![]()
|
|
||||||||
J. Biol. Chem., Vol. 278, Issue 23, 21247-21257, June 6, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

From the Biological Information Research Center, National Institute of Advanced Science and Technology, Tsukuba, Ibaraki 305, Japan
Received for publication, December 3, 2002
, and in revised form, March 20, 2003.
| ABSTRACT |
|---|
|
|
|---|
|
|
| INTRODUCTION |
|---|
|
|
|---|
PolD is composed of a small subunit (DP1) and a large subunit (DP2). The interaction of DP1 and DP2 is essential for the stability and full activity of the enzyme (15, 16). DP1 or DP2 expressed in Escherichia coli is unstable and easily degraded. PolD possesses strong DNA polymerizing and 3'-5' exonuclease (proofreading) activities like other DNA replication polymerases, however, common motifs for the catalysis of other DNA polymerases are absent or not functional in PolD (17, 19). Two invariant residues, Asp1122 and Asp1124 of DP2Pho, located in the most conserved region in the large subunit of PolD, were identified to be the catalytic residues for the DNA polymerization activities (17), indicating that the COOH-terminal of DP2 is involved in the formation of the catalytic center for DNA synthesis. A heterotetrameric structure for PolD from P. horikoshii (PolDPho) was proposed based on the result of gel filtration (17).
Several lines of evidence indicate that family D DNA polymerase is likely
the major DNA polymerase or replicase in Euryarchaeota, participating in DNA
replication, repair, and recombination. In the genomes of the genus
Pyrococcus, the genes coding the two subunits of PolD are adjacent to
the replication origin and several essential genes for DNA metabolism
(20). DP1 shows low but
significant homology to the small subunit of eukaryote DNA polymerase
,
, and
(19,
21), and contains domain and
catalytic motifs for the 3'-5' exonuclease, similar to those of
Mre11, a nuclease involved in double strand DNA break repair
(18,
21,
22). The amino acid sequences
of DP2 contain a short region at the COOH-terminal, which shows homology to
the catalytic subunit of yeast DNA polymerase
(this paper) around the
COOH-terminal putative zinc finger motif (cysteine cluster II). This
homologous region in yeast polymerase
is found to be vital for the
survival of yeast (23,
24). PolD interacts with many
proteins related to DNA replication, repair, and recombination. It was found
that DP1 from P. furiosus interacts specifically with archaeal RadB
by yeast two-hybrid analysis and in vitro pull-down assays
(25). DP2 directly interacts
with proliferating cell nuclear antigen as analyzed by in vivo
immunoprecipitation assays, in vitro pull-down assays in P.
furiosus (26), and yeast
two-hybrid assays in A. fulgidus
(27). Proliferating cell
nuclear antigen was found to stimulate the polymerization activity of PolD of
P. furiosus (26).
Recently, the physical interaction of PolDPho with proliferating cell nuclear
antigen was observed using gel filtration analysis, and DP2 was found to
interact with replication factor C by yeast two-hybrid analysis in P.
horikoshii.2
These findings strongly indicate that PolD plays an essential role in DNA
replication, repair, and recombination.
Despite continuous efforts, the whole structure and detailed mechanism of
DNA replication of replicative DNA polymerases in the three domains of life,
such as polymerase III holoenzyme in E. coli, and DNA polymerase
,
, and
in yeast, remain to be elucidated. This is
particularly the case for eukaryotes whose replication mechanism has become
complicated during evolution and more difficult to study. PolD might be an
ideal molecule for structural analysis as a DNA replicase. Because many
proteins related to DNA replication in Archaea are similar to those in
eukaryotes (28), the study of
archaeal replicative proteins will help us understand the DNA replication
mechanism in eukaryotes. The advantage of using archaeal proteins for analysis
is that they are mostly thermo-stable, and relatively easy to purify and
crystallize.
