JBC PeproTech; Our Business is Cytokines!

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M212286200 on March 24, 2003

J. Biol. Chem., Vol. 278, Issue 23, 21247-21257, June 6, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow All Versions of this Article:
278/23/21247    most recent
M212286200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shen, Y.
Right arrow Articles by Matsui, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shen, Y.
Right arrow Articles by Matsui, I.

Subunit Interaction and Regulation of Activity through Terminal Domains of the Family D DNA Polymerase from Pyrococcus horikoshii*,

Yulong Shen, Xiao-Feng Tang and Ikuo Matsui {ddagger}

From the Biological Information Research Center, National Institute of Advanced Science and Technology, Tsukuba, Ibaraki 305, Japan

Received for publication, December 3, 2002 , and in revised form, March 20, 2003.
    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Functions of the terminal domains of the family D DNA polymerase from Pyrococcus horikoshii (PolDPho) were analyzed by making and characterizing various truncated proteins. Based on a co-expression vector developed previously (Shen, Y., Musti, K., Hiramoto, M., Kikuchi, H., Kawabayashi, Y., and Matsui, I. (2001) J. Biol. Chem. 276, 27376–27383), 25 vectors for terminal truncated proteins were constructed. The expressed proteins were characterized in terms of thermostability, subunit interaction, and polymerization and 3'-5' exonuclease activities. The carboxyl-terminal (1255–1332) of the large subunit (DP2Pho) and two regions, the 201–260 and 599–622, of the small subunit (DP1Pho) were found to be critical for the complex formation, and probable subunit interaction of PolDPho. The amino-terminal (1–300) of DP2Pho is essential for the folding of PolDPho and is likely the oligomerization domain of PolDPho. A short region at the extreme C-terminal of DP2Pho (from 1385 to 1434) and the N-terminal of DP1Pho(1–200), which forms a stable protein, are not absolutely necessary for either polymerization or the 3'-5' exonuclease activity. We identified a possible regulatory role of DP1Pho(1–200) for the 3'-5' exonuclease. Deletion of DP1Pho(1–200) increased the exonuclease and DNA binding activities of PolDPho. Adding DP1Pho(1–200) to the truncated protein suppressed the elevated exonuclease activity. We also constructed and analyzed three internal deletion mutants and two site-directed mutants in the region of the putative zinc finger motif (cysteine cluster II) of DP2Pho at the COOH-terminal. We found that the internal region of the zinc finger motif is critical for the 3'-5' exonuclease, but is dispensable for the DNA polymerization.



View larger version (44K):
[in this window]
[in a new window]
 
FIG. 1.
Schematic maps and the phenotypes summarized of the mutants analyzed in this study. Vectors are named as in Table I, as indicated with Footnote a. Footnote b shows the conserved region among DP1s that shows homology to the eukaryote small subunit of DNA polymerase {delta} is indicated in the box colored in yellow. The mini-intein insertion site and the catalytic center for polymerization in DP2 are shown with arrows and vertical lines. The region that shows homology to the catalytic subunit of yeast DNA polymerase {epsilon} in DP2 is indicated in the box colored in red. Two cysteine clusters are indicated with boxes filled with horizontal lines. The numbers in bold and blue in the parentheses are the numbers of peptide without the intein. Footnote c indicates the thermostability of the truncated peptide (ther. stab.), defined as the presence (+) or absence (-) of specific bands on SDS-GAGE analysis of the supernatant after heating at 85 °C for 30 min (Fig. 3). Subunit Inter., subunit interaction, the ability of complex formation between DP1Pho and DP2Pho after purification steps; Pol., polymerization; Exo., 3'-5' exonuclease activities; +, positive; -, negative; blank, not checked.

 


View larger version (11K):
[in this window]
[in a new window]
 
FIG. 2.
Alignment of the homologous regions of DP2Pho and the large subunit of DNA polymerase {epsilon} of S. cerevisiae. The region was identified when the DNA data bases were searched by BLAST using DP2Pho (without the intein) as a query. Invariant and conserved residues between DP2 from the 12 species and yeast DNA polymerase {epsilon} are in red and blue, respectively. Symbols + and the letters between the sequences indicate conserved and identical residues. The residue numbers of PolDPho are those in which the intein is included.

 

    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Family D DNA polymerase (PolD)1 is a recently found DNA polymerase that exists extensively in Euryarchaeota of Archaea, the third domain of life (1, 2). So far at least 12 archaeal species have been found to have family D DNA polymerases, and their sequences have been deposited in data bases. These species include Pyrococcus horikoshii, Pyrococcus abyssi, Pyrococcus furiosus, Methanococcus jannaschii, Methanosarcina mazei, Methanosarcina acetivorans, Methanobacterium thermoautotrophicum, Archaeoglobus fulgidus, Thermoplasma volcanium, Thermoplasma acidophilum, Methanopyrus kandleri, and Halobacterium sp. NRC01 (3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14). Some members of the DNA polymerase family have been cloned and biochemically characterized, such as PolDs from P. furiosus (15), M. jannaschii (16), P. horikoshii (17), and P. abyssi (18), nevertheless, no structural information on PolD is available at present.

PolD is composed of a small subunit (DP1) and a large subunit (DP2). The interaction of DP1 and DP2 is essential for the stability and full activity of the enzyme (15, 16). DP1 or DP2 expressed in Escherichia coli is unstable and easily degraded. PolD possesses strong DNA polymerizing and 3'-5' exonuclease (proofreading) activities like other DNA replication polymerases, however, common motifs for the catalysis of other DNA polymerases are absent or not functional in PolD (17, 19). Two invariant residues, Asp1122 and Asp1124 of DP2Pho, located in the most conserved region in the large subunit of PolD, were identified to be the catalytic residues for the DNA polymerization activities (17), indicating that the COOH-terminal of DP2 is involved in the formation of the catalytic center for DNA synthesis. A heterotetrameric structure for PolD from P. horikoshii (PolDPho) was proposed based on the result of gel filtration (17).

Several lines of evidence indicate that family D DNA polymerase is likely the major DNA polymerase or replicase in Euryarchaeota, participating in DNA replication, repair, and recombination. In the genomes of the genus Pyrococcus, the genes coding the two subunits of PolD are adjacent to the replication origin and several essential genes for DNA metabolism (20). DP1 shows low but significant homology to the small subunit of eukaryote DNA polymerase {alpha}, {delta}, and {epsilon} (19, 21), and contains domain and catalytic motifs for the 3'-5' exonuclease, similar to those of Mre11, a nuclease involved in double strand DNA break repair (18, 21, 22). The amino acid sequences of DP2 contain a short region at the COOH-terminal, which shows homology to the catalytic subunit of yeast DNA polymerase {epsilon} (this paper) around the COOH-terminal putative zinc finger motif (cysteine cluster II). This homologous region in yeast polymerase {epsilon} is found to be vital for the survival of yeast (23, 24). PolD interacts with many proteins related to DNA replication, repair, and recombination. It was found that DP1 from P. furiosus interacts specifically with archaeal RadB by yeast two-hybrid analysis and in vitro pull-down assays (25). DP2 directly interacts with proliferating cell nuclear antigen as analyzed by in vivo immunoprecipitation assays, in vitro pull-down assays in P. furiosus (26), and yeast two-hybrid assays in A. fulgidus (27). Proliferating cell nuclear antigen was found to stimulate the polymerization activity of PolD of P. furiosus (26). Recently, the physical interaction of PolDPho with proliferating cell nuclear antigen was observed using gel filtration analysis, and DP2 was found to interact with replication factor C by yeast two-hybrid analysis in P. horikoshii.2 These findings strongly indicate that PolD plays an essential role in DNA replication, repair, and recombination.

