Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M300931200 on April 7, 2003

J. Biol. Chem., Vol. 278, Issue 24, 21592-21600, June 13, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/24/21592    most recent
M300931200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by McMahon, M.
Right arrow Articles by Hayes, J. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by McMahon, M.
Right arrow Articles by Hayes, J. D.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Keap1-dependent Proteasomal Degradation of Transcription Factor Nrf2 Contributes to the Negative Regulation of Antioxidant Response Element-driven Gene Expression*

Michael McMahon {ddagger}, Ken Itoh §, Masayuki Yamamoto § and John D. Hayes

From the Biomedical Research Centre, Ninewells Hospital and Medical School, University of Dundee, Dundee DD1 9SY, Scotland, United Kingdom, § Centre for Tsukuba Advanced Research Alliance and Institute of Basic Medical Sciences, University of Tsukuba, Tsukuba 305-8577, Japan

Received for publication, January 28, 2003 , and in revised form, March 29, 2003.
    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Keap1 is a negative regulator of Nrf2, a bZIP transcription factor that mediates adaptation to oxidative stress. Previous studies suggested this negative regulation is a consequence of Keap1 controlling the subcellular distribution of Nrf2. We now report that Keap1 also controls the total cellular level of Nrf2 protein. In the RL34 non-transformed rat liver cell line, Nrf2 was found to accumulate rapidly in response to oxidative stress caused by treatment with sulforaphane, and the accumulation resulted from inhibition of proteasomal-mediated degradation of the bZIP protein. By heterologously expressing in COS1 cells epitope-tagged Nrf2 and an Nrf2{Delta}ETGE mutant lacking the Keap1-binding site, in both the presence and absence of Keap1 we demonstrate that Nrf2 is subject to ubiquitination and proteasomal degradation independently of both Keap1 and the redox environment of the cell. In oxidatively stressed cells, this is the sole mechanism responsible for Nrf2 degradation. However, under homeostatic conditions Nrf2 is subject to a substantially more rapid mode of proteasomal degradation than it is in oxidatively stressed cells, and this rapid turnover of Nrf2 requires it to interact with Keap1. Within Nrf2, the N-terminal Neh2 domain is identified as the redox-sensitive degron. These data suggest that Keap1 negatively regulates Nrf2 by both enhancing its rate of proteasomal degradation and altering its subcellular distribution.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Under homeostatic conditions, cells maintain their redox environment at a higher reducing potential than their surroundings (1). This is essential for correct biological function, and changes in the redox environment of the cell toward a more oxidized potential is referred to as oxidative stress. This can arise from exposure to pro-oxidant phytochemicals such as isothiocyanates, which react with GSH, and quinones, which can decouple mitochondrial electron transfer reactions, generating the superoxide anion (2, 3). Regardless of the source, oxidative stress, if prolonged, results in perturbation of cellular biochemistry and aberrant covalent modification of macromolecules, leading to tissue damage and DNA mutations.

Being disteleological, cells sense oxidative stress and respond by transcriptionally up-regulating numerous cytoprotective genes. These encode proteins with a variety of functions. For example, glutamate cysteine ligase catalytic and modifier subunits, glutathione reductase, malic enzyme 1, glucose-6-phosphate dehydrogenase, thioredoxin reductase, thioredoxin, peroxiredoxin MSP23, heme oxygenase 1, and the cystine/glutamate exchange transport system (49) act directly to replenish the cells major reductants. In addition, detoxication enzymes such as glutathione S-transferases, UDP-glucuronosyltransferases, aldo-keto reductases, and NAD(P)H:quinone oxidoreductase 1 (NQO1)1 act indirectly by metabolizing and excreting the causative agents and byproducts of oxidative stress (1012). Ferritin L chain (12) is induced and inhibits the ability of iron to catalyze the formation of reactive oxygen species. Genes encoding DNA damage repair enzymes might also be induced (8). Thus, in response to oxidants, the cell alters its biochemistry in many ways to reduce the potential for further oxidative stress, restore its redox balance, and repair damage accumulated during the stress. The antioxidant response element (ARE), a cis-acting element present in the promoters of many of the genes encoding the proteins listed above, provides a mechanism to explain their coordinated transcriptional regulation (for review, see Ref. 13).

Nrf2, a member of the "cnc" subfamily of bZIP transcription factors (for review, see Ref. 14), is an essential transactivator of genes containing an ARE, as evidenced by the marked impairment in the expression of genes encoding a number of detoxication enzymes and GSH biosynthetic enzymes in the liver and gastrointestinal tract of nrf2/ mice (11, 15, 16). Nrf2 is highly conserved from mammalian species to chicken and Zebra fish, particularly within six regions designated the Neh1–6 (Nrf2-ECH homology) domains (17). The Neh1 domain contains the cnc-bZIP region, which dictates dimerization partners and confers DNA binding specificity. The Neh4 and Neh5 domains act cooperatively to bind the coactivator CREB-binding protein, thereby activating transcription (18). Of particular interest is the N-terminal region of ~100 amino acids, called the Neh2 domain, which negatively regulates Nrf2 function under homeostatic conditions (19) by mechanisms that are not fully understood.

The negative regulation of Nrf2 requires the interaction of the Neh2 domain with an actin-bound cytosolic protein, Keap1 (Kelch-like ECH-associated protein 1) (19). This appears to be a direct interaction as bacterially expressed and purified mKeap1 interacts in vitro with the Neh2 domain of mNrf2 (20). A tetrapeptide motif, ETGE, that resides close to the C-terminal boundary of Neh2 is critical for this phylogenetically conserved interaction (17). Itoh et al. (19) proposed that Keap1 negatively regulates Nrf2 function by controlling its subcellular localization. According to this model, Keap1 sequesters the bZIP protein in the cytoplasm under homeostatic conditions, leading to low expression of ARE-driven genes. During oxidative stress, a signal that involves phosphorylation and/or redox modification is transduced to the Keap1·Nrf2 complex (1921), leading to its disruption and nuclear translocation of Nrf2. The increased level of nuclear Nrf2 results in enhanced occupancy of ARE enhancers by Nrf2/small Maf heterodimers, recruitment of CREB-binding protein, and transactivation of cytoprotective genes (18).

A drawback of this model is that it does not account for the apparent accumulation of total cellular Nrf2 in response to oxidative stress (2225). Two research groups demonstrated that the accumulation of Nrf2 results from inhibition of its degradation by the 26 S proteasome (24, 25), a feature common to many transcription factors including p53, c-Myc, c-Jun, and {beta}-catenin (26). In this study, we confirm that endogenous Nrf2 is subject to 26 S proteasome-dependent degradation and that its rate of degradation depends upon the redox environment of the cell. Importantly, we demonstrate that although Nrf2 is constitutively ubiquitinated and degraded by the proteasome, a direct interaction between the transcription factor and Keap1 confers redox sensitivity upon its half-life. Thus, under homeostatic conditions, Keap1 interacts with Nrf2 and increases its rate of proteasome-mediated degradation, leading to a reduction in the cellular levels of the bZIP protein. Oxidative stress, by antagonizing this interaction, stabilizes Nrf2, leading to its rapid accumulation within the cell. We identify the Neh2 domain of Nrf2 as the redox-sensitive degron.


    EXPERIMENTAL PROCEDURES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Plasmids
Mouse Nrf2-expressing Plasmids—pcDNA3.1/V5HisBmNrf2 was generated by PCR amplification of the murine Nrf2 coding sequence and 50 nucleotides of 5'-untranslated region (27) using the primer pair 5'-CACAGCGTCCGCCCTCAGCATG-3' and 5'-GTTTTTCTTTGTATCTGGCTTCTTGC-3'. The product was ligated into EcoRV-digested pcDNA3.1/V5HisB (Invitrogen), allowing expression of mNrf2-V5-his fusion protein from a CMV promoter. The pcDNA3.1/V5mNrf2, encoding mNrf2-V5, was generated from pcDNA3.1/V5HisBmNrf2 by site-directed mutagenesis using the primer 5'-GATTCTACGCGTACCGGTTAGCATCATCACCATCACCATTG-3'. Expression vectors pcDNA-3.1/V5HisBmNrf2{Delta}ETGE and pcDNA3.1/V5mNrf2{Delta}ETGE for mutant Nrf2, which lacks the ETGE tetrapeptide motif between residues 79 and 82 required for interaction with Keap1, were created by site-directed mutagenesis using the primer 5'-TTTTCGCTCAGTTTCAACTGGATGAATTCCTCCCAATTCAGCCGGCCC-3'. The pET15bmNrf2 plasmid encoding a hexahistidine-mNrf2 fusion protein was generated by PCR amplification of the mNrf2 coding sequence with the primer pair 5'-CCGCCCTCCATATGATGGACTTGGA-3' and 5'-CTAAGAAATTAACTCGAGAGTTAAA-3'. The product was digested with NdeI and XhoI and ligated into NdeI/XhoI-digested pET15b (Novagen). The pCG-GAL-(HA)mNeh2 plasmid, which expresses a hemagglutinin (HA)-tagged GAL4 DNA binding domain-mNeh2 fusion protein from a CMV promoter, was generated by PCR-amplification of the mNeh2 coding sequence (defined as the first 96 amino acids) using the primer pair 5'-CCTACCACAGCGTCCGCCTCTAGAATGATGGACTTGGAGTTGGC-3' and 5'-CTGGGAGTAGCTGGCGGATCCTCAGGTGTCTGTCTGGATATGCTG-3'. The resulting product was digested with XbaI and BamHI and ligated into similarly digested pCG-GAL(HA) (Ref. 28; kindly provided by Dr. William P. Tansey, Cold Spring Harbor Laboratory, NY). The pCG-GAL(HA)mNeh2{Delta}ETGE vector was generated in an identical fashion, but a template expressing mNrf2{Delta}ETGE was utilized for the PCR reaction.

Mouse Keap1-expressing Plasmids—A mKeap1 cDNA was generated by splice-overlap-extension of the PCR products amplified from two IMAGE consortium clones (315799, 5'-AGGCCCCTAACGGCTAGC-3' and 5'-GCGTATAGCAGCCCACCC-3'; 988252, 5'-ACGCTGCACAAGCCCACG-3' and 5'-CTGTTGTCAGTGCTCAGG-3'). The splice-overlap-extension product was cloned into pCRBlunt (Invitrogen) to generate pCRBluntmKeap1. The mKeap1 coding sequence was PCR-amplified from this template using two primers, 5'-TATGCAGCCCGAACCCAAGCTT-3' and 5'-ATGCAGGTACAGTTTTGTTGATC-3', and cloned into EcoRV-digested pcDNA3.1/V5HisC to generate pcDNA3.1/V5HisCmKeap1, which expresses a mKeap1-V5-his fusion protein. The pcDNA-3.1/mKeap1 plasmid was generated from pcDNA3.1/V5HisCmKeap1 by site-directed mutagenesis using the primer 5'-CAAAACTGTACCTGCTGAATATCCAGCACAGTG-3'; this encodes mKeap1.