To improve our understanding of the structure and properties of PolD, we analyzed the domain structure using proteins truncated at the amino- and carboxyl-terminals of both DP1Pho and DP2Pho, and studied the function of the putative zinc finger motif (cysteine cluster II) at the COOH-terminal of DP2Pho using deletion and site-directed mutants. We identified putative regions responsible for subunit interaction, oligomerization, and regulation of the 3'-5' exonuclease activity in PolDPho. We found that the internal region of the putative zinc finger motif is indispensable for the 3'-5' exonuclease activity. Two NH2-terminal fragments of DP2Pho and one NH2-terminal domain of DP1Pho were highly expressed and purified and could be used for crystal structural analysis of PolDPho.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Construction of Vectors for Expression of Truncated ProteinsThe construction of expression vectors was based on a previously reported co-expression system and vectors (17). PolDPho was expressed with a histidine tag (His tag) at the NH2 terminus of DP1Pho. To construct vectors for COOH-terminal-truncated proteins of DP2Pho, downstream primers were designed at the intended sites. Within each primer, a stop codon followed by a NsiI site was added after the nucleotide sequences at the sites of truncation (Table I). PCR was performed using an upstream primer, pGEM-rbs or L3 and site-specific primers, with the co-expression plasmid pET15b/SL as the template (Table I). The amplified fragments were digested with SacII (or SalI) and NsiI, and inserted into pET15b/SL digested with the corresponding enzymes (17).
|
To construct vectors for the amino-terminal-truncated proteins of DP2Pho, upstream primers were designed at the intended sites. Within each primer, a NdeI site was created immediately ahead of the site of truncation. PCR using the specific primers and L2 or L4 and template pET15b/SL was carried out (Table I). After digestion with NdeI and SalI or Nsil, the fragments were cloned into pGEMEX-1. A second PCR was performed using primer pGEM-rbs and L2 or L4, and the pGEMEX-1 plasmids containing the corresponding insert. After digestion with SacII and SalI (or NsiI), the fragments were cloned back into pET15b/SL to replace the wild type SacII-SalI (or SacII-NsiI) fragments.
To construct vectors for COOH-terminal-truncated proteins of DP1Pho, primers were designed to include a stop codon and a SacII site at the intended sites (Table I). PCR was performed using the vector-derived primer pET-SphI (the SphI site is 354 bp upstream of the NdeI site in pET15b) and specific primers. After digestion with SphI and SacII, the fragments were cloned back into the pET15b/SL vector digested with SphI and SacII (17).
To construct vectors for NH2-terminal-truncated proteins of DP1Pho, site-specific primers were made, in which a NdeI site was created artificially ahead of the intended site of truncation. After PCR using the specific primers and S2M and digestion with NdeI and BamHI, the fragments were cloned into pET15b. Then a second PCR was conducted using the pET15b-derived primer pET-SphI and S2M. After digestion with SphI and SacII, the genes with a truncation of the DP1Pho gene were inserted back into pET15b/SL with replacement of the original SphI-SacII fragments. DNA sequencing was performed to confirm that no spurious mutations had been introduced during PCR for all the mutant plasmids.
Construction of Deletion Mutants and Site-directed MutantsThree deletion mutants, SL(DEL 12891298), SL(DEL 12991308), and SL(DEL 12891308) (Table I), were constructed using the overlap PCR methods (29), similar to the method for removing the mini-intein (17). Site-directed alanine mutants SL(C1289A/C1292A) and SL(C1305A/C1308A) (Table I) were constructed using the overlap PCR methods (29) and as described (17).
Expression and Purification of the EnzymesThe vectors for
truncated, internal deletion, and site-directed mutants were transformed into
host E. coli BL21-CodonPlus (DE3)-RIL. The transformed cells were
grown in 2x YT medium containing ampicillin (100 mg/liter) at 37 °C.
When the A600 reached 0.61.0,
isopropyl-1-thio-
-D-galactopyranoside (2 mM) was
added to induce expression of the genes. After being cultured for 4 h at 37
°C, the cells were harvested by centrifugation, re-suspended in 50
mM Tris-HCl (pH 8.0) containing the protease inhibitor, and
disrupted on ice by sonication. The disrupted cells were heated at 85 °C
for 30 min and centrifuged at 27,000 x g for 20 min to remove
cell debris and denatured proteins. The expression of both DP1Pho and DP2Pho
in native or truncated forms was checked by SDS-PAGE performed on a
1015% gradient gel using the Phast system (Amersham Biosciences).
Protein bands were visualized by staining with Coomassie Brilliant Blue R-250.
The supernatant was dialyzed against buffer A (50 mM Tris-HCl, pH
8.0) then buffer B (50 mM Tris-HCl, pH 7.0). The dialysate was
loaded onto a Hitrap Q column (Amersham Biosciences) that was pre-equilibrated
using the fast protein liquid chromatography system (Amersham Biosciences).