Despite continuous efforts, the whole structure and detailed mechanism of DNA replication of replicative DNA polymerases in the three domains of life, such as polymerase III holoenzyme in E. coli, and DNA polymerase {alpha}, {delta}, and {epsilon} in yeast, remain to be elucidated. This is particularly the case for eukaryotes whose replication mechanism has become complicated during evolution and more difficult to study. PolD might be an ideal molecule for structural analysis as a DNA replicase. Because many proteins related to DNA replication in Archaea are similar to those in eukaryotes (28), the study of archaeal replicative proteins will help us understand the DNA replication mechanism in eukaryotes. The advantage of using archaeal proteins for analysis is that they are mostly thermo-stable, and relatively easy to purify and crystallize.

To improve our understanding of the structure and properties of PolD, we analyzed the domain structure using proteins truncated at the amino- and carboxyl-terminals of both DP1Pho and DP2Pho, and studied the function of the putative zinc finger motif (cysteine cluster II) at the COOH-terminal of DP2Pho using deletion and site-directed mutants. We identified putative regions responsible for subunit interaction, oligomerization, and regulation of the 3'-5' exonuclease activity in PolDPho. We found that the internal region of the putative zinc finger motif is indispensable for the 3'-5' exonuclease activity. Two NH2-terminal fragments of DP2Pho and one NH2-terminal domain of DP1Pho were highly expressed and purified and could be used for crystal structural analysis of PolDPho.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Chemicals and Bacteria Strains—The pET15b vector and ultracompetent E. coli XL2-Blue MRF' cells were purchased from Stratagene (La Jolla, CA). The pGEMEX-1 vector was obtained from Promega (Madison, WI). The E. coli strain BL21-CondonPlus (DE3)-RIL competent cells were purchased from Stratagene. Deep Vent DNA polymerase was provided by New England Biolabs (Beverly, MA). Restriction enzymes were obtained from Takara Shuzo (Otsu, Shiga, Japan) and Promega (Madison, WI). The DNA ligation kit was purchased from Takara Shuzo, and was used according to the manufacturer's recommendation. T4 polynucleotide kinase was obtained from Promega, and protease inhibitor mixture tablets (EDTA-free) were purchased from Roche Diagnostics (Mannheim, Germany). FAM-labeled oligonucleotide was provided by Sawady-Qiagen (Tokyo, Japan).

Construction of Vectors for Expression of Truncated Proteins—The construction of expression vectors was based on a previously reported co-expression system and vectors (17). PolDPho was expressed with a histidine tag (His tag) at the NH2 terminus of DP1Pho. To construct vectors for COOH-terminal-truncated proteins of DP2Pho, downstream primers were designed at the intended sites. Within each primer, a stop codon followed by a NsiI site was added after the nucleotide sequences at the sites of truncation (Table I). PCR was performed using an upstream primer, pGEM-rbs or L3 and site-specific primers, with the co-expression plasmid pET15b/SL as the template (Table I). The amplified fragments were digested with SacII (or SalI) and NsiI, and inserted into pET15b/SL digested with the corresponding enzymes (17).


View this table:
[in this window]
[in a new window]
 
TABLE I
List of the vectors for the expression of mutant proteins and the primers used in the amplification of mutant fragments by PCR

 

To construct vectors for the amino-terminal-truncated proteins of DP2Pho, upstream primers were designed at the intended sites. Within each primer, a NdeI site was created immediately ahead of the site of truncation. PCR using the specific primers and L2 or L4 and template pET15b/SL was carried out (Table I). After digestion with NdeI and SalI or Nsil, the fragments were cloned into pGEMEX-1. A second PCR was performed using primer pGEM-rbs and L2 or L4, and the pGEMEX-1 plasmids containing the corresponding insert. After digestion with SacII and SalI (or NsiI), the fragments were cloned back into pET15b/SL to replace the wild type SacII-SalI (or SacII-NsiI) fragments.

To construct vectors for COOH-terminal-truncated proteins of DP1Pho, primers were designed to include a stop codon and a SacII site at the intended sites (Table I). PCR was performed using the vector-derived primer pET-SphI (the SphI site is 354 bp upstream of the NdeI site in pET15b) and specific primers. After digestion with SphI and SacII, the fragments were cloned back into the pET15b/SL vector digested with SphI and SacII (17).

To construct vectors for NH2-terminal-truncated proteins of DP1Pho, site-specific primers were made, in which a NdeI site was created artificially ahead of the intended site of truncation. After PCR using the specific primers and S2M and digestion with NdeI and BamHI, the fragments were cloned into pET15b. Then a second PCR was conducted using the pET15b-derived primer pET-SphI and S2M. After digestion with SphI and SacII, the genes with a truncation of the DP1Pho gene were inserted back into pET15b/SL with replacement of the original SphI-SacII fragments. DNA sequencing was performed to confirm that no spurious mutations had been introduced during PCR for all the mutant plasmids.

Construction of Deletion Mutants and Site-directed Mutants—Three deletion mutants, SL(DEL 1289–1298), SL(DEL 1299–1308), and SL(DEL 1289–1308) (Table I), were constructed using the overlap PCR methods (29), similar to the method for removing the mini-intein (17). Site-directed alanine mutants SL(C1289A/C1292A) and SL(C1305A/C1308A) (Table I) were constructed using the overlap PCR methods (29) and as described (17).

Expression and Purification of the Enzymes—The vectors for truncated, internal deletion, and site-directed mutants were transformed into host E. coli BL21-CodonPlus (DE3)-RIL. The transformed cells were grown in 2x YT medium containing ampicillin (100 mg/liter) at 37 °C. When the A600 reached 0.6–1.0, isopropyl-1-thio-{beta}-D-galactopyranoside (2 mM) was added to induce expression of the genes. After being cultured for 4 h at 37 °C, the cells were harvested by centrifugation, re-suspended in 50 mM Tris-HCl (pH 8.0) containing the protease inhibitor, and disrupted on ice by sonication. The disrupted cells were heated at 85 °C for 30 min and centrifuged at 27,000 x g for 20 min to remove cell debris and denatured proteins. The expression of both DP1Pho and DP2Pho in native or truncated forms was checked by SDS-PAGE performed on a 10–15% gradient gel using the Phast system (Amersham Biosciences). Protein bands were visualized by staining with Coomassie Brilliant Blue R-250. The supernatant was dialyzed against buffer A (50 mM Tris-HCl, pH 8.0) then buffer B (50 mM Tris-HCl, pH 7.0). The dialysate was loaded onto a Hitrap Q column (Amersham Biosciences) that was pre-equilibrated using the fast protein liquid chromatography system (Amersham Biosciences). The column was developed with a linear gradient of 0–1000 mM NaCl. Fractions containing the PolDPho complex or a truncated single subunit were dialyzed against buffer A to remove the salt. For further purification if applicable, the samples were loaded onto a nickel column (Novagen). After a wash with a buffer containing 20 mM imidazole, the enzymes were eluted with the elution buffer containing 150 mM imidazole. For purification by gel filtration, the samples were dialyzed with 50 mM Tris-HCl buffer (pH 8.0) and 200 mM NaCl, concentrated using a microfilter (Microcon YM-10, Millipore Corp., Bedford, MA), and loaded onto a Hiload Superdex-200 (10/16) column (Amersham Biosciences) equilibrated with 50 mM Tris-HCl buffer and 200 mM NaCl (pH 8.0). The fraction was 0.5 ml and the flow rate was 0.5 ml/min. Peak fractions were collected and concentrated. The protein content was determined with the Bio-Rad protein assay dye reagent (Bio-Rad) using bovine serum albumin (BSA) as the standard protein.

Molecular Mass Determination—The molecular weight was estimated using fast protein liquid chromatography gel filtration on a Hiload Superdex-200 (10/16) column (Amersham Biosciences) equilibrated with 50 mM Tris-HCl buffer (pH 8.0) and 200 mM NaCl. The standards used were thyroglobulin (669 kDa), ferritin (440 kDa), catalase (232 kDa), aldolase (158 kDa), BSA (67 kDa), ovalbumin (43 kDa), chymotrypsinogen A (25 kDa), and ribonuclease A (13.7 kDa). The elution speed was 0.5 ml/min, and fraction size was set at 0.5 ml for the collection of protein samples.