Miscellaneous—The p-164CAT and pARE-164CAT reporter constructs were gifts from Dr. Cecil B. Pickett (Schering Plough Research Institute, Kenilworth, NJ) and have been described previously (29). pCMV{beta}-gal (Clontech) expresses {beta}-galactosidase under the control of a CMV promoter. pHisUb, which expresses hexahistidine-tagged octameric ubiquitin precursor protein from a CMV promoter (30), was provided by Prof. David P. Lane (University of Dundee). Site-directed mutagenesis was accomplished using the GeneEditor kit (Promega), according to the manufacturer's instructions. All constructs were sequence-verified.

Bacterial Expression and Purification of mNrf2
The pET15bmNrf2 plasmid was transformed into Escherichia coli BL21(DE3)RIL (Novagen) and selected on LB agar containing 100 µg/ml ampicillin and 34 µg/ml chloramphenicol. One colony was grown overnight at 37 °C in LB broth containing 200 µg/ml ampicillin and 34 µg/ml chloramphenicol. The next morning it was diluted 1:200 into 200 ml of LB broth containing 500 µg/ml ampicillin and 34 µg/ml chloramphenicol and grown at 37 °C to an A600 nm of 0.4. Thereafter, the bacteria were harvested, and hexahistidine-mNrf2 was induced by resuspension in 200 ml of LB broth containing 500 µg/ml ampicillin, 34 µg/ml chloramphenicol, and 1 mM isopropyl-{beta}-D-thiogalactopyranoside. The bacteria were incubated at 37 °C for 2 h, harvested, washed once with 50 mM Tris-Cl, pH 8.0, containing 2 mM EDTA, and resuspended in 5 ml of binding buffer (20 mM Tris-Cl, pH 7.9, 5 mM imidazole, 0.5 mM NaCl, and 0.01% (v/v) Nonidet P-40). Bacteria were lysed by the addition of 1 mg of lysozyme followed by incubation at 37 °C for 10 min. The lysate was flash-frozen, thawed by adding 20 ml of pre-warmed binding buffer, sonicated to reduce viscosity, and clarified by centrifugation (10,000 x g, 15 min, 4 °C). The resulting supernatant was sterile-filtered and applied to a 1-ml pre-charged Hi-Trap® Ni-chelate column (Amersham Biosciences). Hexahistidine-mNrf2 was eluted from the column in binding buffer supplemented with 250 mM imidazole, dialyzed against 50 mM Tris-Cl, pH 7.4, and flash-frozen and stored at –70 °C.

Cell Culture, Transfections, Chemical Challenge, and Reporter Assays
Both the RL34 non-transformed rat liver epithelial cell line (31) and COS1 cells were maintained in Dulbecco's modified Eagle's medium (Invitrogen) supplemented with 10% (v/v) heat-inactivated fetal calf serum (Invitrogen) and penicillin-streptomycin. Cells were seeded into either 6-well plates or 60-mm tissue culture dishes at least 18 h before transfection and were either 50% (RL34) or 90% (COS1) confluent at the time of transfection. Cells were transfected using Lipofectin (Invitrogen) according to the manufacturer's instructions. As an internal control, pCMV{beta}-gal was included in all transfections. Cells were chemically challenged not less than 40 h after plating. Sulforaphane (Sul) was obtained from LKT laboratories. Cycloheximide (CHX) was obtained from Sigma. Epoxomicin, clasto-lactacystin-{beta}-lactone, and MG132 were obtained from Calbiochem. The {beta}-galactosidase and chloramphenicol acetyl transferase (CAT) reporter assays were carried out as previously described (32).

Antibodies
During this study, a rabbit anti-mNrf2 antiserum was generated by immunization of a female New Zealand White rabbit with bacterially expressed hexahistidine-mNrf2 protein and was used at a dilution of 1:4000. Other antibodies were used at the following dilutions: rabbit anti-rNQO1, 1:3,000 (10); sheep anti-hUBF (upstream binding factor), 1:10,000 (Dr. Brian M. McStay, University of Dundee); rabbit anti-hMEK (mitogen-activated protein kinase-extracellular regulated kinase), 1:1000 (Cell Signaling Technologies); sheep anti-hMnSOD (manganese superoxide dismutase), 1:1000 (Dr. Lesley I. McLellan, University of Dundee); rabbit anti-hCPR (cytochrome P450 reductase), 1:1000 (Dr. Mark J. I. Paine, University of Dundee); mouse anti-V5, 1:2000 (Invitrogen); mouse anti-HA, clone 12CA5, 0.4 µg/ml (Roche Applied Science).

Cell Extracts, Subcellular Fractionation, and Immunoblots
For immunoblots, whole-cell lysates were prepared by scraping cell monolayers into ice-cold radioimmune precipitation assay buffer (50 mM Tris-Cl, pH 7.4, 150 mM NaCl, 1% (v/v) Nonidet P-40, 0.5% (w/v) deoxycholic acid, 0.1% (w/v) SDS supplemented with Complete, EDTA-free protease inhibitor mixture (Roche Applied Science). Lysates were clarified by centrifugation (16,000 x g, 15 min, 4 °C).

Nuclear and 1000 x g supernatant fractions were prepared as follows. Monolayers in 60-mm dishes were trypsinized, and the cell suspension was washed with 3 volumes of ice-cold phosphate-buffered saline by repeated centrifugation (500 x g, 2 min, 4 °C.) The cell pellet was gently resuspended in 300 µl of STM-N buffer (250 mM sucrose, 50 mM Tris-Cl, pH 7.5, 5 mM MgCl2, 10 mM iodoacetamide, 0.5% (v/v) Nonidet P-40 supplemented with Complete, EDTA-free protease inhibitor mixture). After 5 min on ice, the nuclei were pelleted (1000 x g, 5 min, 4 °C.) The resulting supernatant was harvested and is referred to as the 1000 x g supernatant. The nuclei were gently resuspended in 1 ml of STM buffer (STM-N, but lacking the Nonidet P-40) and layered onto 200 µl of a sucrose cushion (40% (w/v) sucrose, 10 mM HEPES, pH 7.5, 10 mM KCl, 1.5 mM MgCl2, and 1 mM dithiothreitol) Nuclei were pelleted (1000 x g, 15 min, 4 °C) and lysed in 100 µl of ice-cold radio-immune precipitation assay buffer on ice for 15 min. The lysate was cleared by centrifugation (16,000 x g, 15 min, 4 °C), and the supernatant was harvested and is referred to as the nuclear fraction. SDS/polyacrylamide-gel electrophoresis, immunoblotting, and protein determination were carried out as previously described (11).

Relative Quantitation of rNQO1 and rNrf2 mRNA
This was carried out by TaqMan® chemistry. Total RNA was isolated from RL34 cells using Trizol reagent (Invitrogen). Approximately 1.5 µg of total RNA was reverse-transcribed to cDNA using random hexamers (Promega) and the SuperScriptTM II RT kit (Invitrogen) according to the manufacturer's instructions.

For the real-time PCR analysis, the following matching oligonucleotide primers and probes, designed using PrimerExpressTM software (PerkinElmer Life Sciences), were used as follows: rNQO1, forward primer, 5'-GCAGGATTCGCCTACACGTATG-3', and reverse primer, 5'-GGTGATGGAAAGCAAGGTCTTC-3'; Probe 5'-(6-carboxyfluorescein)CACCATGTATGACCAAGGTCCTTTCCAGAATA(6-carboxyl tetramethylrhodamine)-3'; rNrf2, forward primer, 5'-TTTGGCAGAGACATTCCCATT-3', and reverse primer, 5'-GGGTGGTGAAGACTGAGCTCTCA-3', Probe 5'-(6-carboxyfluorescein)AGATGACCATGAGTCGCTTGCCCT(6-carboxyl tetramethylrhodamine)-3'. The PCR mixes were prepared and amplified as described previously (16). The expression of 18 S rRNA was used as an internal control and was quantitated by TaqMan® chemistry using the TaqMan® ribosomal RNA control reagent (PerkinElmer Life Sciences).

Data acquisition and analysis utilized the ABI PRISM® 7700 sequence detection system (PerkinElmer Life Sciences). The relative gene expression levels in different samples was calculated using the Comparative CT Method as outlined in the ABI PRISM® 7700 Sequence Detection System User Bulletin 2.

In Vivo Ubiquitination Assay
This was carried out using the method of Treier et al. (30). COS1 cells were transfected with pHisUb along with either pcDNA3.1/V5mNrf2 or pcDNA3.1/V5mNrf2{Delta}ETGE and other expression vectors as described in Fig. 7. Approximately 24 h later, the transfected cells were treated with 10 µM MG132 for 2 h before the monolayers were washed with prewarmed phosphate-buffered saline and scraped into 0.36 ml of phosphate-buffered saline. A whole-cell lysate was prepared from 50 µl of the cell suspension and is referred to as the "input" fraction. His-tagged protein was purified from the remainder of the cell suspension as follows; the cell suspension was lysed by the addition to 2.2 ml of buffer A (6 M guanidine, 10 mM Tris, 0.1 M phosphate buffer, pH 8.0) supplemented with 5 mM imidazole. The resulting lysate was sonicated to reduce viscosity before 50 µl of Ni-CAM® HC resin (Sigma) was added, and the mixture was rotated overnight at 4 °C. Thereafter, the beads were washed sequentially with buffer A supplemented with 10 mM 2-mercaptoethanol (2-ME), buffer B (8 M urea, 10 mM Tris, 0.1 M phosphate buffer, pH 8.0) supplemented with 10 mM 2-ME, buffer C (8 M urea, 10 mM Tris, 0.1 M phosphate buffer, pH 6.3) supplemented with 10 mM 2-ME and 0.2% (v/v) Triton X-100, and finally, buffer C supplemented with 10 mM 2-ME and 0.1% (v/v) Triton X-100. Bound material was eluted from the beads by suspension in 50 µl of modified Laemmli sample buffer (20 mM Tris-Cl, pH 6.8, 10% (v/v) glycerol, 0.8% (w/v) SDS, 0.1% (w/v) bromphenol blue, 0.72 M 2-ME, and 300 mM imidazole) followed by boiling for 4 min. The suspension was centrifuged (16,000 x g, 1 min, 20 °C), and the resulting supernatant was collected and is referred to as the "pull-down" fraction.



View larger version (47K):
[in this window]
[in a new window]
 
FIG. 7.
Nrf2 is ubiquitinated in a Keap1- and oxidative stress-independent fashion. Duplicate dishes of COS1 cells were transfected with the indicated plasmids. After transfection (24 h), cells were treated with 10 µM MG132 for 2 h with or without cotreatment with 15 µM Sul before both a whole-cell lysate (input) and affinity-purified His-tagged protein fraction (Pull-down) were prepared from each dish of transfected cells and blotted with anti-V5. Mr markers are indicated to the left of each blot.