The column was developed with a linear gradient of 01000 mM
NaCl. Fractions containing the PolDPho complex or a truncated single subunit
were dialyzed against buffer A to remove the salt. For further purification if
applicable, the samples were loaded onto a nickel column (Novagen). After a
wash with a buffer containing 20 mM imidazole, the enzymes were
eluted with the elution buffer containing 150 mM imidazole. For
purification by gel filtration, the samples were dialyzed with 50
mM Tris-HCl buffer (pH 8.0) and 200 mM NaCl,
concentrated using a microfilter (Microcon YM-10, Millipore Corp., Bedford,
MA), and loaded onto a Hiload Superdex-200 (10/16) column (Amersham
Biosciences) equilibrated with 50 mM Tris-HCl buffer and 200
mM NaCl (pH 8.0). The fraction was 0.5 ml and the flow rate was 0.5
ml/min. Peak fractions were collected and concentrated. The protein content
was determined with the Bio-Rad protein assay dye reagent (Bio-Rad) using
bovine serum albumin (BSA) as the standard protein.
Molecular Mass DeterminationThe molecular weight was estimated using fast protein liquid chromatography gel filtration on a Hiload Superdex-200 (10/16) column (Amersham Biosciences) equilibrated with 50 mM Tris-HCl buffer (pH 8.0) and 200 mM NaCl. The standards used were thyroglobulin (669 kDa), ferritin (440 kDa), catalase (232 kDa), aldolase (158 kDa), BSA (67 kDa), ovalbumin (43 kDa), chymotrypsinogen A (25 kDa), and ribonuclease A (13.7 kDa). The elution speed was 0.5 ml/min, and fraction size was set at 0.5 ml for the collection of protein samples.
Assay of DNA Polymerizing ActivityThe presence of dNTP in the reaction mixture is essential to synthesize DNA products by PolD. In the absence of dNTP, the substrate DNA is digested by the exonuclease activity. When the dNTP is omitted from the reaction mixture, only exonuclease activity is measurable.
The DNA polymerizing activity was assayed by measuring the incorporation of
[
-32P]dATP into a trichloroacetic acid-insoluble material.
The standard reaction mixture (in 50 µl) contained 20 mM
Tris-HCl (pH 8.8, 25 °C), 10 mM MgSO4, 10
mM KCl, 10 mM
(NH4)2SO4, 0.1% Triton X-100, 200 µg/ml
heat denatured salmon testes DNA, 0.25 mM dNTP mixture, 0.5 µCi
(9.25 kBq) of [
-32P]dATP, and 0.5 µg of purified enzymes
as specified. The reaction was performed at 70 °C for 30 min and then the
radioactivity was measured by scintillation counting.
Assay of Primer Extension ActivityThe primer extension
ability was assayed using a 100-mer oligonucleotide whose sequences were taken
from M13mp19 ssDNA
(5'-TCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGCACTGGCCGTCCTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTT-3',
from positions 6254 to 6353) annealed with a 5'-end labeled 34-mer
oligomer (5'-GTAACGCCAGGGTTTTCCCAGTCACGACGTTGTA-3', complementary
to positions 6337 to 6304 of M13mp18) as a substrate. The 34-mer was
radiolabeled at the 5' terminus with the bacteriophage T4 polynucleotide
kinase and [
-32P]ATP. A substrate of 84-mer oligomer
(5'-TCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGCACTGGCCGTCCTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTAC-3')
annealed with a FAM-labeled 25-mer
(5'-GTAACGCCAGGGTTTTCCCAGTCAC-3') at the 5' end was also
used at a late stage of this study. To make the substrate, labeled primers (10
pmol) were mixed with 20 pmol of the 100-mer or 84-mer oligonucleotides in 20
µl of buffer (7 mM Tris-HCl, pH 8.0, 50 mM NaCl, and
7 mM MgCl2). The tube was boiled for 5 min and then
cooled gradually to room temperature. The polymerization reaction mixture (10
µl) contained 20 mM Tris-HCl (pH 8.8, 25 °C), 10
mM MgSO4, 10 mM KCl, 10 mM
(NH4)2SO4, 0.1% Triton X-100, 0.25
mM dNTP, 0.5 or 2 pmol of labeled substrate as specified, and
enzymes. The reaction was performed at 60, 65, or 70 °C as specified.
After the reaction, 10 µl of stop buffer containing 95% formamide, 10
mM EDTA, and 1.0 mg/ml bromphenol blue was added to the mixture and
the tube was heated in boiling water for 5 min. The samples were loaded onto a
15% polyacrylamide gel containing 7 M urea and 1x TBE buffer
(89 mM Tris-HCl, 89 mM boric acid, and 2 mM
EDTA, pH 8.0) and electrophoresed for 1.5 h. Substrates and reaction products
were visualized using a PhosphorImager (Amersham Biosciences) or a FluorImager
585 (Amersham Biosciences).