Assay of DNA Polymerizing Activity—The presence of dNTP in the reaction mixture is essential to synthesize DNA products by PolD. In the absence of dNTP, the substrate DNA is digested by the exonuclease activity. When the dNTP is omitted from the reaction mixture, only exonuclease activity is measurable.

The DNA polymerizing activity was assayed by measuring the incorporation of [{alpha}-32P]dATP into a trichloroacetic acid-insoluble material. The standard reaction mixture (in 50 µl) contained 20 mM Tris-HCl (pH 8.8, 25 °C), 10 mM MgSO4, 10 mM KCl, 10 mM (NH4)2SO4, 0.1% Triton X-100, 200 µg/ml heat denatured salmon testes DNA, 0.25 mM dNTP mixture, 0.5 µCi (9.25 kBq) of [{alpha}-32P]dATP, and 0.5 µg of purified enzymes as specified. The reaction was performed at 70 °C for 30 min and then the radioactivity was measured by scintillation counting.

Assay of Primer Extension Activity—The primer extension ability was assayed using a 100-mer oligonucleotide whose sequences were taken from M13mp19 ssDNA (5'-TCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGCACTGGCCGTCCTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTT-3', from positions 6254 to 6353) annealed with a 5'-end labeled 34-mer oligomer (5'-GTAACGCCAGGGTTTTCCCAGTCACGACGTTGTA-3', complementary to positions 6337 to 6304 of M13mp18) as a substrate. The 34-mer was radiolabeled at the 5' terminus with the bacteriophage T4 polynucleotide kinase and [{gamma}-32P]ATP. A substrate of 84-mer oligomer (5'-TCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGCACTGGCCGTCCTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTAC-3') annealed with a FAM-labeled 25-mer (5'-GTAACGCCAGGGTTTTCCCAGTCAC-3') at the 5' end was also used at a late stage of this study. To make the substrate, labeled primers (10 pmol) were mixed with 20 pmol of the 100-mer or 84-mer oligonucleotides in 20 µl of buffer (7 mM Tris-HCl, pH 8.0, 50 mM NaCl, and 7 mM MgCl2). The tube was boiled for 5 min and then cooled gradually to room temperature. The polymerization reaction mixture (10 µl) contained 20 mM Tris-HCl (pH 8.8, 25 °C), 10 mM MgSO4, 10 mM KCl, 10 mM (NH4)2SO4, 0.1% Triton X-100, 0.25 mM dNTP, 0.5 or 2 pmol of labeled substrate as specified, and enzymes. The reaction was performed at 60, 65, or 70 °C as specified. After the reaction, 10 µl of stop buffer containing 95% formamide, 10 mM EDTA, and 1.0 mg/ml bromphenol blue was added to the mixture and the tube was heated in boiling water for 5 min. The samples were loaded onto a 15% polyacrylamide gel containing 7 M urea and 1x TBE buffer (89 mM Tris-HCl, 89 mM boric acid, and 2 mM EDTA, pH 8.0) and electrophoresed for 1.5 h. Substrates and reaction products were visualized using a PhosphorImager (Amersham Biosciences) or a FluorImager 585 (Amersham Biosciences).

Assay of 3'-5' Exonuclease Activity—The reaction mixture and procedures used to assay the 3'-5' exonuclease activity of the wild type and mutants were the same as for the primer extension assay, except that the dNTP was not added. The reaction was performed at 60, 65, or 70 °C for 10 min or as indicated. After electrophoresis, the products were visualized and quantified using the PhosphorImager (Bio-Rad) or a FluorImager 585 (Amersham Biosciences), and quantified using the Molecular Analysis or IQMAC software.

Band Shifting Assay—To analyze the binding ability of PolDPho proteins, 40 to 2000 ng of protein was added to a buffer containing 2 pmol of 25-mer ssDNA (FAM 5'-GTAACGCCAGGGTTTTCCCAGTCAC-3'), 25-mer/25-mer double stranded DNA (FAM 5'-GTAACGCCAGGGTTTTCCCAGTCAC-3'/5'-GTGACTGGGAAAACCCTGGCGTTAC-3'), or 33-mer/25-mer (5'-ACAACGTCGTGACTGGGAAAACCCTGGCGTTAC-3'/FAM 5'-GTAACGCCAGGGTTTTCCCAGTCAC-3') substrates, 20 mM Tris-HCl (pH 8.0), 20 mM NaCl, 0.1% Triton X-100, and 50 µg/ml BSA. The tubes were left at room temperature for 20 min. Electrophoresis was carried out in 1x TBE buffer using 0.7% agarose gel, and the bands were verified using a FluorImager 585 scanner (Amersham Biosciences), and quantified using IQMAC software.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Sequence Features of PolD—To determine the truncation sites for structural analysis of PolDPho, the amino acid sequences of DP1 and DP2 from 12 species were compared (Supplementary Materials Figs. 1 and 2). It was found that DP1 is conserved at its middle and COOH-terminal (from around 201 to 622), but not at its NH2-terminal. The most conserved region is from residue 300 to 600, which contains a sequence homologous to the small subunit of eukaryotes DNA polymerase {delta} (19) and a putative phosphoesterase domain for the 3'-5' exonuclease (18, 21). The conserved regions of DP2 are located at residues 1–300, 350–500, 650–750, and 800–1434. DP2Pho and DP2s from P. abyssi and Halobacterium sp. NRC01 have a mini-intein inserted at sites close to the catalytic center for polymerization (Fig. 1) (17). In the middle of the sequences of DP2, there are four pairs of cysteines in P. horikoshii and several other species, and two of them are conserved among all the species (Fig. 1 and Supplementary Materials Fig. 2). At the COOH-terminal of DP2, there is another cysteine cluster containing two pairs of cysteines that are conserved among all the DP2 sequences of 12 species and between PolD and yeast DNA polymerase {epsilon} (24, 30) (Figs. 1 and 2, and Supplementary Materials Fig. 2). The two invariant catalytic residues Asp1122 and Asp1124 of DP2Pho were found to be located in the most conserved region of DP2. Both DP1Pho and DP2Pho are acidic proteins with theoretical isoelectric points of 4.76 and 6.92, respectively. The NH2-terminal half of DP2Pho is acidic (the pI value of the peptide from 1 to 745 is 5.27), whereas the COOH-terminal half is basic (the pI value of the peptide from 784 to 1434 is 9.11).



View larger version (59K):
[in this window]
[in a new window]
 
FIG. 3.
Expression and thermostability of the truncated PolD-Pho proteins assessed by SDS-PAGE and Western blotting analysis. The gels (10–15%) were stained with Coomassie Brilliant Blue R-250 after electrophoresis. Western blotting was performed with nickel-nitrilotriacetic acid alkaline phosphatase. The molecular mass standards are myosin (203 kDa), {beta}-galactosidase (118 kDa), bovine serum albumin (82 kDa), ovalbumin (50 kDa), carbonic anhydrase (33 kDa), soybean trypsin inhibitor (27 kDa), lysozyme (20 kDa), and aprotinin (7 kDa). M, the molecular mass standards. S indicates the bands of DP1Pho. Specific bands are indicated with arrows. A, SDS-PAGE of total proteins of SL(1–300) (lanes 1 and 2), SL(1–481) (lane 3), SL(1–1189) (lane 4), and SL(1–1384) (lane 5). SDS-PAGE of heat-treated supernatant of SL(1–300) (lane 6), SL(1–481) (lane 7), SL(1–1189) (lane 8), and SL(1–1384) (lane 9). Cells were not induced in lane 1, and induced with isopropyl-1-thio-{beta}-D-galactopyranoside in lanes 2–5. B, SDS-PAGE of the total proteins of S(261–622)L, S(301–622)L, S(1–569)L, and S(1–598)L (lanes 1–4). C, Western blotting of the gel in B.