 


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Sulforaphane Transcriptionally Activates rNQO1 in RL34 Cells—Previous workers have shown that NQO1 genes are regulated by agents that cause oxidative stress, and evidence suggests that this is mediated by Nrf2 through an ARE (11, 33, 34). In the present study, we sought to provide further information about how the function of Nrf2 is controlled by oxidative stress. To this end, the isothiocyanate Sul, which causes oxidative stress by reacting with GSH to form dithiocarbamates, (35), was chosen as the oxidative stressor. As a model system we chose the non-transformed rat RL34 cell line over the more commonly utilized human HepG2 and mouse Hepa1c1c7 cell lines because its phenotypic response to Sul more closely recapitulates that observed in rodent liver. Specifically, untreated RL34 cells express an undetectable level of rNQO1 protein that is highly inducible by Sul treatment (Fig. 1A). By contrast, HepG2 and Hepa1c1c7 cell lines both express high basal levels of NQO1 with little or no induction observed after treatment with Sul (data not shown). The accumulation of rNQO1 protein in the RL34 cell line is paralleled by a rapid (significantly increased after 1 h, p < 0.05) elevation in the level of its cognate mRNA (Fig. 1B). As CAT activity expressed from the pARE-164CAT construct, but not p-164CAT, is induced by Sul (Fig. 1C), the increase in NQO1 protein is a consequence of transcriptional activation of rNQO1 promoter, presumably mediated by Nrf2 through the ARE in the promoter of the oxidoreductase gene.



View larger version (21K):
[in this window]
[in a new window]
 
FIG. 1.
Sulforaphane causes transcriptional activation of rNQO1 in RL34 cells. RL34 cells were treated with 15 µM Sul for the indicated periods of time and whole-cell lysates were immunoblotted with rabbit anti-rNQO1 (A) or total RNA was isolated from triplicate dishes (B), and the relative expression of rNQO1 mRNA was determined by real-time PCR using TaqMan® chemistry (mean ± S.D.). C, RL34 cells in 6-well plates were transfected with 0.4 µg of either pARE-164CAT or p-164CAT, 0.4 µg of pCMV{beta}-gal (internal control), and 1.2 µg of empty vector (pcDNA3.1/V5HisC). Cells in triplicate wells were treated with 15 µM Sul or vehicle (0.1% (v/v) dimethyl sulfoxide (DMSO) and lysed after the indicated periods of time. The CAT and {beta}-galactosidase activities of each lysate were determined. The internally controlled and normalized CAT activity (mean ± S.D.) is depicted as a function of time.

 

Sulforaphane Causes a Rapid Nuclear Accumulation of rNrf2 Protein—To determine how Sul controls rNrf2 activity in RL34 cells, whole-cell lysates were prepared at different times after Sul treatment and blotted with a rabbit anti-mNrf2 antiserum (Fig. 2A). An immunochemically cross-reacting electrophoretic band representing rNrf2 was identified by virtue of its comigration with the immunogen. Treatment of cells with Sul, but not vehicle, led to a rapid and sustained elevation in the level of this protein (Fig. 2, A and B). The Nrf2 protein could not be unequivocally identified in untreated RL34 cells but was readily detected 15 min after treatment with Sul. Its level appeared to peak between 2 and 4 h after Sul treatment and remained elevated for at least 24 h. Subcellular fractionation revealed that, whenever detectable, the majority of rNrf2 was associated with the nuclear fraction (Fig. 2C). The procedure provided a highly pure nuclear fraction with no evidence of cytoplasmic, mitochondrial, or endoplasmic reticulum contamination, as assessed by the absence of MEK (mitogen-activated protein kinase-extracellular regulated kinase), manganese superoxide dismutase, or cytochrome P450 reductase marker proteins, respectively.



View larger version (38K):
[in this window]
[in a new window]
 
FIG. 2.
Sulforaphane causes rapid nuclear accumulation of rNrf2 in RL34 cells. A, whole-cell lysates prepared from RL34 cells treated with 15 µM Sul for the indicated periods of time were electrophoresed through a 6% resolving gel and probed with rabbit anti-mNrf2. A 1.4-ng portion of immunogen was used as a standard. Mr markers are indicated to the left of the blot. A cross-reacting band, which comigrates with the rNrf2 band in 10% resolving gels, is indicated by an asterisk. B, whole-cell lysates were prepared from RL34 cells treated with 15 µM Sul (+) or vehicle (–) for the indicated periods of time and blotted with rabbit anti-mNrf2. C, whole-cell lysates were prepared from duplicate dishes of untreated RL34 cells (lanes 1). Nuclear and 1000 x g supernatant fractions were prepared from duplicate dishes of untreated RL34 cells (lanes 2) or cells treated for 2 h with vehicle (lanes 3) or 15 µM Sul (lanes 4). 16 µg (whole-cell lysates), 12 µg (1000 x g supernatant fractions), and 6 µg (nuclear fractions) of protein were separated through a 10% resolving gel and probed with antibodies raised against the proteins indicated on the left. The band developed by the anti-mNrf2 antiserum in nuclear fractions from untreated and vehicle-treated cells (nuclear fraction lanes 2 and 3) does not represent rNrf2, but the band indicated by an asterisk in A. UBF, upstream binding factor; MnSOD, manganese superoxide dismutase; CPR, cytochrome P450 reductase; MEK, mitogen-activated protein kinase-extracellular regulated kinase. D, RL34 cells were treated with 15 µM Sul for 2 h before the addition of CHX to a final concentration of 10 µM. Subsequently, whole-cell lysates were prepared at different time points and probed with rabbit anti-mNrf2. The graph depicts the natural logarithm of the relative expression of rNrf2 protein (quantitated by densitometry) as a function of CHX-chase time (mean ± S.D. of three independent experiments). The best-fit line, 95% confidence limits (broken lines), and the derived half-life (t1/2) are presented.

 

Being undetectable in homeostatic RL34 cells, the stability of rNrf2 under such conditions remains a matter of conjecture. CHX-chase experiments revealed, however, that after2hofSul treatment, degradation of rNrf2 followed first-order kinetics with an approximate half-life of 30 min (Fig. 2D).

Sulforaphane Antagonizes Proteasome-dependent Degradation of rNrf2—The amount of protein expressed in mammalian cells is controlled primarily by regulating its rate of degradation and/or by altering the transcriptional activation of its gene. Evidence that Nrf2 might be transcriptionally activated by oxidative stress was presented by Kwak et al. (22, 23). Although such a mechanism could play some role in the later response to Sul, it is unlikely to account for the large increase in Nrf2 protein within the first 2 h. To discount the possibility that induction of rNrf2 contributes to the accumulation of Nrf2 protein, we measured the level of mRNA for the protein after exposure of RL34 cells to Sul. Real-time PCR showed no statistically significant change in the expression of rNrf2 mRNA at any time. By contrast, rNQO1 mRNA levels were elevated 20-fold within 8 h (Fig. 3). We therefore conclude that Sul does not cause any significant transcriptional activation of rNrf2.



View larger version (16K):
[in this window]
[in a new window]
 
FIG. 3.
Sulforaphane does not increase expression of rNrf2 mRNA. Total RNA was isolated from RL34 cells after treatment with 15 µM Sul for the indicated periods of time. The relative expression of rNrf2 and rNQO1 mRNA were determined by TaqMan® chemistry (mean ± S.D. of triplicate dishes).

 

Failure of Sul to affect induction of rNrf2 mRNA suggested that the increase in rNrf2 protein observed after treatment with the isothiocyanate might be wholly due to a reduction in its rate of degradation. In eukaryotic cells, regulatable proteolysis of intracellular proteins is in most cases accomplished by the proteasome (3638). The notion that Nrf2 protein levels might be controlled by Sul through a proteasome-based mechanism is supported by the work of Sekhar et al. (39) who reported that proteasome inhibition activated ARE-driven gene expression in HepG2 cells. More recently, it has been reported that tert-butylhydroquinone can stabilize hNrf2 in HepG2 cells, and CdCl2 can stabilize mNrf2 protein in Hepa cells (24, 25). To evaluate the role of the proteasome in regulation of rNrf2, we treated RL34 cells with three structurally dissimilar proteasome inhibitors, epoxomicin, clasto-lactacystin-{beta}-lactone (Fig. 4A), and MG132 (data not shown). All resulted in the accumulation of rNrf2, demonstrating that it is subject to proteasome-dependent degradation. In fact, after MG132-treatment of RL34 cells, CHX-chase experiments failed to reveal any degradation of rNrf2 during a chase period of 60 min (Fig. 4B). This finding suggested that the major proteolytic activities responsible for rNrf2 degradation are proteasomal in nature. In addition, because rNrf2 was calculated to have a half-life of 31 min in Sul-treated cells (Fig. 2D), the bZIP protein appears to be subject to proteasome-mediated degradation even during oxidative stress.



View larger version (61K):
[in this window]
[in a new window]
 
FIG. 4.
Sulforaphane stabilizes rNrf2 protein by antagonizing its proteasome-dependent degradation. A, RL34 cells were treated with the indicated compounds for 2 h. Whole-cell lysates were prepared and immunoblotted with rabbit anti-mNrf2. A 1.4-ng portion of immunogen was used as standard. B, RL34 cells were cultured with 2.5 µM MG132 for 2 h before CHX was added to a final concentration of 10 µM. Whole-cell lysates were prepared from duplicate dishes 0, 30, and 60 min after the addition of CHX and probed with rabbit anti-mNrf2. C, RL34 cells were cultured with 2.5 µM MG132 for 2 h. Medium was removed, and all monolayers were washed with one volume of fresh medium. Fresh medium containing 10 µM CHX and either 15 µM Sul (+) or vehicle (–) was added to each dish. Whole-cell lysates were prepared from duplicate dishes 0 or 60 min later and were probed with rabbit anti-mNrf2. DMSO, Me2SO; Epox, epoxomicin; Lac, clasto-lactacystin-{beta}-lactone.

 

Because rNrf2 protein cannot be unequivocally identified in homeostatic RL34 cells, we could not determine directly whether under such circumstances it is subject to a greater rate of proteasome-dependent degradation than when treated with Sul. To investigate this point, the fact that MG132-mediated inhibition of the proteasome is reversible was exploited to generate a measurable pool of rNrf2 in RL34 cells before either returning them to normal conditions or subjecting them to oxidative stress. RL34 cells were pretreated with MG132 for 2 h before the proteasome inhibitor was removed and replaced with media containing CHX and either Sul or vehicle. When cotreated with CHX and vehicle, a notable reduction in the expression of rNrf2 was observed after a chase period of 60 min (Fig. 4C), indicative of proteasomal-mediated degradation. Most importantly, this degradation was clearly inhibited by cotreatment with Sul. Overall, these data suggest that Nrf2 is subject to proteasome-dependent degradation under both homeostatic and oxidative stress conditions but that the rate of degradation is reduced significantly during oxidative stress. Redox-regulated proteasomal degradation is likely to be a universal feature of Nrf2 regulation, at least in mammals.

Direct Interaction between Keap1 and Nrf2 Is Essential to Confer Oxidative Stress Dependence on the Level of Nrf2—To explore the mechanism underlying the oxidative stress-regulated degradation of Nrf2, we sought to reconstitute this phenotype in COS1 cells by heterologously expressing epitope-tagged Nrf2 along with untagged Keap1. In COS1 cells, ectopic expression of mNrf2-V5-his induced ARE-driven CAT activity, which was suppressed by coexpression of mKeap1, whereas transactivation of the reporter construct by heterologous expression of mNrf2{Delta}ETGE-V5-his, a mutant Nrf2 which lacks the tetrapeptide motif between amino acids 79 and 82 essential for the Nrf2/Keap1 interaction, was not ablated by coexpression of mKeap1 (Fig. 5A).