Assay of 3'-5' Exonuclease ActivityThe reaction mixture and procedures used to assay the 3'-5' exonuclease activity of the wild type and mutants were the same as for the primer extension assay, except that the dNTP was not added. The reaction was performed at 60, 65, or 70 °C for 10 min or as indicated. After electrophoresis, the products were visualized and quantified using the PhosphorImager (Bio-Rad) or a FluorImager 585 (Amersham Biosciences), and quantified using the Molecular Analysis or IQMAC software.
Band Shifting AssayTo analyze the binding ability of PolDPho proteins, 40 to 2000 ng of protein was added to a buffer containing 2 pmol of 25-mer ssDNA (FAM 5'-GTAACGCCAGGGTTTTCCCAGTCAC-3'), 25-mer/25-mer double stranded DNA (FAM 5'-GTAACGCCAGGGTTTTCCCAGTCAC-3'/5'-GTGACTGGGAAAACCCTGGCGTTAC-3'), or 33-mer/25-mer (5'-ACAACGTCGTGACTGGGAAAACCCTGGCGTTAC-3'/FAM 5'-GTAACGCCAGGGTTTTCCCAGTCAC-3') substrates, 20 mM Tris-HCl (pH 8.0), 20 mM NaCl, 0.1% Triton X-100, and 50 µg/ml BSA. The tubes were left at room temperature for 20 min. Electrophoresis was carried out in 1x TBE buffer using 0.7% agarose gel, and the bands were verified using a FluorImager 585 scanner (Amersham Biosciences), and quantified using IQMAC software.
| RESULTS |
|---|
|
|
|---|
(19)
and a putative phosphoesterase domain for the 3'-5' exonuclease
(18,
21). The conserved regions of
DP2 are located at residues 1300, 350500, 650750, and
8001434. DP2Pho and DP2s from P. abyssi and
Halobacterium sp. NRC01 have a mini-intein inserted at sites close to
the catalytic center for polymerization
(Fig. 1)
(17). In the middle of the
sequences of DP2, there are four pairs of cysteines in P. horikoshii
and several other species, and two of them are conserved among all the species
(Fig. 1 and Supplementary
Materials Fig. 2). At the
COOH-terminal of DP2, there is another cysteine cluster containing two pairs
of cysteines that are conserved among all the DP2 sequences of 12 species and
between PolD and yeast DNA polymerase
(24,
30) (Figs.
1 and
2, and Supplementary Materials
Fig. 2). The two invariant
catalytic residues Asp1122 and Asp1124 of DP2Pho were
found to be located in the most conserved region of DP2. Both DP1Pho and
DP2Pho are acidic proteins with theoretical isoelectric points of 4.76 and
6.92, respectively. The NH2-terminal half of DP2Pho is acidic (the
pI value of the peptide from 1 to 745 is 5.27), whereas the COOH-terminal half
is basic (the pI value of the peptide from 784 to 1434 is 9.11).
|
Construction of Expression Vectors, Expression, Purification, and Characterization of the MutantsTwenty-five terminal truncation vectors were made for the analysis of terminal domains of both DP1Pho and DP2Pho using the co-expression vector (17). The truncation sites were chosen mainly based upon the sequence alignment, the sites at relatively less conserved regions were selected as start or end residues for NH2-terminal or COOH-terminal truncated mutants (Table I and Fig. 1). PCR was used to generate various mutants (Table I). Two site-directed mutants, SL(C1289A/C1292A) and SL(1305A/C1309A), and three internal deletion mutants SL(DEL 12891298), SL(DEL 12991308), and SL(DEL 12891308), were also made to investigate the function of the putative zinc finger motif (Table I, Fig. 1).