 

Construction of Expression Vectors, Expression, Purification, and Characterization of the Mutants—Twenty-five terminal truncation vectors were made for the analysis of terminal domains of both DP1Pho and DP2Pho using the co-expression vector (17). The truncation sites were chosen mainly based upon the sequence alignment, the sites at relatively less conserved regions were selected as start or end residues for NH2-terminal or COOH-terminal truncated mutants (Table I and Fig. 1). PCR was used to generate various mutants (Table I). Two site-directed mutants, SL(C1289A/C1292A) and SL(1305A/C1309A), and three internal deletion mutants SL(DEL 1289–1298), SL(DEL 1299–1308), and SL(DEL 1289–1308), were also made to investigate the function of the putative zinc finger motif (Table I, Fig. 1).

All of the proteins were well expressed using the E. coli expression system as judged by the presence of specific bands with anticipated molecular sizes, when the total protein was subjected to SDS-PAGE analysis and Western blotting. The thermostability of the truncated proteins was tested by heat treatment at 85 °C for 30 min of the cell extracts, and subsequent SDS-PAGE analysis and Western blotting analysis of the supernatant. For instance, the expression level and thermostability of four DP2Pho truncation constructs are shown in Fig. 3A. All of the proteins were well expressed. However, SL(1– 481) was not thermostable, because no band was obtained from the supernatant (Fig. 3A, lane 7), whereas the others were resistant to the heat treatment (Fig. 3A, lanes 6, 8, and 9). To check the ability to form a complex, subsequent purification steps using a nickel column, anion exchange column, and gel filtration were performed. When complexes were formed, both DP1 and DP2 bands were present in SDS-PAGE profiles after the purification (Fig. 4, C, lanes 3 and 4, and D, lane 1). For DP2 truncation, a complex was able to form in SL(1–1332) and SL(1–1384) (Fig. 4C, lanes 3 and 4). For DP1 truncation, the complex formation was confirmed with the purified S(201–622)L as shown in Fig. 4D, lane 1. The highly stable protein fragments, L(1–300), L(1–745), and S(1–200) were overexpressed with vectors, pET15b/SL(1–300), pET15b/S(L1–745), and pET15b/S(1–200)L, respectively. The polymerization and exonuclease activities were checked using purified truncation complexes. The characterization of the representative truncated proteins is summarized in Fig. 1.



View larger version (66K):
[in this window]
[in a new window]
 
FIG. 4.
SDS-PAGE of the purified truncated PolDPho proteins. The gels (10–15%) were stained with Coomassie Brilliant Blue R-250 after electrophoresis. The molecular mass standards are myosin (203 kDa), {beta}-galactosidase (118 kDa), phosphorylase b (100 kDa), bovine serum albumin (82 kDa), ovalbumin (50 kDa), carbonic anhydrase (33 kDa), soybean trypsin inhibitor (27 kDa), lysozyme (20 kDa), and aprotinin (7 kDa). A, lanes 1 and 2, L(1–300) and L(1–745). B, lanes 1 and 2, L(1–853) and L(1–1189). C, lanes 1–3, SL(1–1231), SL(1–1254), and SL(1–1332); lanes 4 and 5, SL(1–1384) and the wild type. Only DP1 bands were able to be seen in lanes 1 and 2. D, lanes 1 and 2, S(201–622)L and S(1–200). The proteins were purified using Hitrap Q and Superdex 200 columns in A and B, Hitrap Q and the nickel columns in C, and nickel column only in D.

 

Identification of Putative Regions Involved in the Interaction between DP1Pho and DP2Pho—Nine COOH-terminal truncated mutants of DP2Pho were analyzed (Figs. 1, 3A, and 4, AC). As shown in Fig. 4C, only mutants SL(1–1332) and SL(1–1384) were able to form PolDPho complexes. Mutant SL(1–1254) and all truncated forms lacking 1255–1332 of DP2Pho were incapable of complex formation, although most of the truncated DP2Pho proteins were highly thermostable (Fig. 4, AC). Similarly, five NH2-terminal and five COOH-terminal truncated mutants of DP1Pho were analyzed (Table I, Figs. 1, 3, B and C, and 4D). As shown in Fig. 4D, mutant S(201–622)L retained the ability to interact and formed a stable complex, whereas mutant S(261–622)L and all other DP1 NH2-terminal mutants lacking the region from 201 to 260 showed no interaction (Fig. 1, details not shown). Mutant S(1–598)L and all other COOH-terminal mutants of DP1Pho lacking the region from 599 to 622 were unable to form a protein complex either (Fig. 1, details not shown). These findings indicate that the 78-amino acid region from residue 1255 to 1332 in DP2Pho, the 60-amino acid region from residue 201 to 260 in DP1Pho, and the 24-amino acid region from 599 to 622 in DP1Pho, are essential amino sequences for the formation of stable complex of PolDPho. One possibility is that they may directly involve in subunit interaction (see "Discussion").

The N-terminal of DP2Pho(1–300) Is Likely the Oligomerization Domain and May Play a Structural Role in Forming PolD-Pho Complex—As shown in Fig. 4A, the NH2-terminal 1–300 fragment (lane 1) and 1–745 fragment (lane 2) of DP2Pho were highly stable and could be purified in high purity and quantity. Two longer NH2-terminal fragments of DP2Pho, L(1–853), and L(1–1189), were not so stable and produced nicked molecules (Fig. 4B, lanes 1 and 2). Considering that no DP2Pho fragments lacking the NH2-terminal 1–300 region are thermostable (Fig. 1, details not shown), we suppose that the NH2-terminal 1–300 plays an important role in the folding of DP2Pho and in the maintaining of the thermostability of PolDPho.

The molecular mass of the NH2-terminal 1–300 of DP2Pho was measured using gel filtration. The expected value of the NH2-terminal 1–300 of DP2Pho is 33.5 kDa. As shown in Fig. 5A, the profile of the 1–300 fragment showed two major peaks (arrows) with molecular mass of 110 and 62 kDa, respectively, corresponding to the trimer and dimer molecules. A small peak eluted at 8.1 ml, close to the bed volume (7.8 ml) of the column. This indicates that only a small amount of DP2Pho(1–300) protein formed aggregates and the NH2-terminal 1–300 of DP2Pho protein was stable. By SDS-PAGE analysis, the majority of the protein migrated at the position of around 33 kDa (Fig. 5B), but a faint band appeared at the position of about 70 kDa. We presume that this slower band is the incompletely denatured dimeric molecule.



View larger version (29K):
[in this window]
[in a new window]
 
FIG. 5.
Gel filtration analysis of the amino-terminal fragment DP2Pho(1–300). About 5 mg of the DP2Pho(1–300) protein was injected onto a Hiload Superdex-200 (10/16) column (Amersham Biosciences) equilibrated with 50 mM Tris-HCl buffer (pH 8.0) and 200 mM NaCl. The elution speed was 0.5 ml/min and fraction size was 0.5 ml. A, the UV absorbance profile. Three peaks are indicated with arrows and their elution volumes are also labeled. B, SDS-PAGE analysis of the major peak fractions. The monomer and putative dimer bands are indicated with arrows.

 

We have obtained crystals of both native and selenomethionine-substituted DP2Pho(1–300), which are applicable in x-ray structure analysis. This indicates that the multimerization of DP2Pho(1–300) seems unlikely to be caused by nonspecific aggregation. In the cell unit of the crystals, there are eight DP2Pho(1–300) molecules arranged orderly (details not shown). Careful analysis of the interfaces between the molecules in the cell unit may provide information about how the oligomerization of DP2Pho(1–300) is achieved.