View larger version (32K):
[in this window]
[in a new window]
 
FIG. 5.
Keap1 confers redox-sensitivity upon the level of Nrf2. A, COS1 cells in 6-well plates were cotransfected with 0.4 µg of pARE-164CAT reporter vector, 0.4 µg of pCMV{beta}-gal, and the indicated amounts of the following expression plasmids: Nrf2, pcDNA3.1/V5HisBmNrf2; Nrf2{Delta}ETGE, pcDNA3.1/V5HisBmNrf2{Delta}ETGE; Keap1, pcDNA3.1/V5HisCmKeap1. All transfection mixes were made up to 2 µg of total plasmid with pcDNA3.1/V5HisC. After transfection (24 h), whole-cell lysates were prepared, and the CAT and {beta}-galactosidase activities were determined. The relative CAT activities are depicted (mean ± S.D. of three independent experiments.) B, COS1 cells in 60-mm dishes were cotransfected with 2 µg of pcDNA3.1/V5HisBmNrf2, 0.8 µg of pCMV{beta}-gal, and either 2 µg of pcDNA3.1/V5HisC (i) or 2 µg of pcDNA3.1/mKeap1 (ii). After 24 h, dishes were treated with 15 µM sulforaphane, and whole-cell lysates were prepared from duplicate dishes at the indicated time points. The {beta}-galactosidase activity of each lysate was determined. Volumes of lysate containing equivalent amounts of {beta}-galactosidase activity were electrophoresed through an 8% resolving gel and blotted with mouse anti-V5.

 

When pcDNA3.1/V5hisBmNrf2 was transfected alone into COS1 cells, the level of mNrf2-V5-his protein was only minimally responsive to the applied oxidative stress (Fig. 5B, panel i). Coexpression of mNrf2-V5-his and mKeap1 was required to confer significant oxidative stress dependence upon the level of the bZIP protein (Fig. 5B, panel ii), an affect that appeared to result solely from a diminution in the level of the transcription factor under homeostatic conditions when coexpressed with mKeap1. The data in Fig. 5, panel ii, might suggest that mNrf2-V5-his protein is expressed at higher levels in the presence of mKeap1 than without mKeap1 after sulforaphane treatment for 60 and 120 min. This interpretation is incorrect, and the difference in the mNrf2-V5-his signal merely results from the fact that the protein was blotted onto two different membranes (albeit at the same time). No experimental evidence has been obtained to support a difference in the expression of mNrf2-V5-his after 2 h of sulforaphane treatment regardless of the presence or absence of coexpressed mKeap1 (data not shown).

The above findings suggest that under homeostatic conditions Keap1 increases the rate of proteasomal degradation of Nrf2 through a direct interaction and that during oxidative stress this interaction is antagonized, exposing Nrf2 to a reduced rate of proteasomal degradation. To test this model we compared the biological properties of mNrf2-V5-his coexpressed with mKeap1 with the mutant Nrf2, mNrf2{Delta}ETGE-V5-his, coexpressed with mKeap1. Mutant mNrf2{Delta}ETGE-V5-his was found to be subject to proteasomal degradation, judged by the fact its half-life in homeostatic COS1 cells was 29 min (Fig. 6D), but when treated with MG132, its half-life increased to at least 3 h (Fig. 6A, panel ii). Thus, mutant Nrf2 protein accumulated in response to treatment with MG132 (Fig. 6B, panel ii). As predicted by the model, the level of mNrf2{Delta}ETGE-V5-his protein, which could not interact with mKeap1, was not influenced by treatment with Sul (Fig. 6C, panel ii), indicating that its half-life is independent of the redox environment. mNrf2-V5-his was also subject to proteasomal degradation (Fig. 6A, panel i, and B, panel i), but two major differences were observed between it and mNrf2{Delta}ETGE-V5-his. First, under homeostatic conditions mNrf2-V5-his was less stable than mNrf2{Delta}ETGE-V5-his. Although we could not model precisely its kinetics of degradation, a CHX-chase period of between 7.5 and 15 min was sufficient to reduce mNrf2-V5-his expression by half (Fig. 6E). This compares with a half-life of 29 min for mNrf2{Delta}ETGE-V5-his (Fig. 6D). Not surprisingly therefore, mNrf2-V5-his was present at lower levels than was the mutant protein under homeostatic conditions (Fig. 6C). Second, mNrf2-V5-his was found to accumulate rapidly in COS1 cells after exposure to Sul, demonstrating that its half-life was increased by oxidative stress (Fig. 6C). As a consequence, the level of wild-type Nrf2 protein approached that of mutant Nrf2 protein after Sul-treatment.



View larger version (52K):
[in this window]
[in a new window]
 
FIG. 6.
Keap1 destabilizes Nrf2 by directly interacting with it. A, COS1 cells were transfected with 2 µg of pcDNA3.1/mKeap1, 0.8 µg of pCMV{beta}-gal, and either 2 µg of pcDNA3.1/V5HisBmNrf2 (i) or 2 µg of pcDNA3.1/V5HisBmNrf2{Delta}ETGE (ii). After 24 h, cells were treated with 10 µM MG132 for 2 h before CHX was added to a final concentration of 10 µM. Whole-cell lysates were prepared from duplicate dishes at the indicated time points and blotted with mouse anti-V5. B and C, COS1 cells were transfected as described for A, and cells were treated with either 10 µM MG132 (B) or 15 µM Sul (C) for the indicated periods of time before whole-cell lysates were prepared from duplicate dishes and blotted with mouse anti-V5. D, COS1 cells were cotransfected with 2 µg of pcDNA3.1/V5HisBmNrf2{Delta}ETGE, 2 µg of pcDNA3.1/mKeap1, and 0.8 µg of pCMV{beta}-gal. After transfection (24 h), CHX was added to each culture to a final concentration 10 µM, and whole-cell lysates were prepared from duplicate dishes of cells at different CHX-chase times and probed with anti-V5. The graph depicts the natural logarithm of the relative expression (quantitated by densitometry) of mNrf2{Delta}ETGE-V5-his as a function of the CHX-chase time (mean ± S.D. of three independent experiments). E, COS1 cells were cotransfected with 2 µg of pcDNA3.1/V5HisBmNrf2, 2 µg of pcDNA3.1/mKeap1, and 0.8 µg of pCMV{beta}-gal. Later (24 h after transfection), CHX was added to a final concentration of 10 µM, and whole-cell lysates were prepared after the indicated CHX-chase periods. Equal volumes of lysates were electrophoresed through an 8% gel and blotted with anti-V5. 0.5 volume (lane 5) and 0.25 volume (lane 8) of the CHX-chase sample obtained at 0 min (lane 1) were also included to allow estimation of the amount of mNrf2-V5-his remaining at each time point. Whole-cell lysates were also prepared from duplicate dishes of mock-transfected cells and run in lanes 9 and 10. The low signal-to-noise ratio did not allow densitometric scanning of the three blots (from three independent experiments) depicted. Nevertheless, it is clear that in each case, a CHX-chase period of between 7.5 and 15 min reduced the amount of mNrf2-V5-his by half.

 

These results demonstrate that Nrf2 is subject to at least two different modes of proteolysis. First, there exists a Keap1-independent, redox-insensitive proteasomal degradation responsible for the short half-life of rNrf2 in oxidatively stressed RL34 cells (31 min) and for the half-life of mNrf2{Delta}ETGE-V5-his in COS1 cells (29 min). Second, Nrf2 is subject to a substantially more rapid Keap1-dependent, redox-dependent proteasomal degradation. Thus, Keap1 appears to function as a trans-acting factor that stimulates the rate of proteasomal degradation of Nrf2. This activity entails a physical interaction between Keap1 and Nrf2 that occurs under homeostatic conditions but not during oxidative stress (18).

Nrf2 Is Ubiquitinated in Vivo in a Keap1- and Redox-independent Fashion—Many substrates of the 26 S proteasome require polyubiquitination to target them for degradation (40). In light of the data in Fig. 6, we were interested in determining whether Nrf2 is subject to ubiquitination and, if so, whether the ubiquitination is modulated by Keap1 and/or Sul treatment. To determine the ubiquitination status of Nrf2, COS1 cells were transfected with vectors expressing the proteins indicated in Fig. 7. After 24 h, cells were treated with MG132 with or without Sul cotreatment as indicated. Subsequently, His-tagged proteins were affinity-purified and assayed for the presence of V5-tagged proteins by immunoblot analysis (Fig. 7). A smear of high molecular mass V5-tagged protein was evident in the "pull-down" fraction of COS1 cells cotransfected with mNrf2-V5, mKeap1, and Ub-his (lanes 5 and 6). Because no V5-tagged protein was detected if the vector expressing either mNrf2-V5 (lanes 9 and 10) or Ub-his (lanes 11 and 12) was omitted from the transfection, this smear represents polyubiquitinated mNrf2-V5. In addition, Fig. 7 also demonstrated that polyubiquitination of Nrf2 occurs in a Keap1-independent fashion; in the absence of heterologously expressed mKeap1, mNrf2-V5 was still ubiquitinated (lanes 1 and 2), and heterologously expressed mNrf2{Delta}ETGE-V5 (lanes 3 and 4) was successfully polyubiquitinated in this assay. Finally, oxidative stress caused by treatment with Sul did not impair the ubiquitination of mNrf2-V5 (compare lanes 5 and 6 with lanes 7 and 8). It is, therefore, concluded that Nrf2 can be ubiquitinated by a mechanism that is independent of both Keap1 and the redox environment of the cell.

The Neh2 Domain of Nrf2 Constitutes a Redox-sensitive Degron—Although it was evident that the ETGE tetrapeptide motif of Nrf2 is essential for its Keap1-dependent degradation, it was unclear what cis-acting sequences within the transcription factor were sufficient to target it for redox-sensitive degradation by the proteasome. We postulated that its Neh2 domain, which is highly conserved across species and contains the ETGE tetrapeptide motif, might serve as a redox-sensitive "degron" (a protein sequence sufficient to confer metabolic instability; see Varshavsky (41)). To evaluate this hypothesis, constructs expressing either the mNeh2 domain or mNeh2{Delta}ETGE fused to the C terminus of a HA-tagged GAL4 DNA binding domain were generated.

An initial experiment revealed that during heterologous coexpression of either GAL4(HA)mNeh2 or GAL4(HA) mNeh2{Delta}ETGE with mKeap1, the level of neither fusion protein was altered when the COS1 cells were exposed to Sul (data not shown). One explanation considered for the failure of mKeap1 to confer redox sensitivity upon the expression level of Gal4(HA)mNeh2 protein was that the level of expression of the N-terminal fusion protein might be sufficiently great as to saturate the binding capacity of the heterologously expressed mKeap1. To reduce the expressed levels of these fusion proteins, we transfected reduced amounts of the relevant expression constructs into COS1 cells. In line with the above interpretation, when lower amounts of the fusion proteins were expressed, the expression of GAL4(HA)mNeh2 became Sul-dependent, in contrast to the expression of GAL4(HA) mNeh2{Delta}ETGE (Fig. 8A). Next, we sought to show that the half-life of the HA-tagged GAL4 DNA binding domain was reduced by fusing the mNeh2 domain to its C terminus. Because of a low signal-to-noise ratio, it was not possible to calculate or estimate by immunoblot analysis the half-life of Gal4(HA) mNeh2 or GAL4(HA)mNeh2{Delta}ETGE when they were expressed at the low levels required to confer redox sensitivity upon the expression level of the wild-type fusion protein. Nonetheless, when expressed at higher levels, CHX-chase experiments revealed that the half-lives of both GAL4(HA)mNeh2 (33 min) and GAL4(HA)mNeh2{Delta}ETGE (29 min) were much shorter than that of GAL4(HA) (500 min) (Fig. 8B). The similar half-life of both fusion proteins is in complete accordance with the observation that, under these transfection conditions, the expression of Gal4(HA)mNeh2 protein was unaltered by sulforaphane treatment. The calculated half-lives for both fusion proteins are close to those calculated for mNrf2{Delta}ETGE-V5-his in COS1 cells (Fig. 6D), suggesting that the Neh2 domain of Nrf2 is the sole cis-acting determinant of Nrf2 stability. Overall, these data suggest that the Neh2 region of Nrf2 constitutes a redox-sensitive degron.