All of the proteins were well expressed using the E. coli expression system as judged by the presence of specific bands with anticipated molecular sizes, when the total protein was subjected to SDS-PAGE analysis and Western blotting. The thermostability of the truncated proteins was tested by heat treatment at 85 °C for 30 min of the cell extracts, and subsequent SDS-PAGE analysis and Western blotting analysis of the supernatant. For instance, the expression level and thermostability of four DP2Pho truncation constructs are shown in Fig. 3A. All of the proteins were well expressed. However, SL(1 481) was not thermostable, because no band was obtained from the supernatant (Fig. 3A, lane 7), whereas the others were resistant to the heat treatment (Fig. 3A, lanes 6, 8, and 9). To check the ability to form a complex, subsequent purification steps using a nickel column, anion exchange column, and gel filtration were performed. When complexes were formed, both DP1 and DP2 bands were present in SDS-PAGE profiles after the purification (Fig. 4, C, lanes 3 and 4, and D, lane 1). For DP2 truncation, a complex was able to form in SL(11332) and SL(11384) (Fig. 4C, lanes 3 and 4). For DP1 truncation, the complex formation was confirmed with the purified S(201622)L as shown in Fig. 4D, lane 1. The highly stable protein fragments, L(1300), L(1745), and S(1200) were overexpressed with vectors, pET15b/SL(1300), pET15b/S(L1745), and pET15b/S(1200)L, respectively. The polymerization and exonuclease activities were checked using purified truncation complexes. The characterization of the representative truncated proteins is summarized in Fig. 1.
|
Identification of Putative Regions Involved in the Interaction between DP1Pho and DP2PhoNine COOH-terminal truncated mutants of DP2Pho were analyzed (Figs. 1, 3A, and 4, AC). As shown in Fig. 4C, only mutants SL(11332) and SL(11384) were able to form PolDPho complexes. Mutant SL(11254) and all truncated forms lacking 12551332 of DP2Pho were incapable of complex formation, although most of the truncated DP2Pho proteins were highly thermostable (Fig. 4, AC). Similarly, five NH2-terminal and five COOH-terminal truncated mutants of DP1Pho were analyzed (Table I, Figs. 1, 3, B and C, and 4D). As shown in Fig. 4D, mutant S(201622)L retained the ability to interact and formed a stable complex, whereas mutant S(261622)L and all other DP1 NH2-terminal mutants lacking the region from 201 to 260 showed no interaction (Fig. 1, details not shown). Mutant S(1598)L and all other COOH-terminal mutants of DP1Pho lacking the region from 599 to 622 were unable to form a protein complex either (Fig. 1, details not shown). These findings indicate that the 78-amino acid region from residue 1255 to 1332 in DP2Pho, the 60-amino acid region from residue 201 to 260 in DP1Pho, and the 24-amino acid region from 599 to 622 in DP1Pho, are essential amino sequences for the formation of stable complex of PolDPho. One possibility is that they may directly involve in subunit interaction (see "Discussion").
The N-terminal of DP2Pho(1300) Is Likely the Oligomerization Domain and May Play a Structural Role in Forming PolD-Pho ComplexAs shown in Fig. 4A, the NH2-terminal 1300 fragment (lane 1) and 1745 fragment (lane 2) of DP2Pho were highly stable and could be purified in high purity and quantity. Two longer NH2-terminal fragments of DP2Pho, L(1853), and L(11189), were not so stable and produced nicked molecules (Fig. 4B, lanes 1 and 2). Considering that no DP2Pho fragments lacking the NH2-terminal 1300 region are thermostable (Fig. 1, details not shown), we suppose that the NH2-terminal 1300 plays an important role in the folding of DP2Pho and in the maintaining of the thermostability of PolDPho.
The molecular mass of the NH2-terminal 1300 of DP2Pho was measured using gel filtration. The expected value of the NH2-terminal 1300 of DP2Pho is 33.5 kDa. As shown in Fig. 5A, the profile of the 1300 fragment showed two major peaks (arrows) with molecular mass of 110 and 62 kDa, respectively, corresponding to the trimer and dimer molecules. A small peak eluted at 8.1 ml, close to the bed volume (7.8 ml) of the column. This indicates that only a small amount of DP2Pho(1300) protein formed aggregates and the NH2-terminal 1300 of DP2Pho protein was stable. By SDS-PAGE analysis, the majority of the protein migrated at the position of around 33 kDa (Fig. 5B), but a faint band appeared at the position of about 70 kDa. We presume that this slower band is the incompletely denatured dimeric molecule.
|
We have obtained crystals of both native and selenomethionine-substituted DP2Pho(1300), which are applicable in x-ray structure analysis. This indicates that the multimerization of DP2Pho(1300) seems unlikely to be caused by nonspecific aggregation. In the cell unit of the crystals, there are eight DP2Pho(1300) molecules arranged orderly (details not shown). Careful analysis of the interfaces between the molecules in the cell unit may provide information about how the oligomerization of DP2Pho(1300) is achieved.