The Dispensability of the NH2-terminal 1–200 of DP1Pho and COOH-terminal 1385–1434 of DP2Pho for the Polymerization and 3'-5' Exonuclease Activities and the Elevation of Exonuclease Activity of PolDPho because of Truncation of the NH2-terminal 1–200 Residues—As shown in Fig. 4, C, lane 4 and D, lane 1, two mutants, S(201–622)L and SL(1–1384), could be purified as the wild type PolD. These two mutants had polymerization (not shown) and 3'-5' exonuclease activities (Fig. 7A). To identify the catalytic core of PolDPho, a mutant, S(201–622)L(1–1384) was also made. The activities were compared with the wild type PolDPho. As shown in Fig. 6, the polymerization of S(201–622)L(1–1384) remained the same as the wild type when measured using the acid precipitation method and primer extension assay (Fig. 6, A and B). To our surprise, the exonuclease activity of S(210–622)L(1–1384) and S(201–622)L was remarkably elevated compared with that of the wild type PolDPho (Figs. 6B, and 7, A and B). The substrate remaining of the two DP1Pho(1–200) truncated mutants, S(210–622)L(1–1384) and S(201–622)L, after 1 or 5 min incubation, was only about one-seventh of that of the proteins with full-length of DP1Pho, the wild type, and mutant S(1–622)L(1–1384) (Fig. 7B). These results indicate that the NH2-terminal 200 amino acids of DP1Pho and the COOH-terminal 50 amino acids of DP2Pho are not absolutely required for either complex formation or catalysis. The 1–200 fragment of DP1Pho is related to the exonuclease activity of PolD, truncation of it enhances the 3'-5' exonuclease activity, whereas the COOH-terminal 50 amino acids of PD2Pho are not directly related to the catalysis, but may be involved in protein-protein interaction.



View larger version (36K):
[in this window]
[in a new window]
 
FIG. 7.
Elevation of the 3'-5' activity by the truncation of the NH2-terminal 1–200 region of DP1Pho. A, comparison of the 3'-5' exonuclease activity of the wild type PolDPho and truncated mutants S(201–622)L(1–1384), S(201–622)L, and SL(1–1384) The 100-mer/32P-labeled 34-mer (0.5 pmol) was used as the substrate. The reaction was performed at 65 °C and the amount of enzyme used in each reaction was 200 ng. The reaction was performed for 1 and 5 min. Lane 1, no enzyme; lanes 2–5, wild type, S(201–622)L(1–1384), S(201–622)L, and S(1–622)L(1–1384), 1 min; lanes 6–9, as lanes 2–5, 5 min. B, graphic representation of the results shown in A. The spot of the control (without enzyme) was used as the position of unhydrolyzed substrate for calculation.

 


View larger version (36K):
[in this window]
[in a new window]
 
FIG. 6.
Dispensability of the NH2-terminal 1–200 fragment of DP1Pho and COOH-terminal 1384–1434 fragment of DP2Pho for the enzymatic activities. A, time courses of the polymerization activity of the wild type PolDPho (square) and mutant S(201–622)L(1–1384) (filled circle) using the acid precipitate method. The activity was the average of two measurements for each protein and time. Fivehundred nanograms of enzyme was used in each measurement, and the reaction was performed at 70 °C for 30 min. B, primer extension of the wild type PolDPho and mutant S(201–622)L(1–1384). The reaction was performed at 65 °C and the amount of enzyme used in each reaction was 200 ng. The 100-mer/32P labeled 34-mer (0.5 pmol) was used as the substrate. Lane 1, no enzyme; lanes 2–4, wild type 0.5, 1, and 2 min; lanes 5–7, S(201–622)L(1–1384), 0.5, 1, and 2 min.

 

The N-terminal 1–200 Domain of DP1Pho Forms a Highly Stable Protein and Negatively Regulates the Exonuclease of PolDPho—The fragment of S(1–200) was found to form a thermostable protein, and could be purified in high purity (Fig. 4D, lane 2). The 1–200 fragment migrated to a position of ~39 kDa in SDS-PAGE analysis, much higher than its expected size (22.5 kDa) (Fig. 4D, lane 2). Two other COOH-terminal mutants of DP1Pho, S(1–569)L and S (1–598) (Fig. 3, B and C, lanes 3 and 4), also migrated much more slowly than expected. In contrast, three NH2-terminal truncated mutants of DP1Pho, S(201–622)L (Fig. 4D, lane 1), S(261–622)L, and S(301–622)L (Fig. 3, B and C, lanes 1 and 2), migrated as expected. It was noted that the full-length DP1Pho migrated as a 90-kDa protein, significantly higher than its expected size of 70 kDa (17). The reason for this retardation is not know. It seems that it was the NH2-terminal 1–200 that leads to the slower migration of DP1Pho. Gel filtration analysis showed that the 1–200 fragment formed a monomer rather than dimer (data not shown), suggesting that the NH2-terminal 1–200 fragment of DP1PHo is not likely involved in the dimerization of PolDPho (17).

To elucidate the mechanism behind the elevation in the 3'-5' exonuclease activity of mutant S(201–622)L, we examined the effect of DP1Pho(1–200) on the exonuclease activity of mutant S(201–622)L(1–1384) protein. As shown in Fig. 8, the activity of mutant S(201–622)L(1–1384) protein was reduced when DP1Pho(1–200) was added. The more DP1(1–200) was added the weaker the exonuclease activity became (Fig. 8, lanes 4–8). As a control, BSA at the same ratios was added to the reaction tubes and no change in activity was observed (Fig. 8, lanes 9–13).



View larger version (91K):
[in this window]
[in a new window]
 
FIG. 8.
The NH2-terminal 1–200 fragment of DP1Pho inhibits the exonuclease activity of S(201–622)L(1–1384). The reaction was performed at 70 °C for 2 min. The 100-mer/32P-labeled 34-mer was used as the substrate. Two-hundred nanograms of truncated mutant S(201–622)L(1–1384) was mixed with various amounts of DP1(1–200) or BSA, and added to the tubes. The molar ratios of DP1(1–200) (lanes 4–8) or BSA (lanes 9–13) and S(201–622)L(1–1384) were 0.5:1, 1:1, 2:1, 5:1, and 10:1, respectively. Lane 1, no enzyme; lane 2, wild type PolDPho; lane 3, S(201–622)L(1–1384) only.

 

We compared the DNA binding abilities of the wild type and mutant S(201–622)L(1–1384) using a band shift assay. As shown in Fig. 9, AC (lanes 1 and 2) and D, the ability of the mutant S(201–622)L(1–1384) to bind single stranded DNA is remarkably higher than that of the wild type. A similar difference was also observed using blunt end and recessive end dsDNA (Fig. 9, C and D), although with less magnitude. It is proposed that DP1(1–200) and DNA compete for the same site on PolDPho. Consistent with this assumption, the NH2-terminal 1–200 of DP1Pho is very acid with a calculated pI of 3.91. In the wild type PolDPho, the DP1Pho(1–200) region may interact with the DNA binding site and regulate the exonuclease activity of PolDPho.



View larger version (39K):
[in this window]
[in a new window]
 
FIG. 9.
Enhanced DNA binding ability of mutant S(201–622)L(1–1384). A, comparison of ssDNA binding ability between wild type PolD and mutant S(201–622)L(1–1384). A 25-mer oligonucleotide labeled at the 5' end by FAM (0.2 pmol/µl) was used and the protein amount was 40 (lanes 1 and 5), 200 (lanes 2 and 6), 400 (lanes 3 and 7), and 2000 ng (lanes 4 and 8), respectively. The reaction was carried out at room temperature for 30 min before loading on a 0.7% agarose gel and electrophoresis in 1x TBE buffer. B, graphical representation of the result as shown in A. Each value was from at least three independent reactions. C, comparison of DNA binding ability between the wild type PolDPho and mutant S(201–622)L(1–1384) using ssDNA, blunt end dsDNA, and recessive end dsDNA. The substrate concentration used was 0.2 pmol/µl, and the amount of the enzyme in each tube was 500 ng. The reaction was carried out at room temperature for 20 min before loading on a 0.7% agarose gel. Lanes 3 and 6, no enzyme; lanes 1, 4, and 7, the wild type enzyme; lanes 2, 5, and 8, mutant S(201–622)L(1–1384). D, graphical representation of the result as shown in C. Each value was from at least three reactions. Some of the error bars are not visible because of low values.