View larger version (36K):
[in this window]
[in a new window]
 
FIG. 8.
The Neh2 domain of Nrf2 constitutes a redox-sensitive degron. A, COS1 cells were transfected with 2 µg of pcDNA3.1/mKeap1, 0.8 µg of pCMV{beta}-gal, and the indicated amounts of either pCG-GAL(HA)mNeh2 or pCG-GAL(HA)mNeh2{Delta}ETGE. All transfection mixes were made up to the same amount of DNA with pcDNA3.1/V5HisC. After 24 h, duplicate dishes of cells were treated with either 15 µM Sul (+) or vehicle (-) for 2 h, and whole-cell lysates were prepared and blotted with anti-HA. The bands representing the fusion proteins are shown with an asterisk. B, COS1 cells were cotransfected with 2 µg of pcDNA3.1/mKeap1, 0.8 µg of pCMV{beta}-gal, and 2 µg of either pCG-GAL(HA), pCG-GAL(HA)mNeh2, or pCG-GAL(HA)mNeh2{Delta}ETGE. Twenty-four h after transfection, CHX was added to a final concentration of 10 µM, and whole-cell lysates were prepared from duplicate dishes of cells after the indicated CHX-chase periods and probed with anti-HA. The graphs depict the natural logarithm of the relative expression (quantitated by densitometry) of the indicated proteins as a function of the CHX-chase time (mean ± S.D. of three independent experiments).

 


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
This paper contains the first report that Nrf2 is subject to constitutive, Keap1-independent polyubiquitination and degradation by the proteasome. During oxidative stress, this appears to be the sole mechanism accounting for degradation of the bZIP transcription factor. It confers a half-life of 31 min upon rNrf2 in oxidatively stressed RL34 cells and a half-life of 29 min upon mNrf2{Delta}ETGE-V5-his heterologously expressed in COS1 cells (cf. Figs. 2D and 6D). The ubiquitin-conjugating enzymes involved in the process remain unidentified, but the Neh2 domain of Nrf2 constitutes the relevant degron.

Under homeostatic conditions, the amount of Nrf2 protein in the RL34 cell line (this paper), other cell lines (2325), and in murine liver (22) is significantly lower than in cells subjected to oxidative stress. This reduction is a consequence of a second more rapid mode of proteasomal degradation of Nrf2 that operates in non-stressed cells and requires Keap1 as an essential trans-acting factor (Figs. 5 and 6). Keap1 increases the homeostatic rate of proteasomal degradation of Nrf2 by directly interacting with it via the ETGE tetrapeptide motif present between residues 79 and 82 in the Neh2 domain of the bZIP protein (Figs. 5 and 6). The fact that this interaction is antagonized by oxidative stress (19) explains why this mode of degradation is restricted to homeostatic conditions. The half-life of endogenous rNrf2 in non-stressed RL34 cells could not be calculated because it was undetectable, but the half-life of mNrf2-V5-his heterologously coexpressed with mKeap1 in homeostatic COS1 cells was between 7.5 and 15 min. By contrast, the half-life of mNrf2{Delta}ETGE-V5-his heterologously expressed under the same conditions was ~30 min (Fig. 6).

Although the Neh2 domain of Nrf2 constitutes a degron common to both Keap1-independent and -dependent degradation of Nrf2 (Fig. 8), the mechanism of Keap1-dependent degradation and its relationship to Keap1-independent degradation remains a matter of conjecture. It is not known whether the Keap1-dependent degradation of Nrf2 involves a direct enhancement of the Keap1-independent degradation or constitutes a distinct parallel pathway. It is not even clear whether the Keap1-dependent pathway requires polyubiquitination of Nrf2. In yeast, the efficient degradation of many proteins, such as Mat{alpha}2 and Far1, requires their localization to discrete cellular compartments, apparently due to the non-uniform distribution of components of the ubiquitin system and the proteasome (42, 43). In mammalian cells, the proteasome and ubiquitin-conjugating enzymes also appear to be non-uniformly distributed throughout the cytoplasm and the nucleus (38, 4446). In common with many other Kelch-repeat proteins (for review, see Ref. 47), Keap1 has a restricted cellular distribution, being localized to the cytoskeleton (19, 48, 49). Thus, Keap1 may recruit Nrf2 in a redox-dependent manner to regions of the cytoskeleton to facilitate proteasomal degradation. Certainly, proteasomes have been observed localized to the cytoskeleton in mammalian cells (Ref. 45 and references therein). It is even possible that Keap1 might actively recruit Nrf2 to the proteasome, a notion supported by the functional similarity between Keap1 and the recently identified yeast protein Cic1 (50). Like Keap1, Cic1 increases the rate of proteasomal degradation of specific substrates (the SCF subunits Cdc4 and Grr1) but has no effect on the global rate of proteasomal degradation. Cic1 was originally isolated in a yeast two-hybrid screen for proteins interacting with the {alpha}4 subunit of the yeast proteasome and appears to act as an adaptor between the relevant SCF complexes and the proteasome, thereby ensuring the preferential proteasomal degradation of important regulatory proteins over the general population of ubiquitinated substrates (50). The existence in mammalian cells of proteins with characteristic similar to Cic1 or "extrinsic factors that assist in the recognition of certain substrates" (40), has been predicted. Keap1 may act as such a factor by a similar mechanism to that observed for Cic1. Keap1 appears to function as a dimer (49), with each monomer containing six Kelch-repeat motifs (19). Because this motif represents a general protein-protein interaction module (47), Keap1 possesses the characteristics required to bind and bring together multiple proteins.

It is curious that reports to date on Keap1 function have emphasized its sequestration of Nrf2 in the cytosol without noting an enhanced rate of degradation of Nrf2 (19, 48). It should be borne in mind that although heterologous expression of Nrf2 and Keap1 in cells is sufficient to observe an interaction between the two proteins, enhanced degradation of Nrf2 might require other conditions to be fulfilled. Thus, we have shown that Keap1 is essential to enhance the rate of degradation of Nrf2 in homeostatic cells but have not demonstrated that it is sufficient for this purpose. It is likely that the consequence of the Keap1-Nrf2 interaction will depend upon the amounts of heterologous proteins expressed and the cell line studied. It is intriguing to note that mouse liver (22) and two non-transformed cell lines (RL34 (this study) and PE cells (23)) contain no detectable Nrf2 protein under homeostatic conditions. By contrast, two of three transformed cell lines for which data are available (HepG2 and H4IIEC3 (24)) contain detectable levels of Nrf2 proteins under homeostatic conditions, and treatment of these cell lines with oxidative stressors only modestly increases the half-lives and levels of the bZIP proteins. It has been argued that up-regulation of GSH-dependent enzymes might contribute to the transformed phenotype by allowing cancerous cells to better withstand oxidative stress (51, 52), and it is conceivable that in certain transformed cell lines Keap1 function is partly disabled, and it does not efficiently degrade Nrf2. This might be one explanation for the high expression of NQO1 in HepG2 cells. In cell lines emphasizing the sequestration of heterologously expressed Nrf2 by heterologously expressed Keap1, not only might Nrf2 not be destabilized by Keap1, but rather, by competing with the endogenous ubiquitin ligases for Nrf2, Keap1 might actually stabilize Nrf2, as has been observed in HepG2 cells by Sekhar et al. (53).

In conclusion, the half-life of Nrf2 is coupled to the redox state of the cell by means of a redox-sensitive interaction between the ETGE tetrapeptide motif of its Neh2 degron and Keap1, a cytoskeleton-bound protein. This interaction does not occur in oxidative-stressed cells, and under these conditions, Nrf2 is subject to Keap1-independent ubiquitination and proteasome-mediated degradation. However, in homeostatic cells Keap1 binds Nrf2 and by doing so substantially reduces the half-life of the transcription factor from that observed in oxidative-stressed cells. This redox-sensitive half-life enables rapid accumulation of total cellular levels of Nrf2 in response to oxidative stress, which contributes to the increase in nuclear levels of the transcription factor, the induction of cytoprotective genes, and ultimately, the restoration of homeostasis. In turn, this destabilizes Nrf2, and the adaptive response is switched off. How the redox environment of the cell is linked to the Keap1-Nrf2 interaction and how Keap1 enhances the rate of degradation of Nrf2 are subjects worthy of further inquiry.


    FOOTNOTES
 
* This work was funded by grants from the Association for International Cancer Research (99-041 and 02-049) (to M. Y. and J. D. H.). The TaqMan® analyses described herein were obtained with equipment provided by a Medical Research Council Cooperative Group Grant G00002 [GenBank] 81. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

{ddagger} To whom correspondence should be addressed: Biomedical Research Centre, Ninewells Hospital and Medical School, Dundee DD1 9SY, Scotland, UK. Tel.: 44-1382-660111; Fax: 44-1382-669993; E-mail: m.j.m.mcmahon{at}dundee.ac.uk.

1 The abbreviations used are: NQO1, NAD(P)H:quinone oxidoreductase 1; ARE, antioxidant response element; Neh, Nrf2-ECH homology; Keap1, Kelch-like ECH-associated protein 1; HA, hemagglutinin; Sul, sulforaphane; CAT, chloramphenicol acetyltransferase; CHX, cycloheximide; 2-ME, 2-mercaptoethanol; CREB, cAMP-response element-binding protein; CMV, cytomegalovirus. Back


    ACKNOWLEDGMENTS
 
We thank Dr. Brian McStay, Dr. William Tansey, Prof. David Lane, Dr. Sonia Lain, and Dr. Sam Crouch for expert advice and help.