The Dispensability of the NH2-terminal 1200 of DP1Pho and COOH-terminal 13851434 of DP2Pho for the Polymerization and 3'-5' Exonuclease Activities and the Elevation of Exonuclease Activity of PolDPho because of Truncation of the NH2-terminal 1200 ResiduesAs shown in Fig. 4, C, lane 4 and D, lane 1, two mutants, S(201622)L and SL(11384), could be purified as the wild type PolD. These two mutants had polymerization (not shown) and 3'-5' exonuclease activities (Fig. 7A). To identify the catalytic core of PolDPho, a mutant, S(201622)L(11384) was also made. The activities were compared with the wild type PolDPho. As shown in Fig. 6, the polymerization of S(201622)L(11384) remained the same as the wild type when measured using the acid precipitation method and primer extension assay (Fig. 6, A and B). To our surprise, the exonuclease activity of S(210622)L(11384) and S(201622)L was remarkably elevated compared with that of the wild type PolDPho (Figs. 6B, and 7, A and B). The substrate remaining of the two DP1Pho(1200) truncated mutants, S(210622)L(11384) and S(201622)L, after 1 or 5 min incubation, was only about one-seventh of that of the proteins with full-length of DP1Pho, the wild type, and mutant S(1622)L(11384) (Fig. 7B). These results indicate that the NH2-terminal 200 amino acids of DP1Pho and the COOH-terminal 50 amino acids of DP2Pho are not absolutely required for either complex formation or catalysis. The 1200 fragment of DP1Pho is related to the exonuclease activity of PolD, truncation of it enhances the 3'-5' exonuclease activity, whereas the COOH-terminal 50 amino acids of PD2Pho are not directly related to the catalysis, but may be involved in protein-protein interaction.
|
|
The N-terminal 1200 Domain of DP1Pho Forms a Highly Stable
Protein and Negatively Regulates the Exonuclease of PolDPhoThe
fragment of S(1200) was found to form a thermostable protein, and could
be purified in high purity (Fig.
4D, lane 2). The 1200 fragment migrated
to a position of
39 kDa in SDS-PAGE analysis, much higher than its
expected size (22.5 kDa) (Fig.
4D, lane 2). Two other COOH-terminal mutants of
DP1Pho, S(1569)L and S (1598)
(Fig. 3, B and
C, lanes 3 and 4), also migrated much
more slowly than expected. In contrast, three NH2-terminal
truncated mutants of DP1Pho, S(201622)L
(Fig. 4D, lane
1), S(261622)L, and S(301622)L
(Fig. 3, B and
C, lanes 1 and 2), migrated as
expected. It was noted that the full-length DP1Pho migrated as a 90-kDa
protein, significantly higher than its expected size of 70 kDa
(17). The reason for this
retardation is not know. It seems that it was the NH2-terminal
1200 that leads to the slower migration of DP1Pho. Gel filtration
analysis showed that the 1200 fragment formed a monomer rather than
dimer (data not shown), suggesting that the NH2-terminal
1200 fragment of DP1PHo is not likely involved in the dimerization of
PolDPho (17).
To elucidate the mechanism behind the elevation in the 3'-5' exonuclease activity of mutant S(201622)L, we examined the effect of DP1Pho(1200) on the exonuclease activity of mutant S(201622)L(11384) protein. As shown in Fig. 8, the activity of mutant S(201622)L(11384) protein was reduced when DP1Pho(1200) was added. The more DP1(1200) was added the weaker the exonuclease activity became (Fig. 8, lanes 48). As a control, BSA at the same ratios was added to the reaction tubes and no change in activity was observed (Fig. 8, lanes 913).
|
We compared the DNA binding abilities of the wild type and mutant S(201622)L(11384) using a band shift assay. As shown in Fig. 9, AC (lanes 1 and 2) and D, the ability of the mutant S(201622)L(11384) to bind single stranded DNA is remarkably higher than that of the wild type. A similar difference was also observed using blunt end and recessive end dsDNA (Fig. 9, C and D), although with less magnitude. It is proposed that DP1(1200) and DNA compete for the same site on PolDPho. Consistent with this assumption, the NH2-terminal 1200 of DP1Pho is very acid with a calculated pI of 3.91. In the wild type PolDPho, the DP1Pho(1200) region may interact with the DNA binding site and regulate the exonuclease activity of PolDPho.