 

Deletion Mutants in the Region of the COOH-terminal Putative Zinc Finger Motif (Cysteine Cluster II) of DP2Pho Were Able to Form Complex and Had Polymerization Ability but Lost the Exonuclease Activity—The COOH-terminal of DP2 contains a conserved putative zinc finger motif (Cys1289-Cys1308 of DP2Pho). It is within a homologuos region between PolDPho-(1264–1335) and yeast DNA polymerase {epsilon} (Fig. 2). This region was found to be essential for DNA replication and for an intact S/M cell cycle checkpoint in yeast (30). The subunit interaction region identified in DP2Pho(1255–1332) as shown above encompasses the putative zinc finger motif. To investigate the role of the putative zinc finger motif, deletion mutants SL(DEL 1289–1298), SL(DEL 1299–1308), and SL(DEL 1289–1308), and site-directed alanine mutants, SL(C1289/C1292) and SL(C1305/C1308) were made (Table I and Fig. 1). The proteins were purified and PolDPho complexes were formed for all the five mutants (Fig. 10D). The primer extension and 3'-5' exonuclease activities were measured (Fig. 10, A and B). It was found that the polymerization activity of SL(DEL 1289–1298), SL(DEL 1299–1308), and SL(DEL 1289–1308) remained, although it was reduced (Fig. 10A). However, the exonuclease activity was not detected (Fig. 10B), even if the reaction time was elongated from 5 (Fig. 10B) to 30 min (Fig. 10C). Meanwhile, for the site-directed mutants SL(C1289/C1292) and SL(C1305/C1308), both polymerization and exonuclease activities were unaffected compared with the wild type PolDPho (Fig. 10, AC). These results suggested that the region between the two pairs of cysteine residues, not the cysteine residues themselves, is directly involved in the exonuclease activity, because an alanine mutation of either cysteine pair did not have any effect on the catalytic activities.



View larger version (50K):
[in this window]
[in a new window]
 
FIG. 10.
Polymerization and 3'-5' exonuclease activities of deletion mutants and site-directed alanine mutants in the region of the COOH-terminal putative zinc finger motif of DP2Pho. A 84-mer/FAM 5' 25-mer substrate (0.2 pmol/µl) was used for the analysis. Two-hundred nanograms of enzyme was added in the reaction tube, and the reaction was performed for 2 min for the polymerization assay (A), and 5 (B) or 30 min (C) for the exonuclease assay. The reaction temperature was 60 °C. Lanes 1, no enzyme; lane 2, the wild type; lane 3, SL(DEL 1289–1298); lane 4, SL(DEL 1299–1308); lane 5, SL(DEL 1289–1308); lane 6, SL(C1289A/C1292A); and lane 7, SL(C1305A/C1308A). D, SDS-PAGE analysis to show the formation of the complexes of the deletion and site-directed mutants. The proteins were purified using nickel, Hitrap Q, and Superdex 200 gel filtration columns. Lane 1, the wild type; lane 2, SL(C1305A/C1308A); lane 3, SL(DEL 1289–1298); lane 4, SL(DEL 1299–1308); lane 5, SL(DEL 1289–1308); lane 6, SL(C1289A/C1292A).

 


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Family D DNA polymerase is an interesting macromolecule with a molecular mass of 420 kDa, but its structure remains unknown. While x-ray crystallography has been attempted and cryoelectron microscopy is being carried out to solve the whole structure, in this study a molecular approach was utilized to analyze the domain structure by making and examining 25 truncated proteins. Sequence information was used to decide if the truncation sites and the conserved regions were avoided. It was expected that the core structure could be identified and partial stable domains of PolDPho could be obtained, which might become materials for x-ray crystallography, through this approach. A model of the domain structure is depicted in Fig. 11 to summarize the knowledge of PolD gained so far, including results from this study.



View larger version (23K):
[in this window]
[in a new window]
 
FIG. 11.
A model of the domain structure of PolDPho. The intein of DP2Pho is not included. The numbers of the amino sequences are those including the intein.

 

One of the most interesting findings is that we identified three critical regions for the formation of the stable PolDPho complex. They might be the regions for the subunit interaction of PolDPho. The region in DP2Pho is a 78-amino acid sequence from residue 1255 to 1332. Two areas in DP1Pho are from 201 to 260 (60 amino acid) and from 599 to 622 (24 amino acid). The 78-amino acid region in DP2Pho was recently confirmed by yeast two-hybrid analysis assay.3 The two regions in DP1Pho have yet to be confirmed, however, a study in P. furiosus found that the two corresponding sites in DP1 of P. furiosus were critical for strong polymerization activity (25), which is consistent with our results.

It is not clear how they function in complex formation. They may be directly involved in subunit interaction. Alternatively, they may be involved in the folding of individual subunit, or local domains, so that they indirectly effect the complex formation. This may be particularly true for the DP1 region from 599 to 622, because DP1(1–598) and similar truncated DP1 mutants are not thermostable (Fig. 1). The third possibility may be that the folding and subunit interaction processes are inseparable. This might be reasonable, because neither DP1 nor DP2 was stable when expressed individually, and in the genome of Pyrococcus the genes are arranged in tandem in the same operon (17).

It is interesting that the identified region (1255–1332) of DP2Pho is within the homology region of DP2 with the catalytic subunit of yeast DNA polymerase {epsilon} (Fig. 2). In yeast, this area is very important for DNA replication and a checkpoint, its deletion resulting in sensitivity to methylmethane sulfonate (24, 30). This region functions in protein/protein interaction and protein/DNA interaction. It was found that yeast could survive with a deletion of the catalytic domain if the COOH-terminal region was present (31, 32), and it was suggested that another DNA polymerase could substitute for the catalysis of DNA replication through the recruitment of enzymes by the COOH-terminal region of DNA polymerase {epsilon}. Because in PolD the region was found to probably interact with DP1, which contains a putative domain homologous to the small subunits of eukaryote polymerase {alpha}, {delta}, and {epsilon}, and Mre11, it could be hypothesized that in yeast the COOH-terminal region of polymerase {epsilon} interacts with the small subunits of DNA polymerase {delta}, {alpha}, or Mre11 for DNA replication and DNA repair. Further characterization of PolD structurally and biochemically in Archaea may shed light on the mechanism by which polymerase {epsilon} associates with other DNA replication and repair proteins in eukaryotes.

A surprising observation is that deletion of the COOH-terminal zinc finger region (1289–1308) did not abolish the subunit interaction (Fig. 10D). Instead, while the polymerization of the deletion mutants remained (Fig. 10A), the 3'-5' exonuclease was completely inactivated (Fig. 10, B and C). Our explanation is that the putative zinc finger region is neither the single nor main region for the subunit interaction. Other parts or the whole domain in the COOH-terminal of DP2Pho may also be involved in the interaction. The internal region of the zinc finger motif may mainly interact with DP1Pho to form the catalytic center for the exonuclease activity. Further study of the interaction between the zinc finger motif and DP1 may reveal how the exonuclease catalysis works in PolDPho.

Another interesting observation is that the truncated mutant S(201–622)L had enhanced exonuclease activity and DNA binding ability, and that the NH2-terminal 1–200 fragment of DP1Pho, which is the least conserved among DP1 from 12 species, can form a highly stable protein and inhibits the exonuclease of S(201–622)L. It seems likely that DP1(1–200) regulates the exonuclease activity of PolD through binding to the DNA binding site. Because DP1(1–200) is very acidic, it might form a DNA analogue and compete with DNA for the binding site of PolD. This finding may also indicate that the small subunit is responsible for the exonuclease activity of PolD.