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Schafer, F. Q., and Buettner, G. R. (2001) Free Radic. Biol. Med. 30, 1191–1212[CrossRef][Medline] [Order article via Infotrieve]
  2. Cadenas, E. (1995) in Oxidative Stress and Antioxidant Defenses in Biology (Ahmad, S., ed) pp. 1–61, Chapman & Hall, New York
  3. Dalton, T. P., Shertzer, H. G., and Puga, A. (1999) Annu. Rev. Pharmacol. Toxicol. 39, 67–101[CrossRef][Medline] [Order article via Infotrieve]
  4. Inamdar, N. M., Ahn, Y. I., and Alam, J. (1996) Biochem. Biophys. Res. Commun. 221, 570–576[CrossRef][Medline] [Order article via Infotrieve]
  5. Moinova, H. R., and Mulcahy, R. T. (1999) Biochem. Biophys. Res. Commun. 261, 661–668[CrossRef][Medline] [Order article via Infotrieve]
  6. Ishii, T., Itoh, K., Takahashi, S., Sato, H., Yanagawa, T., Katoh, K., Bannai, S., and Yamamoto, M. (2000) J. Biol. Chem. 275, 16023–16029[Abstract/Free Full Text]
  7. Kim, Y-C., Masutani, H., Yamaguchi, Y., Itoh, K., Yamamoto, M., and Yodoi, J. (2001) J. Biol. Chem. 276, 18399–18406[Abstract/Free Full Text]
  8. Li, J., Lee, J.-M., and Johnson, J. A. (2002) J. Biol. Chem. 277, 388–394[Abstract/Free Full Text]
  9. Sasaki, H., Sato, H., Kuriyama-Matsumura, K., Sato, K., Maebara, K., Wang, H., Tamba, M., Itoh, K., Yamamoto, M., and Bannai, S. (2002) J. Biol. Chem. 277, 44765–44771[Abstract/Free Full Text]
  10. Kelly, V. P., Ellis, E. M., Manson, M. M., Chanas, S. A., Moffat, G. J., McLeod, R., Judah, D. J., Neal, G. E., and Hayes, J. D. (2000) Cancer Res. 60, 957–969[Abstract/Free Full Text]
  11. McMahon, M., Itoh, K., Yamamoto, M., Chanas, S. A., Henderson, C. J., McLellan, L. I., Wolf, C. R., Cavin, C., and Hayes, J. D. (2001) Cancer Res. 61, 3299–3307[Abstract/Free Full Text]
  12. Thimmulappa, R. K., Mai, K. H., Srisuma, S., Kensler, T. W., Yamamoto, M., and Biswal, S. (2002) Cancer Res. 62, 5196–5203[Abstract/Free Full Text]
  13. Nguyen, T., Sherratt, P. J., and Pickett, C. B. (2003) Annu. Rev. Pharmacol. Toxicol. 43, 233–260[CrossRef][Medline] [Order article via Infotrieve]
  14. Motohashi, H., O'Connor, T., Katsuoka, F., Engel, J. D., and Yamamoto, M. (2002) Gene (Amst.) 294, 1–12[CrossRef][Medline] [Order article via Infotrieve]
  15. Itoh, K., Chiba, T., Takahashi, S., Ishii, T., Igarashi, K., Katoh, Y., Oyake, T., Hayashi, N., Satoh, K., Hayatama, I., Yamamoto, M., and Nabeshima, Y.-I. (1997) Biochem. Biophys. Res. Commun. 236, 313–322[CrossRef][Medline] [Order article via Infotrieve]
  16. Chanas, S. A., Jiang, Q., McMahon, M., McWalter, G. K., McLellan, L. I., Elcombe, C. R., Henderson, C. J., Wolf, C. R., Moffat, G. J., Itoh, K., Yamamoto, M., and Hayes, J. D. (2002) Biochem. J. 365, 405–416[CrossRef][Medline] [Order article via Infotrieve]
  17. Kobayashi, M., Itoh, K., Suzuki, T., Osanai, H., Nishikawa, K., Katoh, Y., Takagi, Y., and Yamamoto, M. (2002) Genes Cells 7, 807–820[Abstract]
  18. Katoh, Y., Itoh, K., Yoshida, E., Miyagashi, M., Fukamizu, A., and Yamamoto, M. (2001) Genes Cells 6, 857–868[Abstract]
  19. Itoh, K., Wakabayashi, N., Katoh, Y., Ishii, T., Igarashi, K., Engel, J. D., and Yamamoto, M. (1999) Genes Dev. 13, 76–86[Abstract/Free Full Text]
  20. Dinkova-Kostova, A. T., Holtzclaw, W. D., Cole, R. N., Itoh, K., Wakabayashi, N., Katoh, Y., Yamamoto, M., and Talalay, P. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 11908–11913[Abstract/Free Full Text]
  21. Huang, H.-C., Nguyen, T., and Pickett, C. B. (2002) J. Biol. Chem. 277, 42769–42774[Abstract/Free Full Text]
  22. Kwak, M.-K., Itoh, K., Yamamoto, M., Sutter, T. R., and Kensler, T. W. (2001) Mol. Med. 7, 135–145[Medline] [Order article via Infotrieve]
  23. Kwak, M.-K., Itoh, K., Yamamoto, M., and Kensler, T. W. (2002) Mol. Cell. Biol. 22, 2883–2892[Abstract/Free Full Text]
  24. Nguyen, T., Sherratt, P. J., Huang, H.-C., Yang, C. S., and Pickett, C. B. (2003) J. Biol. Chem. 278, 4536–4541[Abstract/Free Full Text]
  25. Stewart, D., Killeen, E., Naquin, R., Alam, S., and Alam, J. (2003) J. Biol. Chem. 278, 2396–2402[Abstract/Free Full Text]
  26. Hershko, A., and Ciechanover, A. (1998) Annu. Rev. Biochem. 67, 425–479[CrossRef][Medline] [Order article via Infotrieve]
  27. Chan, K., Lu, R., Chang, J. C., and Kan, Y. W. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 13943–13948[Abstract/Free Full Text]
  28. Salghetti, S. E., Muratani, M., Wijnen, H., Futcher, B., and Tansey, W. P. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 3118–3123[Abstract/Free Full Text]
  29. Favreau, L. V., and Pickett, C. B. (1991) J. Biol. Chem. 266, 4556–4561[Abstract/Free Full Text]
  30. Treier, M., Staszewski, L., and Bohmann, D. (1994) Cell 78, 787–796[CrossRef][Medline] [Order article via Infotrieve]
  31. Moramitsu, Y., Nakagawa, Y., Hayashi, K., Fujii, H., Kumagai, T., Nakamura, Y., Osawa, T., Horio, F., Itoh, K., Iida, K., Yamamoto, M., and Uchida, K. (2002) J. Biol. Chem. 277, 3456–3463[Abstract/Free Full Text]
  32. Bonneson, C., Eggleston, I. M., and Hayes, J. D. (2001) Cancer Res. 61, 6120–6130[Abstract/Free Full Text]
  33. Prestera, T., Holtzclaw, W. D., Zhang, Y., and Talalay, P. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 2965–2969[Abstract/Free Full Text]
  34. Nguyen, T., Huang, H. C., and Pickett, C. B. (2000) J. Biol. Chem. 275, 15466–15473[Abstract/Free Full Text]
  35. Kirlin, W. G., Cai, J., Thompson, S. A., Diaz, D., Kavanagh, T. J., and Jones, D. P. (1999) Free Radic. Biol. Med. 27, 1208–1218[CrossRef][Medline] [Order article via Infotrieve]
  36. Ciechanover, A. (1998) EMBO J. 17, 7151–7160[CrossRef][Medline] [Order article via Infotrieve]
  37. Baumeister, W., Walz, J., Züll, F., and Seemüller, E. (1998) Cell 92, 367–380[CrossRef][Medline] [Order article via Infotrieve]
  38. Glickman, M. H., and Ciechanover, A. (2001) Physiol. Rev. 82, 373–428
  39. Sekhar, K. R., Soltaninassab, S. R., Borrelli, M. J., Xu, Z-Q., Meredith, M. J., Domann, F. E., and Freeman, M. L. (2000) Biochem. Biophys. Res. Commun. 270, 311–317[CrossRef][Medline] [Order article via Infotrieve]
  40. Pickart, C. M. (2000) Trends Biochem. Sci. 25, 544–548[CrossRef][Medline] [Order article via Infotrieve]
  41. Varshavsky, A. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 12142–12149[Abstract/Free Full Text]
  42. Lenk, U., and Sommer, T. (2000) J. Biol. Chem. 275, 39403–39410[Abstract/Free Full Text]
  43. Blondel, M., Galan, J-M., Chi, Y., Lafourcade, C., Longaretti, C., Deshaies, R. J., and Peter, M. (2000) EMBO J. 19, 6085–6097[CrossRef][Medline] [Order article via Infotrieve]
  44. Brooks, P., Fuertes, G., Murray, R. Z., Bose, S., Knecht, E., Rechsteiner, M. C., Hendil, K. B., Tanaka, K., Dyson, J., and Rivett, A. J. (2000) Biochem. J. 346, 155–161[CrossRef][Medline] [Order article via Infotrieve]
  45. De Conto, F., Pilotti, E., Razin, S. V., Ferraglia, F., Géraud, G., Arcangeletti, C., and Scherrer, K. (2000) J. Cell Sci. 113, 2399–2407[Abstract]
  46. Lafarga, M., Berciano, M. T., Pena, E., Mayo, I., Castaño, J. G., Bohmann, D., Rodrigues, J. P., Tavanez, J. P., and Carmo-Fonseca, M. (2002) Mol. Biol. Cell 13, 2771–2782[Abstract/Free Full Text]
  47. Adams, J. Kelso, R., and Cooley, L. (2000) Trends Cell Biol. 10, 17–24[CrossRef][Medline] [Order article via Infotrieve]
  48. Dhakshinamoorthy, S., and Jaiswal, A. (2001) Oncogene 20, 3906–3917[CrossRef][Medline] [Order article via Infotrieve]
  49. Zipper, L. M., and Mulcahy, R. T. (2002) J. Biol. Chem. 277, 36544–36552[Abstract/Free Full Text]
  50. Jäger, S., Strayle, J., Heinemeyer, W., and Wolf, D. H. (2001) EMBO J. 20, 4423–4431[CrossRef][Medline] [Order article via Infotrieve]
  51. Farber, E. (1984) Can. J. Biochem. Cell Biol. 62, 486–494[Medline] [Order article via Infotrieve]
  52. Hayes, J. D., and McLellan, L. I. (1999) Free Radic. Res. 31, 273–300[Medline] [Order article via Infotrieve]
  53. Sekhar, K. R., Yan, X. X., and Freeman, M. L. (2002) Oncogene 21, 6829–6834[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Rheumatology (Oxford)Home page
H. Ah Kim, Y. Yeo, W.-U. Kim, and S. Kim
Phase 2 enzyme inducer sulphoraphane blocks matrix metalloproteinase production in articular chondrocytes
Rheumatology, August 1, 2009; 48(8): 932 - 938.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
H. Dreger, K. Westphal, A. Weller, G. Baumann, V. Stangl, S. Meiners, and K. Stangl
Nrf2-dependent upregulation of antioxidative enzymes: a novel pathway for proteasome inhibitor-mediated cardioprotection
Cardiovasc Res, July 15, 2009; 83(2): 354 - 361.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
Z. Sun, Y. E. Chin, and D. D. Zhang
Acetylation of Nrf2 by p300/CBP Augments Promoter-Specific DNA Binding of Nrf2 during the Antioxidant Response
Mol. Cell. Biol., May 15, 2009; 29(10): 2658 - 2672.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Nguyen, P. Nioi, and C. B. Pickett
The Nrf2-Antioxidant Response Element Signaling Pathway and Its Activation by Oxidative Stress
J. Biol. Chem., May 15, 2009; 284(20): 13291 - 13295.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
S. A. Reisman, I. L. Csanaky, L. M. Aleksunes, and C. D. Klaassen
Altered Disposition of Acetaminophen in Nrf2-null and Keap1-knockdown Mice
Toxicol. Sci., May 1, 2009; 109(1): 31 - 40.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. M. Cummings, C. A. Bentley, S. A. Perdue, P. W. Baas, and J. D. Singer
The Cul3/Klhdc5 E3 Ligase Regulates p60/Katanin and Is Required for Normal Mitosis in Mammalian Cells
J. Biol. Chem., April 24, 2009; 284(17): 11663 - 11675.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
S. A. Reisman, R. L. Yeager, M. Yamamoto, and C. D. Klaassen
Increased Nrf2 Activation in Livers from Keap1-Knockdown Mice Increases Expression of Cytoprotective Genes that Detoxify Electrophiles more than those that Detoxify Reactive Oxygen Species
Toxicol. Sci., March 1, 2009; 108(1): 35 - 47.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Zhang, A. Kobayashi, M. Yamamoto, and J. D. Hayes
The Nrf3 Transcription Factor Is a Membrane-bound Glycoprotein Targeted to the Endoplasmic Reticulum through Its N-terminal Homology Box 1 Sequence
J. Biol. Chem., January 30, 2009; 284(5): 3195 - 3210.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
M. Suzuki, T. Betsuyaku, Y. Ito, K. Nagai, Y. Nasuhara, K. Kaga, S. Kondo, and M. Nishimura
Down-Regulated NF-E2-Related Factor 2 in Pulmonary Macrophages of Aged Smokers and Patients with Chronic Obstructive Pulmonary Disease
Am. J. Respir. Cell Mol. Biol., December 1, 2008; 39(6): 673 - 682.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. A. Rushworth, D. J. MacEwan, and M. A. O'Connell
Lipopolysaccharide-Induced Expression of NAD(P)H:Quinone Oxidoreductase 1 and Heme Oxygenase-1 Protects against Excessive Inflammatory Responses in Human Monocytes
J. Immunol., November 15, 2008; 181(10): 6730 - 6737.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. F. Reichard, M. A. Sartor, and A. Puga
BACH1 Is a Specific Repressor of HMOX1 That Is Inactivated by Arsenite
J. Biol. Chem., August 15, 2008; 283(33): 22363 - 22370.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
M. B. Sibhatu, P. K. Smitherman, A. J. Townsend, and C. S. Morrow
Expression of MRP1 and GSTP1-1 modulate the acute cellular response to treatment with the chemopreventive isothiocyanate, sulforaphane
Carcinogenesis, April 1, 2008; 29(4): 807 - 815.
[Abstract] [Full Text] [PDF]