|
Deletion Mutants in the Region of the COOH-terminal Putative Zinc
Finger Motif (Cysteine Cluster II) of DP2Pho Were Able to Form Complex and Had
Polymerization Ability but Lost the Exonuclease ActivityThe
COOH-terminal of DP2 contains a conserved putative zinc finger motif
(Cys1289-Cys1308 of DP2Pho). It is within a homologuos
region between PolDPho-(12641335) and yeast DNA polymerase
(Fig. 2). This region was found
to be essential for DNA replication and for an intact S/M cell cycle
checkpoint in yeast (30). The
subunit interaction region identified in DP2Pho(12551332) as shown
above encompasses the putative zinc finger motif. To investigate the role of
the putative zinc finger motif, deletion mutants SL(DEL 12891298),
SL(DEL 12991308), and SL(DEL 12891308), and site-directed
alanine mutants, SL(C1289/C1292) and SL(C1305/C1308) were made
(Table I and
Fig. 1). The proteins were
purified and PolDPho complexes were formed for all the five mutants
(Fig. 10D). The
primer extension and 3'-5' exonuclease activities were measured
(Fig. 10, A and
B). It was found that the polymerization activity of
SL(DEL 12891298), SL(DEL 12991308), and SL(DEL 12891308)
remained, although it was reduced (Fig.
10A). However, the exonuclease activity was not detected
(Fig. 10B), even if
the reaction time was elongated from 5
(Fig. 10B) to 30 min
(Fig. 10C).
Meanwhile, for the site-directed mutants SL(C1289/C1292) and SL(C1305/C1308),
both polymerization and exonuclease activities were unaffected compared with
the wild type PolDPho (Fig. 10,
AC). These results suggested that the
region between the two pairs of cysteine residues, not the cysteine residues
themselves, is directly involved in the exonuclease activity, because an
alanine mutation of either cysteine pair did not have any effect on the
catalytic activities.
|
| DISCUSSION |
|---|
|
|
|---|
|
One of the most interesting findings is that we identified three critical regions for the formation of the stable PolDPho complex. They might be the regions for the subunit interaction of PolDPho. The region in DP2Pho is a 78-amino acid sequence from residue 1255 to 1332. Two areas in DP1Pho are from 201 to 260 (60 amino acid) and from 599 to 622 (24 amino acid). The 78-amino acid region in DP2Pho was recently confirmed by yeast two-hybrid analysis assay.3 The two regions in DP1Pho have yet to be confirmed, however, a study in P. furiosus found that the two corresponding sites in DP1 of P. furiosus were critical for strong polymerization activity (25), which is consistent with our results.
It is not clear how they function in complex formation. They may be directly involved in subunit interaction. Alternatively, they may be involved in the folding of individual subunit, or local domains, so that they indirectly effect the complex formation. This may be particularly true for the DP1 region from 599 to 622, because DP1(1598) and similar truncated DP1 mutants are not thermostable (Fig. 1). The third possibility may be that the folding and subunit interaction processes are inseparable. This might be reasonable, because neither DP1 nor DP2 was stable when expressed individually, and in the genome of Pyrococcus the genes are arranged in tandem in the same operon (17).
It is interesting that the identified region (12551332) of DP2Pho is
within the homology region of DP2 with the catalytic subunit of yeast DNA
polymerase
(Fig. 2). In
yeast, this area is very important for DNA replication and a checkpoint, its
deletion resulting in sensitivity to methylmethane sulfonate
(24,
30). This region functions in
protein/protein interaction and protein/DNA interaction. It was found that
yeast could survive with a deletion of the catalytic domain if the
COOH-terminal region was present
(31,
32), and it was suggested that
another DNA polymerase could substitute for the catalysis of DNA replication
through the recruitment of enzymes by the COOH-terminal region of DNA
polymerase
. Because in PolD the region was found to probably interact
with DP1, which contains a putative domain homologous to the small subunits of
eukaryote polymerase
,
, and
, and Mre11, it could be
hypothesized that in yeast the COOH-terminal region of polymerase
interacts with the small subunits of DNA polymerase
,
, or Mre11
for DNA replication and DNA repair. Further characterization of PolD
structurally and biochemically in Archaea may shed light on the mechanism by
which polymerase
associates with other DNA replication and repair
proteins in eukaryotes.