We found that the NH2-terminal 1–300 fragment of DP2Pho forms an extremely stable and oligomeric protein by gel filtration analysis. During purification of several other native NH2-terminal DP2Pho fragments, including DP2Pho(1–318), DP2Pho(1–705), DP2Pho(1–745), and selenomethionine-substituted DP2Pho(1–300), for crystallization analysis, we always found putative oligomeric molecules of them but not monomer molecules in the gel filtration step (data not shown). However, further biochemical analysis using techniques such as sedimentation velocity analysis and crystal x-ray or NMR structural analysis are needed to confirm the real state of DP2Pho(1–300) in both solution and static conditions.

The tendency of the NH2-terminal DP2Pho to form ordered oligomers might provide evidence that PolDPho forms a heterotetrameric structure (L2S2). Previously, it was suggested that wild type PolDPho formed a heterotetrameric structure (L2S2) containing two large and two small subunits in one molecule based on gel filtration analysis (17). It seems to be likely that the NH2-terminal 1–300 domain plays a fundamental role in the formation of the heterotetrameric structure (L2S2) of PolDPho. An asymmetric dimeric structure is believed reasonable for the coupling of both the leading and lagging strand DNA synthesis at the DNA replication fork. It is known that the replicative holoenzyme III of E. coli is such an asymmetric dimer containing two {alpha} subunits that are responsible for the synthesis of both DNA strands (33, 34). The T4 DNA polymerase was found to form a dimer in the presence of DNA (37). The DNA polymerase {epsilon} of budding yeast Saccharomyces cerevisiae was found to form a dimeric structure in vivo and the dimerization is essential for DNA replication (24). The nature of DNA polymerase {delta} seems to be controversial. It was reported that both recombinant and native DNA polymerase {delta} of Schizosaccharomyces pombe are composed of four subunits and form a dimeric structure (35). Recently, detailed biochemical analysis demonstrated a monomer structure for DNA polymerase (36). The settling of this issue may require elucidation of the structure of the DNA replicase. Because of the similarity between PolD and DNA polymerase {delta} and {epsilon}, the structure of thermostable PolD if solved will help us understand the structure of eukaryote DNA replicases and the DNA replication mechanism.


    FOOTNOTES
 
* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

The on-line version of this article (available at http://www.jbc.org) contains Figs. 1 and 2. Back

{ddagger} To whom correspondence should be addressed: Biological Information Research Center, National Institute of Advanced Science and Technology, Tsukuba, Ibaraki 305-8566, Japan. Tel.: 81-298-616142; Fax: 81-298-616151; E-mail: ik-matsui{at}aist.go.jp.

1 The abbreviations used are: PolD, family D DNA polymerase; DP1, small subunit of the family D DNA polymerase; DP2, large subunit of the family D DNA polymerase; PolDPho, family D DNA polymerase from P. horikoshii; DP1Pho, small subunit of the family D DNA polymerase from P. horikoshii; DP2Pho, large subunit of the family D DNA polymerase from P. horikoshii; FAM, fluorescein; BSA, bovine serum albumin; ssDNA, single stranded DNA; dsDNA, double stranded DNA. Back

2 Y. Shen, X-F. Tang, and I. Matsui, unpublished data. Back

3 X.-F. Tang, Y. Shen, and I. Matsui, manuscript in preparation. Back


    ACKNOWLEDGMENTS
 
We thank Emiko Yamamoto for technical help during this study, as well as Eriko Matsui, Hiroki Higashibata, Hideshi Yokoyama, and Yuji Urushibata for helpful discussions.



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Cann, I. K., and Ishino, Y. (1999) Genetics 152, 1249-1267[Abstract/Free Full Text]
  2. Burgers, P. M. J., Koonin, E. V., Bruford, E., Blanco, L., Burtis, K. C., Christman, M. F., Copeland, W. C., Friedberg, E. C., Hanaoka, F., Hinkle, D. C., Lawrence, C. W., Nakanishi, M., Ohmori, H., Prakash, L., Prakash, S., Reynaud, C., Sugino, A., Todo, T., Wang, Z., Weill, J., and Woodgate, R. (2001) J. Biol. Chem. 276, 43487-43490[Free Full Text]
  3. Kaneko, T., Tanaka, A., Sato, S., Kotani, H., Sazuka, T., Miyajma, N., Sugiura, M., and Tabata, S. (1995) DNA Res. 2, 153-166[Abstract]
  4. Gaspin, C., Cavaille, J., and Erauso, G. (2000) J. Mol. Biol. 297, 895-906[CrossRef][Medline] [Order article via Infotrieve]
  5. Robb, F. T., Maeder, D. L., Brown, J. R., DiRuggiero, J., Stump, M. D., Yeh, R. K., Weiss, R. B., and Dunn, D. M. (2001) Methods Enzymol. 330, 134-157[Medline] [Order article via Infotrieve]
  6. Bult, C. J., White, O., Olsen, G. J., Zhou, L., Fleischmann, R. D., Sutton, G. G., Blake, J. A., FitzGerald, L. M., Clayton, R. A., Gocayne, J. D., Kerlavage, A. R., Dougherty, B. A., Tomb, J., Adams, M. D., Reich, C. I., Overbeek, R., Kirkness, E. F., Weinstock, K. G., Merrick, J. M., Glodek, A., Scott, J. D., Geoghagen, N. S., Weidman, J. F., Fuhrmann, J. L., Nguyen, D. T., Utterback, T., Kelley, J. M., Peterson, J. D., Sadow, P. W., Hanna, M. C., Cotton, M. D., Hurst, M. A., Roberts, K. M., Kaine, B. B., Borodovsky, M., Klenk, H. P., Fraser, C. M., Smith, H. O., Woese, C. R., and Venter, J. C. (1996) Science 273, 1058-1073[Abstract]
  7. Deppenmeier, U., Johann, A., Hartsch, T., Merkl, R. Schmitz, R. A., Martinez-Arias, R., Henne, A., Wiezer, A., Baeumer, S., Jacobi, C., Brueggemann, H., Lienard, T., Christmann, A., Boemecke, M., Steckel, S., Bhattacharyya, A., Lykidis, A., Overbeek, R., Klenk, H.-P., Gunsalus, R. P., Fritz, H.-J., and Gottschalk, G. (2002) J. Mol. Microbiol. Biotechnol. 4, 453-461[Medline] [Order article via Infotrieve]
  8. Galagan, J. E., Nusbaum, C., Roy, A., Endrizzi, M. G., Macdonald, P., FitzHugh, W., Calvo, S., Engels, R., Smirnov, S., Atnoor, D., Brown, A., Allen, N., Naylor, J., Stange-Thomann, N., DeArellano, K., Johnson, R., Linton, L., McEwan, P., McKernan, K., Talamas, J., Tirrell, A., Ye, W., Zimmer, A., Barber, R. D., Cann, I., Graham, D. E., Grahame, D. A., Guss, A., Hedderich, R., Ingram-Smith, C., Kuettner, C. H., Krzycki, J. A., Leigh, J. A., Li, W., Liu, J., Mukhopadhyay, B., Reeve, J. N., Smith, K., Springer, T. A., Umayam, L. A., White, O., White, R. H., de Macario, E. C., Ferry, J. G., Jarrell, K. F., Jing, H., Macario, A. J. L., Paulsen, I., Pritchett, M., Sowers, K. R., Swanson, R. V., Zinder, S. H., Lander, E., Metcalf, W. W., and Birren, B. (2002) Genome Res. 12, 532-542[Abstract/Free Full Text]
  9. Smith, D. R., Doucette-Stamm, L. A., Deloughery, C., Lee, H., Dubois, J., Aldredge, T., Bashirzadeh, R., Blakely, D., Cook, R., Gilbert, K., Harrison, D., Hoang, L., Keagle, P., Lumm, W., Pothier, B., Qiu, D., Spadafora, R., Vicaire, R., Wang, Y., Wierzbowski, J., Gibson, R., Jiwani, N., Caruso, A., Bush, D., and Reeve, J. N. (1997) J. Bacteriol. 179, 7135-7155[Abstract/Free Full Text]
  10. Klenk, H. P., Clayton, R. A., Tomb, J., White, O., Nelson, K. E., Ketchum, K. A., Dodson, R. J., Gwinn, M., Hickey, E. K., Peterson, J. D., Richardson, D. L., Kerlavage, A. R., Graham, D. E., Kyrpides, N. C., Fleischmann, R. D., Quackenbush, J., Lee, N. H., Sutton, G. G., Gill, S., Kirkness, E. F., Dougherty, B. A., McKenney, K., Adams, M. D., Loftus, B., Peterson, S., Reich, C. I., McNeil, L. K., Badger, J. H., Glodek, A., Zhou, L., Overbeek, R., Gocayne, J. D., Weidman, J. F., McDonald, L., Utterback, T., Cotton, M. D., Spriggs, T., Artiach, P., Kaine, B. P., Sykes, S. M., Sadow, P. W., D'Andrea, K. P., Bowman, C., Fujii, C., Garland, S. A., Mason, T. M., Olsen, G. J., Fraser, C. M., Smith, H. O., Woese, C. R., and Venter, J. C. (1997) Nature 390, 364-370[CrossRef][Medline] [Order article via Infotrieve]
  11. Kawashima, T., Yamamoto, Y., Aramaki, H., Nunoshiba, T., Kawamoto, T., Watanabe, K., Yamazaki, M., Kanehori, K., Amano, N., Ohya, Y., Makino, K., and Suzuki, M. (1999) Proc. Jpn. Acad. 75, 213-218
  12. Ruepp, A., Graml, W., Santos-Martinez, M. L., Koretke, K. K., Volker, C., Mewes, H. W., Frishman, D., Stocker, S., Lupas, A. N., and Baumeister, W. (2000) Nature 407, 508-513[CrossRef][Medline] [Order article via Infotrieve]
  13. Slesarev, A. I., Mezhevaya, K. V., Makarova, K. S., Polushin, N. N., Shcherbinina, O. V., Shakhova, V. V., Belova, G. I., Aravind, L., Natale, D. A., Rogozin, I. B., Tatusov, R. L., Wolf, Y. I., Stetter, K. O., Malykh, A. G., Koonin, E. V., and Kozyavkin, S. A. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 4644-4649[Abstract/Free Full Text]
  14. Ng, W. V., Kennedy, S. P., Mahairas, G. G., Berquist, B., Pan, M., Shukla, H. D., Lasky, S. R., Baliga, N., Thorsson, V., Sbrogna, J., Swartzell, S., Weir, D., Hall, J., Dahl, T. A., Welti, R., Goo, Y. A., Leithauser, B., Keller, K. R., Cruz, M., Danson, D., Hough, D., Maddocks, P., Jablonski, M., Krebs, C., Angevine, H., Dale, Isenbarger, T. A., Peck, R. F., Pohlschrod, M., Spudich, J. L., Jung, K.-H., Alam, M., Freitas, T., Hou, S., Daniels, C. J., Dennis, P., Omer, A. D., Ebhardt, H., Lowe, T. M., Liang, P., Riley, M., Hood, L., and DasSarma, S. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 12176-12181[Abstract/Free Full Text]
  15. Uemori, T., Sato, Y., Kato, I., Doi, H., and Ishino, Y. (1997) Genes Cells 2, 499-512[Abstract]
  16. Ishino, Y., Komori, K., Cann, I. K., and Koga, Y. (1998) J. Bacteriol. 180, 2232-2236[Abstract/Free Full Text]
  17. Shen, Y., Musti, K., Hiramoto, M., Kikuchi, H., Kawabayashi, Y., and Matsui, I. (2001) J. Biol. Chem. 276, 27376-28383[Abstract/Free Full Text]
  18. Gueguen, Y., Rolland, J., Lecompte, O., Azam, P., Romancer, G. L., Flament, D., Raffin, J., and Dietrich, J. (2001) Eur. J. Biochem. 268, 5961-5969[Medline] [Order article via Infotrieve]
  19. Cann, I. K., Komori, K., Toh, H., Kanai, S., and Ishino, Y. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 14250-14255[Abstract/Free Full Text]
  20. Myllykallio, H., Lopez, P., Lopez-Garcia, P., Heilig, R., Saurin, W., Zivanovic, Y., Philippe, H., and Forterre, P. (2000) Science 288, 2212-2215[Abstract/Free Full Text]
  21. Aravind, L., and Koonin, E. V. (1998) Nucleic Acids Res. 26, 3746-3752[Abstract/Free Full Text]
  22. Hopfner, K., Karcher, A., Craig, L., Woo, T. T., Carney, J. P., and Tainer, J. A. (2001) Cell 105, 473-485[CrossRef][Medline] [Order article via Infotrieve]
  23. Dua, R., Levy, D., and Campbell, J. L. (1999) J. Biol. Chem. 274, 22283-22288[Abstract/Free Full Text]
  24. Dua, R., Edwards, S., Levy, D. L., and Campbell, J. L. (2000) J. Biol. Chem. 275, 28816-28825[Abstract/Free Full Text]
  25. Hayashi, I., Morikawa, K., and Ishino, Y. (1999) Nucleic Acids Res. 27, 4695-4702[Abstract/Free Full Text]
  26. Cann, I. K., Ishino, S., Hayashi, I., Komori, K., Toh, H., Morikawa, K., and Ishino, Y. (1999) J. Bacteriol. 181, 6591-6599[Abstract/Free Full Text]
  27. Motz, M., Kober, I., Girardot, C., Loeser, E., Bauer, U., Albers, M., Moeckel, G., Minch, E., Voss, H., Kilger, C., and Koegl, M. (2002) J. Biol. Chem. 277, 16179-16188[Abstract/Free Full Text]
  28. Tye, B. K. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 2399-2401[Free Full Text]
  29. Kadowaki, H., Kadowaki, T., Wondisford, F. E., and Taylor, S. I. (1989) Gene (Amst.) 76, 161-166[CrossRef][Medline] [Order article via Infotrieve]
  30. Dua, R., Levy, D. L., and Campbell, J. L. (1998) J. Biol. Chem. 273, 30046-30055[Abstract/Free Full Text]
  31. Kesti, T., Flick, K., Keranen, S., Syvaoja, J. E., and Wittenburg, C. (1999) Mol. Cell 3, 279-285
  32. Connelly, J. C., and Leach, D. R. F. (2002) Trends Biochem. Sci. 27, 410-419[CrossRef][Medline] [Order article via Infotrieve]
  33. McHenry, C. S. (1991) J. Biol. Chem. 266, 19127-19130[Free Full Text]
  34. Glove, B. P., and McHenry, C. S. (2001) Cell 105, 925-934[CrossRef][Medline] [Order article via Infotrieve]
  35. Zuo, S., Bermudez, V., Zhang, G., Kelman, Z., and Hurwitz, J. (2000) J. Biol. Chem. 275, 5153-5162[Abstract/Free Full Text]
  36. Johansson, E., Majka, J., and Burgers, P. M. (2001) J. Biol. Chem. 276, 43824-43828[Abstract/Free Full Text]
  37. Faoud, T. I., Trakselis, M. A., and Benkovic, S. J. (2003) J. Biol. Chem. 278, 3145-3152[Abstract/Free Full Text]
  38. Thompson, J. D., Higgins, D. G., and Gibson, T. J. (1994) Nucleic Acids Res. 22, 4673-4680[Abstract/Free Full Text]



This article has been cited by