Home page
Toxicol PatholHome page
K. Kanki, T. Umemura, Y. Kitamura, Y. Ishii, Y. Kuroiwa, Y. Kodama, K. Itoh, M. Yamamoto, A. Nishikawa, and M. Hirose
A Possible Role of Nrf2 in Prevention of Renal Oxidative Damage by Ferric Nitrilotriacetate
Toxicol Pathol, February 1, 2008; 36(2): 353 - 361.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
J. F. Reichard, G. T. Motz, and A. Puga
Heme oxygenase-1 induction by NRF2 requires inactivation of the transcriptional repressor BACH1
Nucleic Acids Res., December 18, 2007; 35(21): 7074 - 7086.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
O.-H. Lee, A. K. Jain, V. Papusha, and A. K. Jaiswal
An Auto-regulatory Loop between Stress Sensors INrf2 and Nrf2 Controls Their Cellular Abundance
J. Biol. Chem., December 14, 2007; 282(50): 36412 - 36420.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
X. J. Wang, J. D. Hayes, C. J. Henderson, and C. R. Wolf
Identification of retinoic acid as an inhibitor of transcription factor Nrf2 through activation of retinoic acid receptor alpha
PNAS, December 4, 2007; 104(49): 19589 - 19594.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
Y. Zenke-Kawasaki, Y. Dohi, Y. Katoh, T. Ikura, M. Ikura, T. Asahara, F. Tokunaga, K. Iwai, and K. Igarashi
Heme Induces Ubiquitination and Degradation of the Transcription Factor Bach1
Mol. Cell. Biol., October 1, 2007; 27(19): 6962 - 6971.
[Abstract] [Full Text] [PDF]


Home page
GENES CELLSHome page
Y. Watai, A. Kobayashi, H. Nagase, M. Mizukami, J. McEvoy, J. D. Singer, K. Itoh, and M. Yamamoto
Subcellular localization and cytoplasmic complex status of endogenous Keap1
Genes Cells, October 1, 2007; 12(10): 1163 - 1178.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
J. Zhao, A. N. Moore, J. B. Redell, and P. K. Dash
Enhancing Expression of Nrf2-Driven Genes Protects the Blood Brain Barrier after Brain Injury
J. Neurosci., September 19, 2007; 27(38): 10240 - 10248.
[Abstract] [Full Text] [PDF]


Home page
Toxicol PatholHome page
L. M. Aleksunes and J. E. Manautou
Emerging Role of Nrf2 in Protecting Against Hepatic and Gastrointestinal Disease
Toxicol Pathol, June 1, 2007; 35(4): 459 - 473.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
A. F. Hubbs, S. A. Benkovic, D. B. Miller, J. P. O'Callaghan, L. Battelli, D. Schwegler-Berry, and Q. Ma
Vacuolar Leukoencephalopathy with Widespread Astrogliosis in Mice Lacking Transcription Factor Nrf2
Am. J. Pathol., June 1, 2007; 170(6): 2068 - 2076.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M.-F. Yueh and R. H. Tukey
Nrf2-Keap1 Signaling Pathway Regulates Human UGT1A1 Expression in Vitro and in Transgenic UGT1 Mice
J. Biol. Chem., March 23, 2007; 282(12): 8749 - 8758.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Gao, J. Wang, K. R. Sekhar, H. Yin, N. F. Yared, S. N. Schneider, S. Sasi, T. P. Dalton, M. E. Anderson, J. Y. Chan, et al.
Novel n-3 Fatty Acid Oxidation Products Activate Nrf2 by Destabilizing the Association between Keap1 and Cullin3
J. Biol. Chem., January 26, 2007; 282(4): 2529 - 2537.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Aberg, M. Perander, B. Johansen, C. Julien, S. Meloche, S. M. Keyse, and O.-M. Seternes
Regulation of MAPK-activated Protein Kinase 5 Activity and Subcellular Localization by the Atypical MAPK ERK4/MAPK4
J. Biol. Chem., November 17, 2006; 281(46): 35499 - 35510.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
X. J. Wang, J. D. Hayes, and C. R. Wolf
Generation of a Stable Antioxidant Response Element-Driven Reporter Gene Cell Line and Its Use to Show Redox-Dependent Activation of Nrf2 by Cancer Chemotherapeutic Agents.
Cancer Res., November 15, 2006; 66(22): 10983 - 10994.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
C. M. Clements, R. S. McNally, B. J. Conti, T. W. Mak, and J. P.-Y. Ting
DJ-1, a cancer- and Parkinson's disease-associated protein, stabilizes the antioxidant transcriptional master regulator Nrf2
PNAS, October 10, 2006; 103(41): 15091 - 15096.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. Yu, P. A. Egner, J. Wakabayashi, N. Wakabayashi, M. Yamamoto, and T. W. Kensler
Nrf2-mediated Induction of Cytoprotective Enzymes by 15-Deoxy-{Delta}12,14-Prostaglandin J2 Is Attenuated by Alkenal/one Oxidoreductase
J. Biol. Chem., September 8, 2006; 281(36): 26245 - 26252.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. McMahon, N. Thomas, K. Itoh, M. Yamamoto, and J. D. Hayes
Dimerization of Substrate Adaptors Can Facilitate Cullin-mediated Ubiquitylation of Proteins by a "Tethering" Mechanism: A TWO-SITE INTERACTION MODEL FOR THE Nrf2-Keap1 COMPLEX
J. Biol. Chem., August 25, 2006; 281(34): 24756 - 24768.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. Wang and J. Y. Chan
Nrf1 Is Targeted to the Endoplasmic Reticulum Membrane by an N-terminal Transmembrane Domain: INHIBITION OF NUCLEAR TRANSLOCATION AND TRANSACTING FUNCTION
J. Biol. Chem., July 14, 2006; 281(28): 19676 - 19687.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Biol.Home page
C. Goldring, N. Kitteringham, R. Jenkins, I. Copple, J.-F. Jeannin, and B. K. Park
Plasticity in cell defence: access to and reactivity of critical protein residues and DNA response elements
J. Exp. Biol., June 15, 2006; 209(12): 2337 - 2343.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Salazar, A. I. Rojo, D. Velasco, R. M. de Sagarra, and A. Cuadrado
Glycogen Synthase Kinase-3beta Inhibits the Xenobiotic and Antioxidant Cell Response by Direct Phosphorylation and Nuclear Exclusion of the Transcription Factor Nrf2
J. Biol. Chem., May 26, 2006; 281(21): 14841 - 14851.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
S. W. Ryter, J. Alam, and A. M. K. Choi
Heme Oxygenase-1/Carbon Monoxide: From Basic Science to Therapeutic Applications
Physiol Rev, April 1, 2006; 86(2): 583 - 650.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. Kobayashi, M.-I. Kang, Y. Watai, K. I. Tong, T. Shibata, K. Uchida, and M. Yamamoto
Oxidative and Electrophilic Stresses Activate Nrf2 through Inhibition of Ubiquitination Activity of Keap1
Mol. Cell. Biol., January 1, 2006; 26(1): 221 - 229.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
P. Nioi, T. Nguyen, P. J. Sherratt, and C. B. Pickett
The Carboxy-Terminal Neh3 Domain of Nrf2 Is Required for Transcriptional Activation
Mol. Cell. Biol., December 15, 2005; 25(24): 10895 - 10906.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Ishii, K. Itoh, Y. Morishima, T. Kimura, T. Kiwamoto, T. IIzuka, A. E. Hegab, T. Hosoya, A. Nomura, T. Sakamoto, et al.
Transcription Factor Nrf2 Plays a Pivotal Role in Protection against Elastase-Induced Pulmonary Inflammation and Emphysema
J. Immunol., November 15, 2005; 175(10): 6968 - 6975.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Nguyen, P. J. Sherratt, P. Nioi, C. S. Yang, and C. B. Pickett
Nrf2 Controls Constitutive and Inducible Expression of ARE-driven Genes through a Dynamic Pathway Involving Nucleocytoplasmic Shuttling by Keap1
J. Biol. Chem., September 16, 2005; 280(37): 32485 - 32492.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
F. Katsuoka, H. Motohashi, T. Ishii, H. Aburatani, J. D. Engel, and M. Yamamoto
Genetic Evidence that Small Maf Proteins Are Essential for the Activation of Antioxidant Response Element-Dependent Genes
Mol. Cell. Biol., September 15, 2005; 25(18): 8044 - 8051.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H.-J. Kim and A. E. Nel
The Role of Phase II Antioxidant Enzymes in Protecting Memory T Cells from Spontaneous Apoptosis in Young and Old Mice
J. Immunol., September 1, 2005; 175(5): 2948 - 2959.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. Li, M. R. Jain, C. Chen, X. Yue, V. Hebbar, R. Zhou, and A.-N. T. Kong
Nrf2 Possesses a Redox-insensitive Nuclear Export Signal Overlapping with the Leucine Zipper Motif
J. Biol. Chem., August 5, 2005; 280(31): 28430 - 28438.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
M. Traka, A. V. Gasper, J. A. Smith, C. J. Hawkey, Y. Bao, and R. F. Mithen
Transcriptome Analysis of Human Colon Caco-2 Cells Exposed to Sulforaphane
J. Nutr., August 1, 2005; 135(8): 1865 - 1872.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. L. Eggler, G. Liu, J. M. Pezzuto, R. B. van Breemen, and A. D. Mesecar
Modifying specific cysteines of the electrophile-sensing human Keap1 protein is insufficient to disrupt binding to the Nrf2 domain Neh2
PNAS, July 19, 2005; 102(29): 10070 - 10075.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Usami, Y. Kusano, T. Kumagai, S. Osada, K. Itoh, A. Kobayashi, M. Yamamoto, and K. Uchida
Selective Induction of the Tumor Marker Glutathione S-Transferase P1 by Proteasome Inhibitors
J. Biol. Chem., July 1, 2005; 280(26): 25267 - 25276.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Y. Shih, S. Imbeault, V. Barakauskas, H. Erb, L. Jiang, P. Li, and T. H. Murphy
Induction of the Nrf2-driven Antioxidant Response Confers Neuroprotection during Mitochondrial Stress in Vivo
J. Biol. Chem., June 17, 2005; 280(24): 22925 - 22936.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. Velichkova and T. Hasson
Keap1 Regulates the Oxidation-Sensitive Shuttling of Nrf2 into and out of the Nucleus via a Crm1-Dependent Nuclear Export Mechanism
Mol. Cell. Biol., June 1, 2005; 25(11): 4501 - 4513.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. Miao, L. Hu, P. J. Scrivens, and G. Batist
Transcriptional Regulation of NF-E2 p45-related Factor (NRF2) Expression by the Aryl Hydrocarbon Receptor-Xenobiotic Response Element Signaling Pathway: DIRECT CROSS-TALK BETWEEN PHASE I AND II DRUG-METABOLIZING ENZYMES
J. Biol. Chem., May 27, 2005; 280(21): 20340 - 20348.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
T. W. P. Devling, C. D. Lindsay, L. I. McLellan, M. McMahon, and J. D. Hayes
Utility of siRNA against Keap1 as a strategy to stimulate a cancer chemopreventive phenotype
PNAS, May 17, 2005; 102(20): 7280 - 7285.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
R. N. Karapetian, A. G. Evstafieva, I. S. Abaeva, N. V. Chichkova, G. S. Filonov, Y. P. Rubtsov, E. A. Sukhacheva, S. V. Melnikov, U. Schneider, E. E. Wanker, et al.
Nuclear Oncoprotein Prothymosin {alpha} Is a Partner of Keap1: Implications for Expression of Oxidative Stress-Protecting Genes
Mol. Cell. Biol., February 1, 2005; 25(3): 1089 - 1099.
[Abstract] [Full Text] [PDF]