A surprising observation is that deletion of the COOH-terminal zinc finger region (12891308) did not abolish the subunit interaction (Fig. 10D). Instead, while the polymerization of the deletion mutants remained (Fig. 10A), the 3'-5' exonuclease was completely inactivated (Fig. 10, B and C). Our explanation is that the putative zinc finger region is neither the single nor main region for the subunit interaction. Other parts or the whole domain in the COOH-terminal of DP2Pho may also be involved in the interaction. The internal region of the zinc finger motif may mainly interact with DP1Pho to form the catalytic center for the exonuclease activity. Further study of the interaction between the zinc finger motif and DP1 may reveal how the exonuclease catalysis works in PolDPho.
Another interesting observation is that the truncated mutant S(201622)L had enhanced exonuclease activity and DNA binding ability, and that the NH2-terminal 1200 fragment of DP1Pho, which is the least conserved among DP1 from 12 species, can form a highly stable protein and inhibits the exonuclease of S(201622)L. It seems likely that DP1(1200) regulates the exonuclease activity of PolD through binding to the DNA binding site. Because DP1(1200) is very acidic, it might form a DNA analogue and compete with DNA for the binding site of PolD. This finding may also indicate that the small subunit is responsible for the exonuclease activity of PolD.
We found that the NH2-terminal 1300 fragment of DP2Pho forms an extremely stable and oligomeric protein by gel filtration analysis. During purification of several other native NH2-terminal DP2Pho fragments, including DP2Pho(1318), DP2Pho(1705), DP2Pho(1745), and selenomethionine-substituted DP2Pho(1300), for crystallization analysis, we always found putative oligomeric molecules of them but not monomer molecules in the gel filtration step (data not shown). However, further biochemical analysis using techniques such as sedimentation velocity analysis and crystal x-ray or NMR structural analysis are needed to confirm the real state of DP2Pho(1300) in both solution and static conditions.
The tendency of the NH2-terminal DP2Pho to form ordered
oligomers might provide evidence that PolDPho forms a heterotetrameric
structure (L2S2). Previously, it was suggested that wild
type PolDPho formed a heterotetrameric structure (L2S2)
containing two large and two small subunits in one molecule based on gel
filtration analysis (17). It
seems to be likely that the NH2-terminal 1300 domain plays a
fundamental role in the formation of the heterotetrameric structure
(L2S2) of PolDPho. An asymmetric dimeric structure is
believed reasonable for the coupling of both the leading and lagging strand
DNA synthesis at the DNA replication fork. It is known that the replicative
holoenzyme III of E. coli is such an asymmetric dimer containing two
subunits that are responsible for the synthesis of both DNA strands
(33,
34). The T4 DNA polymerase was
found to form a dimer in the presence of DNA
(37). The DNA polymerase
of budding yeast Saccharomyces cerevisiae was found to form a
dimeric structure in vivo and the dimerization is essential for DNA
replication (24). The nature
of DNA polymerase
seems to be controversial. It was reported that both
recombinant and native DNA polymerase
of Schizosaccharomyces
pombe are composed of four subunits and form a dimeric structure
(35). Recently, detailed
biochemical analysis demonstrated a monomer structure for DNA polymerase
(36). The settling of this
issue may require elucidation of the structure of the DNA replicase. Because
of the similarity between PolD and DNA polymerase
and
, the
structure of thermostable PolD if solved will help us understand the structure
of eukaryote DNA replicases and the DNA replication mechanism.
| FOOTNOTES |
|---|
The on-line version of this article (available at
http://www.jbc.org)
contains Figs. 1 and
2. ![]()
To whom correspondence should be addressed: Biological Information Research
Center, National Institute of Advanced Science and Technology, Tsukuba,
Ibaraki 305-8566, Japan. Tel.: 81-298-616142; Fax: 81-298-616151; E-mail:
ik-matsui{at}aist.go.jp.
1 The abbreviations used are: PolD, family D DNA polymerase; DP1, small
subunit of the family D DNA polymerase; DP2, large subunit of the family D DNA
polymerase; PolDPho, family D DNA polymerase from P. horikoshii;
DP1Pho, small subunit of the family D DNA polymerase from P.
horikoshii; DP2Pho, large subunit of the family D DNA polymerase from
P. horikoshii; FAM, fluorescein; BSA, bovine serum albumin; ssDNA,
single stranded DNA; dsDNA, double stranded DNA. ![]()
2 Y. Shen, X-F. Tang, and I. Matsui, unpublished data. ![]()
3 X.-F. Tang, Y. Shen, and I. Matsui, manuscript in preparation. ![]()
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
This article has been cited by