transcription suggested an increased level of free Fe(II). We suggest YggX has many of the properties that have been proposed for a component of trafficking that binds the free iron pool (10, 12, 13). Although the in vitro results showed YggX could sequester Fe(II), no iron was associated with the purified, dialyzed protein (data not shown). This result is consistent with a low affinity association that might be expected for a ligand to allow the release of Fe(II) to relevant cellular processes such as Fur regulation and [Fe-S] cluster synthesis/repair.
|
YggX Can Sequester Fe(II) in VitroThe demonstration that purified YggX could decrease the amount of Fe(II) detectable in solution by 1,10-phen (Fig. 4) was critical in developing the model presented for in vivo function. Results of this experiment were interpreted to mean that YggX can bind Fe(II), at least to the extent that it becomes unavailable to 1,10-phen. The model we propose for the role of YggX suggests an affinity that is necessarily less than that of other proteins and processes that require access to Fe(II) in the cell. Without additional experimentation it is not possible to determine an affinity for the association of YggX with iron nor suggest the stoichiometry of binding. Although the precise implications of the in vitro results cannot be determined, they provide biochemical support for the function of YggX that is proposed in the working model.
Cys-7 Is Essential for the Function of YggXThe validity of considering the in vitro activity of YggX described here as relevant to the in vivo situation is justified by the behavior of a mutant protein. When a single amino acid change was generated in the protein, the resulting YggXC7S variant was dramatically less active in both assays used to test function of YggX in vitro. Significantly, the mutant protein failed to generate the phenotypes associated with the wild-type protein in vivo (Ref. 19 and data not shown). Taken together these results allowed the conclusion that the in vitro activity reported was relevant to in vivo function and that the Cys-7 residue is essential for YggX function, possibly by serving as a ligand for Fe(II).
Lack of YggX Has Led to Detection of Subtle Effects on [Fe-S]
SynthesisTo provide a ligand for the free Fe(II) pool, a protein
would be expected to be abundant. The strains used herein that accumulate
YggX, contained between 8,000 and
12,000 copies per cell depending on
growth stage. Significantly, a similar level of YggX was detected in other
S. enterica serovar Typhimurium wild-type strains and the
one strain of E. coli K12 that was tested (data not shown). This
result suggests that high levels of YggX are more the norm and indicates that
the LT2 strain isolate that we have utilized heavily in our work (DM1) is
"mutant" with respect to levels of YggX.
The model presented suggests that a strain with low levels of YggX would be more sensitive to small changes in [Fe-S] cluster metabolism, because Fe(II) trafficking to biosynthetic enzymes and repair systems is not operating at full efficiency. Work from our laboratory has shown that mutations in apbC, apbE, and gshA result in [Fe-S] cluster defects in strains with low levels of YggX (19, 49, 50). Accumulation of YggX is sufficient to suppress both the nutritional and biochemical defects associated with these mutations (19).3 Thus, the serendipitous use of a strain with low YggX accumulation has been instrumental in our ability to identify new players in a central cellular process.
YggX Homologs in Other OrganismsThe gene encoding YggX has
been found in over 40 bacterial genomes thus far (
20% of both complete
and unfinished genome sequences). YggX is mainly distributed in pathogens from
the
-proteobacteria (e.g. Salmonella, Escherichia,
Pseudomonas, and Erwinia) division, with a few from the
-proteobacteria (e.g. Neisseria and Ralstonia)
division. A common obstacle both plant and animal pathogens face is iron
deprivation due to the action of the host (reviewed in Refs.
10 and
51). Organisms with YggX may
have an advantage under conditions of iron limitation by trafficking the metal
more efficiently in addition to sequestering free Fe(II) from toxic oxygen
species released as a defense by the host. Moreover, YggX is found in several
symbiont isolates (Wigglesworthia, Buchnera, and
Azotobacter) and in some bacteria with metal-oriented lifestyles
(Shewanella onidensis and Acidithiobacillus ferrioxidans).
It is tempting to speculate that YggX has evolved as a means to evade damage
caused by oxidative bursts from the host or symbiont and/or protect organisms
from the toxicity generated by redox-active metals.
In summary, this work has identified an additional protein involved in bacterial iron homeostasis. The biochemical and genetic data presented herein support the model that the YggX protein serves as a link between iron transport and cellular processes requiring iron and thus may be a missing link in iron trafficking.
| FOOTNOTES |
|---|
Supported by the Jerome J. Stefaniak Predoctoral Fellowship from the
Department of Bacteriology. ![]()
To whom correspondence should be addressed: Dept. of Bacteriology, 1550 Linden
Dr., Madison, WI 53706. Tel.: 608-265-4630; Fax: 608-262-9865; E-mail:
downs{at}bact.wisc.edu.
1 The abbreviations used are: Fur, ferric uptake regulator protein; CFU,
colony-forming unit(s); AP, abasic; 1,10-phen, 1,10-phenanthroline; NCE, no
carbon E medium. ![]()
2 J. A. Gralnick, D. M. Wolfe, and D. M. Downs, unpublished. ![]()
3 J. A. Gralnick and D. M. Downs, unpublished observations. ![]()
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
J. M. Boyd, J. A. Lewis, J. C. Escalante-Semerena, and D. M. Downs Salmonella enterica Requires ApbC Function for Growth on Tricarballylate: Evidence of Functional Redundancy between ApbC and IscU J. Bacteriol., July 1, 2008; 190(13): 4596 - 4602. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Layer, S. Ollagnier-de Choudens, Y. Sanakis, and M. Fontecave Iron-Sulfur Cluster Biosynthesis: CHARACTERIZATION OF ESCHERICHIA COLI CYaY AS AN IRON DONOR FOR THE ASSEMBLY OF [2Fe-2S] CLUSTERS IN THE SCAFFOLD IscU J. Biol. Chem., June 16, 2006; 281(24): 16256 - 16263. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Vivas, E. Skovran, and D. M. Downs Salmonella enterica Strains Lacking the Frataxin Homolog CyaY Show Defects in Fe-S Cluster Metabolism In Vivo J. Bacteriol., February 1, 2006; 188(3): 1175 - 1179. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-W. Chen, C.-M. Sun, W.-L. Sheng, Y.-C. Wang, and W.-J. Syu Expression Analysis of Up-Regulated |