Home page
Arch NeurolHome page
H. M. Fathallah-Shaykh
Genomic Discovery Reveals a Molecular System for Resistance to Oxidative and Endoplasmic Reticulum Stress in Cultured Glioma
Arch Neurol, February 1, 2005; 62(2): 233 - 236.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
J. Li, D. Johnson, M. Calkins, L. Wright, C. Svendsen, and J. Johnson
Stabilization of Nrf2 by tBHQ Confers Protection against Oxidative Stress-Induced Cell Death in Human Neural Stem Cells
Toxicol. Sci., February 1, 2005; 83(2): 313 - 328.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
S. Bandiera, S. Weidlich, V. Harth, P. Broede, Y. Ko, and T. Friedberg
Proteasomal Degradation of Human CYP1B1: Effect of the Asn453Ser Polymorphism on the Post-Translational Regulation of CYP1B1 Expression
Mol. Pharmacol., February 1, 2005; 67(2): 435 - 443.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. Furukawa and Y. Xiong
BTB Protein Keap1 Targets Antioxidant Transcription Factor Nrf2 for Ubiquitination by the Cullin 3-Roc1 Ligase
Mol. Cell. Biol., January 1, 2005; 25(1): 162 - 171.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
D. D. Zhang, S.-C. Lo, J. V. Cross, D. J. Templeton, and M. Hannink
Keap1 Is a Redox-Regulated Substrate Adaptor Protein for a Cul3-Dependent Ubiquitin Ligase Complex
Mol. Cell. Biol., December 15, 2004; 24(24): 10941 - 10953.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
G. K. McWalter, L. G. Higgins, L. I. McLellan, C. J. Henderson, L. Song, P. J. Thornalley, K. Itoh, M. Yamamoto, and J. D. Hayes
Transcription Factor Nrf2 Is Essential for Induction of NAD(P)H:Quinone Oxidoreductase 1, Glutathione S-Transferases, and Glutamate Cysteine Ligase by Broccoli Seeds and Isothiocyanates
J. Nutr., December 1, 2004; 134(12): 3499S - 3506S.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
W. Qiang, J. M. Cahill, J. Liu, X. Kuang, N. Liu, V. L. Scofield, J. R. Voorhees, A. J. Reid, M. Yan, W. S. Lynn, et al.
Activation of Transcription Factor Nrf-2 and Its Downstream Targets in Response to Moloney Murine Leukemia Virus ts1-Induced Thiol Depletion and Oxidative Stress in Astrocytes
J. Virol., November 1, 2004; 78(21): 11926 - 11938.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
S. B. Cullinan, J. D. Gordan, J. Jin, J. W. Harper, and J. A. Diehl
The Keap1-BTB Protein Is an Adaptor That Bridges Nrf2 to a Cul3-Based E3 Ligase: Oxidative Stress Sensing by a Cul3-Keap1 Ligase
Mol. Cell. Biol., October 1, 2004; 24(19): 8477 - 8486.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Karlsson, J. Mathers, R. J. Dickinson, M. Mandl, and S. M. Keyse
Both Nuclear-Cytoplasmic Shuttling of the Dual Specificity Phosphatase MKP-3 and Its Ability to Anchor MAP Kinase in the Cytoplasm Are Mediated by a Conserved Nuclear Export Signal
J. Biol. Chem., October 1, 2004; 279(40): 41882 - 41891.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. Li, J. Alam, M. I. Venkatesan, A. Eiguren-Fernandez, D. Schmitz, E. Di Stefano, N. Slaughter, E. Killeen, X. Wang, A. Huang, et al.
Nrf2 Is a Key Transcription Factor That Regulates Antioxidant Defense in Macrophages and Epithelial Cells: Protecting against the Proinflammatory and Oxidizing Effects of Diesel Exhaust Chemicals
J. Immunol., September 1, 2004; 173(5): 3467 - 3481.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
V. Svehlikova, S. Wang, J. Jakubikova, G. Williamson, R. Mithen, and Y. Bao
Interactions between sulforaphane and apigenin in the induction of UGT1A1 and GSTA1 in CaCo-2 cells
Carcinogenesis, September 1, 2004; 25(9): 1629 - 1637.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. Kobayashi, M.-I. Kang, H. Okawa, M. Ohtsuji, Y. Zenke, T. Chiba, K. Igarashi, and M. Yamamoto
Oxidative Stress Sensor Keap1 Functions as an Adaptor for Cul3-Based E3 Ligase To Regulate Proteasomal Degradation of Nrf2
Mol. Cell. Biol., August 15, 2004; 24(16): 7130 - 7139.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
B. Li, X. Wang, N. Rasheed, Y. Hu, S. Boast, T. Ishii, K. Nakayama, K. I. Nakayama, and S. P. Goff
Distinct roles of c-Abl and Atm in oxidative stress response are mediated by protein kinase C {delta}
Genes & Dev., August 1, 2004; 18(15): 1824 - 1837.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. McMahon, N. Thomas, K. Itoh, M. Yamamoto, and J. D. Hayes
Redox-regulated Turnover of Nrf2 Is Determined by at Least Two Separate Protein Domains, the Redox-sensitive Neh2 Degron and the Redox-insensitive Neh6 Degron
J. Biol. Chem., July 23, 2004; 279(30): 31556 - 31567.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
Y. Zhang and G. B. Gordon
A strategy for cancer prevention: Stimulation of the Nrf2-ARE signaling pathway
Mol. Cancer Ther., July 1, 2004; 3(7): 885 - 893.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. Shen, V. Hebbar, S. Nair, C. Xu, W. Li, W. Lin, Y.-S. Keum, J. Han, M. A. Gallo, and A.-N. T. Kong
Regulation of Nrf2 Transactivation Domain Activity: THE DIFFERENTIAL EFFECTS OF MITOGEN-ACTIVATED PROTEIN KINASE CASCADES AND SYNERGISTIC STIMULATORY EFFECT OF Raf AND CREB-BINDING PROTEIN
J. Biol. Chem., May 28, 2004; 279(22): 23052 - 23060.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H. Motohashi, F. Katsuoka, J. D. Engel, and M. Yamamoto
Small Maf proteins serve as transcriptional cofactors for keratinocyte differentiation in the Keap1-Nrf2 regulatory pathway
PNAS, April 27, 2004; 101(17): 6379 - 6384.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Martin, A. I. Rojo, M. Salinas, R. Diaz, G. Gallardo, J. Alam, C. M. R. de Galarreta, and A. Cuadrado
Regulation of Heme Oxygenase-1 Expression through the Phosphatidylinositol 3-Kinase/Akt Pathway and the Nrf2 Transcription Factor in Response to the Antioxidant Phytochemical Carnosol
J. Biol. Chem., March 5, 2004; 279(10): 8919 - 8929.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
N. Wakabayashi, A. T. Dinkova-Kostova, W. D. Holtzclaw, M.-I. Kang, A. Kobayashi, M. Yamamoto, T. W. Kensler, and P. Talalay
Protection against electrophile and oxidant stress by induction of the phase 2 response: Fate of cysteines of the Keap1 sensor modified by inducers
PNAS, February 17, 2004; 101(7): 2040 - 2045.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M.-I. Kang, A. Kobayashi, N. Wakabayashi, S.-G. Kim, and M. Yamamoto
Scaffolding of Keap1 to the actin cytoskeleton controls the function of Nrf2 as key regulator of cytoprotective phase 2 genes
PNAS, February 17, 2004; 101(7): 2046 - 2051.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
D. D. Zhang and M. Hannink
Distinct Cysteine Residues in Keap1 Are Required for Keap1-Dependent Ubiquitination of Nrf2 and for Stabilization of Nrf2 by Chemopreventive Agents and Oxidative Stress
Mol. Cell. Biol., November 15, 2003; 23(22): 8137 - 8151.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
I. R. Jowsey, Q. Jiang, K. Itoh, M. Yamamoto, and J. D. Hayes
Expression of the Aflatoxin B1-8,9-Epoxide-Metabolizing Murine Glutathione S-Transferase A3 Subunit Is Regulated by the Nrf2 Transcription Factor through an Antioxidant Response Element
Mol. Pharmacol., November 1, 2003; 64(5): 1018 - 1028.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/24/21592    most recent
M300931200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by McMahon, M.
Right arrow Articles by Hayes, J. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by McMahon, M.
Right arrow Articles by Hayes, J. D.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement