HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 278, Issue 24, 21715-21720, June 13, 2003

This Article Abstract Full Text (PDF) Data Supplement All Versions of this Article: 278/24/21715    most recent M302484200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Ögrünç, M. Articles by Sancar, A. Search for Related Content PubMed PubMed Citation Articles by Ögrünç, M. Articles by Sancar, A. Social Bookmarking                      What's this?

Identification and Characterization of Human MUS81-MMS4 Structure-specific Endonuclease^*,

Müge Örünç and Aziz Sancar 

From the Department of Biochemistry and Biophysics, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, 27599-7260

Received for publication, March 11, 2003 , and in revised form, April 8, 2003.

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Replication forks may stall when they reach a block on the DNA template such as DNA damage, and the recovery of such stalled replication forks plays a crucial role in the maintenance of genomic stability. Holliday junctions, which are X-shaped DNA structures, are formed at the stalled replication forks and can accumulate if they are not cleaved by structure-specific endonucleases. Recently, a novel nuclease involved in resolving Holliday junction-like structures, Mus81, has been reported in yeast and humans. MUS81 has sequence homology to another DNA nuclease, XPF, which, with its partner ERCC1, makes the 5 ' incision during nucleotide excision repair. MUS81 also has a binding partner named Mms4 in Saccharomyces cerevisiae and Eme1 in Schizosaccharomyces pombe, but no such partner was identified in human cells. Here, we report identification of the binding partner of human MUS81, which we designate hMMS4. Using immunoaffinity purification we show that hMUS81 or hMMS4 alone have no detectable nuclease activity, but that the hMUS81 ·hMMS4 complex is a structure-specific nuclease that is capable of resolving fork structures.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
It is important for any dividing cell to ensure the integrity and fidelity of the genome. To accomplish this goal, all cellular events have to be processed orderly and properly. Checkpoint pathways monitor the sequence of these cellular processes as well as the quality of these biochemical events (1, 2). The DNA replication, or S phase, checkpoint is one of the checkpoint pathways that helps to maintain the fidelity of cell division by monitoring the completion of the DNA replication. The S phase checkpoint ensures the re-assembly and recovery of broken replication forks and ensures activation of replication origins in an orderly manner. Replication forks may stall when they reach a replication block, for example a DNA damage, or when the nucleotide pools are insufficient for elongation (3, 4). A broken replication fork leads to specific DNA structures including Holliday junctions. In response to DNA damage or DNA replication blocks, both checkpoint and recombinational DNA repair pathways are activated to resolve the Holliday junction-like structures and promote fork re-assembly (5, 6).

Much of our current understanding about the checkpoint control pathways is drawn from studies in budding and fission yeast. Despite some differences between yeast and mammalian cells, the major components of this protein network appear to be the same. Mus81 was initially identified by two independent yeast-two hybrid screens with S. cerevisiae Rad54 (7) and S. pombe Cds1 (homolog of human Chk2) (8) used as bait. Chk2, defined as a transducer protein in the checkpoint signal transduction pathway, is a Ser/Thr protein kinase (9, 10, 11, 12). Incomplete replication is monitored by checkpoint damage sensor proteins, which either activate Chk2 and ensure a reversible S phase arrest or activate both Chk1 and Chk2 to establish a G₂/M arrest (13). Studies in yeast indicate that Rad53, budding yeast homolog of Chk2, is required for the stalled replication fork recovery (14). Current models suggest that the S phase checkpoint activates the recombinational repair machinery instead of indirectly allowing repair by inhibiting replication (6). Rad54, a double-stranded DNA-dependent ATPase, works together with the Rad52 epistatic group proteins in the recombinational repair of double-strand DNA breaks (15). The properties of these two Mus81-interacting proteins, Chk2 and Rad54, strongly suggest that MUS81 plays a role in the S phase recovery pathway.

MUS81 has high homology to the XPF family of nucleases (16, 17, 18). The XPF protein forms a stable heterodimer with its binding partner, ERCC1, and this complex is required for the 5' nuclease activity during nucleotide excision repair (19, 20). A Mus81 binding partner has been reported in both budding and fission yeast as Mms4 and Eme1, respectively (21, 22). These complexes are capable of resolving a variety of fork structures that may arise during replication fork arrest or recombination, including Holliday structures (23).

Human MUS81 was previously identified, and partially purified hMUS81 was shown to cleave fork structures (24, 25). There were no biochemical data that the human MUS81 preparation contained hMMS4, and standard data base searches failed to reveal a human ortholog (24, 25). Here we have used bioinformatics approaches to identify a human ortholog of Mms4/Eme1. Furthermore, we show that although hMUS81 has no nuclease activity on its own, the protein, which we designate hMMS4, forms a heterodimer with hMUS81, and this hMUS81-hMMS4 heterodimer has a structure-specific endonuclease activity. We conclude that the newly identified human protein is a functional homolog of yeast Mms4/Eme1, which confers specific endonuclease activity to hMUS81.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
DNA Constructs—hMUS81/pCR2.1 was kindly provided by JANSSEN Research Foundation, Beerse, Belgium (24). pcDNA4-FLAG-hMUS81-His was constructed using a N-terminal PCR primer that has FLAG sequence and C-terminal myc-His tags were obtained from the sequence within the pcDNA4 vector (Invitrogen) backbone. The hMUS81 cDNA was amplified with Pfu Turbo enzyme (Stratagene) from this plasmid by using primers 5'-GCAACAGGATCCAGCCACCATGGACTACAAGGACGACGATGACAAG GCGGCCCGGTCG-3' and 5'-CTAGCTCGAGGGTCAAGGGGCCGTAGCTGCA-3'. The PCR product was digested with BamHI and XhoI and inserted into pcDNA4/myc-HisA vector (Invitrogen).

The results of PSI-PHI BLAST and 3D-PSSM (three-dimensional position-specific scoring matrix) searches using SpEme1 and ScMms4 sequences against the human genome data base showed that the IMAGE clone MGC: 9497 was a statistically significant candidate. The open reading frame of the putative human MMS4 gene was amplified from pCMV.SPORT6-MMS4 plasmid (Invitrogen), which contains the IMAGE clone MGC: 9497, using primers 5'-GCAACAAAGCTTAGCCACCATGTACCCATACGACGTCCCAGACTACGCTGCTCTAAAGACATCACCCTCACTG-3' and 5'-CTTTAGCCGCTCGAGTTAATGATGATGATGATGATGGTCAGCA CTATCTAAAG-3'. The PCR product was digested with HindIII and XhoI enzymes and then inserted into pcDNA4/myc-HisA vector to obtain the N-terminal HA¹-tagged and C-terminal His-tagged hMMS4 expression vector pcDNA4-HA-hMMS4-His. Both the N- and C-terminal tags were obtained from the PCR primers. The C-terminal primer encodes for a His tag and a stop codon at the end. PCR-generated sequences were verified by DNA sequencing (University of North Carolina at Chapel Hill DNA Sequencing Facility). The control plasmid used for immunoprecipitation experiments, FLAG-hCRY1-myc/His, has been described previously (26).

DNA Substrates—DNA substrates were prepared from HPLC-purified 50-mer DNA oligos (OPERON Technologies) as Oligo 1, 5'-GACGCTGCCGAATTCTGGCTTGCTAGGACATCTTTGCCCACGTTGACCCG-3'; Oligo 2, 5'-GCGATAGTCTCTAGACAGCATGTCCTAGCAAGCCAGAATTCGGCA GCGTC-3'; and Oligo 3, CGGGTCAACGTGGGCAAAGATGTCCTAG CAAGCCAGAATTCGGCAGCGTC. The underlined nucleotides in Oligo 2 are complementary to those in the Oligo 1. The single-stranded DNA was made by labeling and purifying Oligo 1. The double-stranded DNA was made by annealing labeled Oligo 1 with Oligo 3. The Y structure was made by annealing Oligo 1 with Oligo 2. Oligo1 (1 pmol) was labeled at the 5' terminus using 1 mCi [-³²P]ATP (ICN, 7000 Ci/mmol) and T4 polynucleotide kinase (New England Biolabs). Following kinase inactivation, the labeled Oligo 1 was gel-purified on 10% denaturing gel and annealed with an excess of cold Oligo 4. Then, double-stranded 50-mers were gel-purified from a 5% non-denaturing polyacrylamide gel.

Cell Culture, Expression of Recombinant Proteins, and Immunoprecipitation—The SV40-transformed human embryonic kidney 293 (293T) cells were maintained in Dulbecco's modified Eagle's medium with high glucose (Invitrogen) supplemented with 10% fetal bovine serum and 100 units of penicillin and streptomycin/ml. 4 x 10⁶ 293T cells were plated on 150 cm² plates 1 day prior to transfection. Cells were transfected with either pcDNA4-FLAG-hMUS81-His or pcDNA4-HA-hMMS4-His mammalian expressions vectors or both of these vectors (15 µg plasmid DNA each) using the calcium-phosphate precipitation protocol (27). After 10 h of incubation at 37 °C in 5% CO₂, fresh medium was added to the cells, and incubation was continued for a further 36–48 h. Cells were washed once with cold phosphate-buffered saline and then were harvested and pelleted. The pellet was lysed using lysis buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 10 mM -glycerophosphate, 10% glycerol, 1% Tween 20, 0.1% Nonidet P-40, 1 mM Na₃VO₄, 1 mM NaF, and EDTA-free protease inhibitors (Roche Molecular Biochemicals)) for 20 min. The cell lysates were centrifuged and the supernatant was bound to 15 µl of washed and activated either HA (Roche Applied Science) or FLAG (Sigma) resin. The resin was washed and activated prior to use according to the manufacturer's protocol. The lysates were incubated with the beads rocking at 4 C° for 6–10 h. Then, the beads were washed three times with 1 ml of lysis buffer and three times with 1 ml of nuclease buffer, which is described below. The immunoprecipitates were analyzed on 10% SDS-polyacrylamide gels. Western blots were performed by transferring proteins to Highbond ECL nitrocellulose papers (Amersham Biosciences) using a semi-dry electroblotter. For immunoblotting, His (sc-803)-purified rabbit polyclonal antibody (Santa Cruz Biotechnology) was used followed by antirabbit secondary antibody (Promega) and alkaline phosphotase color development assay (Promega).

Endonuclease Assay—The endonuclase assay was performed using hMUS81, hMMS4, or hMUS81-hMMS4 immunoprecipitates. After washing FLAG and HA immunoprecipitates three times with lysis buffer followed by three times with nuclease buffer (50 mM Tris-HCl, pH 7.5, 100 µg/ml bovine serum albumin, 1 mM -mercaptoethanol, 2.5 mM MgCl₂) (24), and they were incubated with radio-labeled Y structure DNA substrate (1 nM) in 30 µl reaction volume for 1 h at 30 °C, unless otherwise indicated. The reaction was stopped by the addition of 10 µg proteinase K (Roche Applied Science) plus 10% SDS with incubation at 37 °C for 20 min, followed by phenol-chloroform extraction and ethanol precipitation. The products were analyzed on denaturing 10% polyacrylamide gels, and the level of incision was quantified by Phosphor-Imager (Amersham Biosciences) using ImageQuant software.

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Identification of a Putative Human Mms4/Eme1 Partner of hMUS81 by Bioinformatic Approaches—There is limited amino acid sequence homology between the two MMS4 homologs in budding and fission yeast (Fig. 1), and standard search methods did not uncover any obvious human homolog of either one. Therefore, we decided to use more advanced bioinformatic tools that are based on comparison searches of three-dimensional structures, such as PSI-PHI BLAST, to identify the human homolog. After performing five iterated profile searches of human data base using the query sequence fission yeast Eme1, we found that IMAGE clone MGC: 9497, had an e-value better than threshold in several consecutive rounds (Supplemental Table I). To further confirm this, we also performed a 3D-PSSM search, which scans the secondary structure prediction of query sequence fission yeast Eme1 against a representative secondary structure fold library. One of the highest scoring structural matches was again the human IMAGE clone MGC: 9497, with 17.9%, whereas the budding yeast homolog scored 18.7% against the fission yeast. We concentrated our efforts on IMAGE clone MGC: 9497 and not the clone BAB71047 [GenBank] .1, which also has high scores (Supplemental Table I), because despite a high degree of sequence identity of the two clones, BAB71047 [GenBank] .1 has a deletion of 13 amino acids in the middle of the open reading frame. Therefore, we decided to determine whether the MGC: 9497 encoded protein possessed Mms4/Eme1-like function. For simplicity, we will refer to the IMAGE clone MGC: 9497 as hMMS4. The gene encodes a protein of 583 amino acids with no obvious sequence motifs.

View larger version (71K): [in this window] [in a new window]   FIG. 1. Sequence alignment of MUS81 binding partner proteins. Primary sequence alignment of three homologs of MMS4 proteins in S. cerevisiae (ScMms4), S. pombe (SpEme1), and human protein (hMMS4) was done with JellyFish software (30).

MUS81 Binds to MMS4 Specifically to Form a Complex— The first step in ascertaining whether MMS4 encodes the human binding partner of MUS81 was to express both MUS81 and MMS4 proteins in mammalian cells to determine whether they interact. Human 293T cells were transfected both with FLAG-MUS81-His and HA-MMS4-His vectors alone and together. After transfection of 293T cells, cell lysates were prepared and Western blotting was performed using His antibodies. In Fig. 2, lanes 1–4 show cell lysates and expression levels of each protein, and lanes 5–8 show the results of the immunoprecipitation using FLAG beads. Although HA-MMS4-His was expressed at the same levels in both lanes 2 and 3, only in lane 7 were both hMMS4 and hMUS81 proteins present, indicating that hMMS4 interacts with the FLAG-MUS81 protein but not with the negative control FLAG-CRY1 in lane 6. These results were confirmed by performing the reciprocal immunoprecipitation assay. Immunoprecipitation of hMMS4 pulled down hMUS81 showing that the interaction we detected is specific (Fig. 3A). In lanes 1–3 cell lysates were immunoprecipitated using HA resin and in lanes 4–6 they were immunoprecipitated with FLAG resin. Lanes 2 and 4 were used as negative controls for nuclease assay using HA and FLAG resins, respectively. In lanes 1 and 5, HA-MMS4 and FLAG-MUS81 proteins were expressed and immunoprecipitated on their own. In lanes 3 and 6, hMUS81 and hMMS4 were expressed together and pulled-down with either HA or FLAG resins. These results demonstrate that hMMS4 is a binding partner for hMUS81 protein.

View larger version (44K): [in this window] [in a new window]   FIG. 2. Results of co-immunoprecipitation of MMS4 with MUS81. 293T cells were transfected with FLAG-CRY1-His (lane 1), FLAG-CRY1-His and HA-MMS4-His (lane 2), FLAG-MUS81-His (lane 3), and FLAG-MUS81-His and HA-MMS4-His (lane 4) plasmids. Cell lysates were prepared and bound to FLAG beads and analyzed by immunoblotting. Western blot was performed using His antibody as all proteins were His-tagged at the carboxyl-terminus. The expression levels of each protein are shown in lanes 1–4 as Input. The proteins bound to the FLAG beads were shown in lanes 5–8 as Bound. The CRY1, MMS4, and MUS81 proteins are indicated by arrows. IP, immunoprecipitation; IB, immunoblot.

View larger version (37K): [in this window] [in a new window]   FIG. 3. A, reciprocal immnunoprecipitation of MUS81 with MMS4. Either HA-MMS4-His (lanes 1 and 4) or FLAG-MUS81-His (lanes 2 and 5) alone or together (lanes 3 and 6) were expressed in 293T cells. The cell lysates were bound to either HA (lanes 1–3) or FLAG beads (lanes 4–6). Western blot was performed using His antibodies for the bound proteins. Lanes 1–3 contain immunoprecipitates using HA beads, whereas lanes 4–6 contain immunoprecipitates using FLAG beads. M, molecular weight markers. The star symbol indicates IgG antibodies present in the FLAG beads. B, nuclease assay-fraction of the beads used in A were tested for nuclease activity. The arrows, corresponding to nucleotides 29 and 28, indicate where the MUS81 ·MMS4 complex cuts specifically. In lanes 3 and 6–9 the proteins were immunoprecipitated with HA beads, whereas in lanes 2, 5, and 10–12 FLAG beads were used. In lanes 1, 4, and 13, single-stranded (ss), double-stranded (ds), and Y DNA substrates were incubated with the nuclease buffer, respectively. The reactions were incubated for 60 min at 30 °C, and the DNA was resolved on 10% denaturing polyacrylamide gel. In the bottom, a schematic representation of the single-stranded DNA, double-stranded DNA, and the Y structure are shown. Asterisks indicate the radiolabel, and the arrows represent the major incision products. C, quantitative analysis of nuclease activity. Graphic presentation of the nuclease activity of the proteins is shown. When the MUS81 ·MMS4 complex was immunoprecipitated with HA beads, the activity was 6-fold higher than with the FLAG immunoprecipitates. The error bars represent standard deviation of three independent experiments. Nuclease activity of HA-MMS4 immunoprecipitates was not above background (data not plotted).

MUS81-MMS4 Is a Structure-specific Endonuclease—Next, we performed nuclease assays with the immunoprecipitates of the FLAG-MUS81-His protein, the HA-MMS4-His protein, and the FLAG-MUS81-His ·HA-MMS4-His protein complex to determine whether these two proteins form a functional nuclease complex. We used Y-structure substrates for our nuclease assays because such a structure is typically used for detecting nuclease activity of structure-specific nucleases such as FEN1 and XPF-ERCC1 (28, 29). The results of the nuclease assay are shown in Fig. 3B. The immunoprecipitates of hMUS81 and hMMS4 or the complex have only minor nonspecific nuclease activity on either single-stranded DNA (lanes 1–3) or double-stranded DNA (lanes 4–6). Immunoprecipitates of the individual proteins also failed to cleave the Y-structure specifically (lanes 7 and 11). In contrast, immunoprecipitates that contained both hMus81 and hMMS4 incised the Y-structure at the junction of single-stranded DNA to double-stranded DNA specifically (lanes 9 and 12). These results show that hMMS4 not only binds to hMUS81, but also forms a functional complex that incises Y-shaped DNA structure in a specific manner common to this family of nucleases.

Because a previous report (24) indicated that hMUS81 immunoprecipitates had junction cutting activity, we performed a kinetic assay to detect any low level of activity that might have been missed in Fig. 3B. HA-immunoprecipitated MUS81 · MMS4 complex was used because HA resin immunoprecipitates resulted in better complex formation and higher nuclease activity (Fig. 3C). In Fig. 4A, lanes 1–4, DNA substrate and/or FLAG- and HA-immunoprecipitated cell lysates were incubated for 60 min. HA-immunoprecipitated MUS81 ·MMS4 protein complex was incubated for 15, 30, 45, and 60 min (lanes 5–8). As seen in Fig. 4A (lanes 5–8), only the MUS81 ·MMS4 complex cuts the DNA specifically. Quantitative analysis of this data (Fig. 4B) shows that MUS81 alone had less than 5% of the nuclease activity of MUS81 ·MMS4 complex. Thus, we conclude that the MUS81 ·MMS4 complex is the functional form of MUS81 resolvase.

View larger version (25K): [in this window] [in a new window]   FIG. 4. A, kinetic analysis of MUS81-MMS4 nuclease activity. Auto-radiogram of the assay gel is shown. FLAG-immunoprecipitated HA-MMS4 and HA-immunoprecipitated FLAG-MUS81 cell lysates were incubated with the DNA substrate for 60 min at 30 °C as controls and shown in lane 2 and 3. FLAG immunoprecipitate of FLAG-MUS81 was also incubated for 60 min. In lanes 5–7, HA immunoprecipitate of HA-MMS4 ·FLAG-MUS81 complex was incubated for 15, 30, 45, and 60 min, respectively. The arrows indicate the hMUS81-hMMS4 cutting site. B, quantitative analysis of hMUS81-hMMS4 nuclease activity data. Graphic presentation from three independent experiments including the one shown in A are plotted. Squares, hMUS81-hMMS4; diamond, hMUS81 alone. The error bars represent standard deviation.

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Here we report a novel human protein, hMMS4, that binds to hMUS81 to form a nuclease complex. We show that hMMS4 is necessary for the nuclease activity of hMUS81 on the Y structure DNA substrates. Therefore, we suggest that human MUS81 has a binding partner, hMMS4, which is necessary for its nuclease activity. We do not observe any significant nuclease activity using only recombinant hMUS81 protein made in human cells. This may be a consequence of not having enough endogenous hMMS4 to complex with the overexpressed hMUS81 protein in mammalian cells. However, when we coexpressed both components of the complex, the nuclease activity was readily detectable (Fig. 3B, lanes 3 and 6). Therefore, our results demonstrate that human MMS4 is not only the binding partner of hMUS81 but is also necessary for the Y structure-specific nuclease activity. In addition, we observed a difference between the levels of nuclease activity in the complex using HA and FLAG resin to immunoprecipitate the proteins (Fig. 3C). This difference was the result of different amounts of the proteins present in the complexes in the HA- and FLAG-immunoprecipitation used for these experiments (Fig. 3A). In a previous study (24), it was reported that immunoprecipitated hMUS81 protein alone had specific nuclease activity. In that study hMUS81 protein was obtained from stable cell lines, and it is possible that under those conditions the MUS81 ·MMS4 complex was immunoprecipitated. Our data indicates that hMUS81 does not appear to have intrinsic structure-specific nuclease activity. Although further studies are needed to resolve the cause of the discrepancy between the two studies, our results, along with the known biochemical properties of this family of nucleases (17, 18, 19, 20), suggest that the functional form of human MUS81 protein is the MUS81-MMS4 heterodimer.

	FOOTNOTES

 
^* This work was supported by National Institutes of Health Grant GM32833. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The on-line version of this article (available at http://www.jbc.org) contains Supplemental Table I.

To whom correspondence should be addressed: Dept. of Biochemistry and Biophysics, University of North Carolina, School of Medicine, Chapel Hill, NC 27599-7260. Tel.: 919-962-0115; E-mail: Aziz_Sancar{at}med.unc.edu.

¹ The abbreviation used is: HA, hemagglutinin.

	ACKNOWLEDGMENTS

 
We thank Drs. Laura A. Lindsey-Boltz and Joyce T. Reardon for useful comments on the manuscript.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 

1. Elledge, S. J. (1996) Science 274, 1664–1672[Abstract/Free Full Text]
2. Abraham, R. T. (2001) Genes Dev. 15, 2177–2196[Free Full Text]
3. Kim, S. M., and Huberman, J. A. (2001) EMBO 20, 6115–6126[CrossRef][Medline] [Order article via Infotrieve]
4. Lopes, M., Cotta-Ramusino, C., Pellicioli, A., Liberi, G., Plevani, P., Muzi-Falconi, M., Newlon, C. S., and Foiani, M. (2001) Nature 412, 557–561[CrossRef][Medline] [Order article via Infotrieve]
5. Cox, M. M. (2002) Mutat. Res. 510, 107–120[Medline] [Order article via Infotrieve]
6. Rhind, N., Russel, P. (2000) Curr. Biol. 10, R908-R911[CrossRef][Medline] [Order article via Infotrieve]
7. Interthal, H., and Heyer, W. D. (2000) Mol. Gen. Genet. 263, 812–827[CrossRef][Medline] [Order article via Infotrieve]
8. Boddy, M. N., Lopez-Girona, A., Shanahan, P., Interthal, H., Heyer, W. D., and Russell, P. (2000) Mol. Cell. Biol. 20, 8758–8766[Abstract/Free Full Text]
9. Bartek, J., Falck, J., and Lukas, J. (2001) Nat. Rev. Mol. Cell. Biol. 2, 877–886[CrossRef][Medline] [Order article via Infotrieve]
10. Murakami, H., and Okayama, H. (1995) Nature 374, 817–819[CrossRef][Medline] [Order article via Infotrieve]
11. Blasina, A., de Weyer, I. V., Laus, M. C., Luyten, W. H. M. L., Parker, A. E., and McGowan, C. H. (1999) Curr. Biol. 9, 1–10[CrossRef][Medline] [Order article via Infotrieve]
12. Brown, A. L., Lee, C. H., Schwarz, J. K., Mitiku, N., Piwnicia-Worms, H., and Chung, J. H. (1999) Proc. Natl. Acad. Sci. 96, 373745–373750
13. Chatuvedi, P., Eng, W. K., Zhu, Y., Mattern, R., Mishra, R., Hurle, M. R., Zhang, X., Annan, R. S., Lu, Q., Faucette, L. F., Scott, G. F., Li, X., Carr, S. A., Johnson, R. K., Winkler, J. D., and Zhou, B. B. (1999) Oncogene 18, 4047–4054[CrossRef][Medline] [Order article via Infotrieve]
14. Foiani, M., Pellicioli, A., Lopes, M., Lucca, C., Ferrari, M., Liberi, G., Muzi Falconi, M., and Plevani, P. (2000) Mutat. Research 451, 187–196
15. Mazin, A. V., Alexeev, A. A., and Kowalczykowski, S. C. (2003) J. Biol. Chem. 278, 14029–14036[Abstract/Free Full Text]
16. Brookman, K. W., Lamerdin, J. E., Thelen, M. P., Hwang, M., Reardon, J. T., Sancar, A., Zhou, Z. Q., Walter, C. A., Parris, C. N., and Thompson, L. H. (1997) Mol. Cell. Biol. 16, 6553–6562
17. Aravind, L., Walker, R. W., and Koonin, E. V. (1999) Nucleic Acids Res. 27, 1223–1242[Abstract/Free Full Text]
18. Enzlin, J. H., and Scharer, O. D. (2002) EMBO J. 21, 2045–2053[CrossRef][Medline] [Order article via Infotrieve]
19. Sancar, A. (1996) Annu. Rev. Biochem. 65, 43–81[CrossRef][Medline] [Order article via Infotrieve]
20. Wood, R. D. (1997) J. Biol. Chem. 272, 23465–23468[Free Full Text]
21. Boddy, M. N., Gaillard, P. H., McDonald, W. H., Shanahan, P., Yates, J. R., III, and Russell, P. (2001) Cell 107, 537–548[CrossRef][Medline] [Order article via Infotrieve]
22. Mullen, J. R., Kaliraman, V., Ibrahim, S. S., and Brill, S. J. (2001) Genetics 157, 103–118[Abstract/Free Full Text]
23. Whitby, M. C., Osman, F., and Dixon, J. (2003) J. Biol. Chem. 278, 6928–6935[Abstract/Free Full Text]
24. Chen, X. B., Melchionna, R., Denis, C. M., Gaillard, P. H., Blasina, A., van de Weyer, I., Boddy, M. N., Russell, P., Vialard, J., and McGowan, C. H. (2001) Mol. Cell 8, 1117–1127[CrossRef][Medline] [Order article via Infotrieve]
25. Constantinou, A., Chen, X. B., McGowan, C. H., and West, S. C. EMBO J. 21, 5577–5585
26. Özgür, S., and Sancar, A. (2003) Biochemistry 42, 2926–2932[CrossRef][Medline] [Order article via Infotrieve]
27. Jordan, M., Schallhorn, A., Wurm, and F. M. (1996) Nucleic Acids Res. 24, 596–601[Abstract/Free Full Text]
28. Samson, T., Henricksen, L. A., and Bambara, R. A. (2000) J. Biol. Chem. 275, 10498–10505[Abstract/Free Full Text]
29. Kaliraman, V., Mullen, J. R., Fricke, W. M., Bastin-Shanower, S. A., and Brill, S. J. (2001) Genes Dev. 15, 2730–2740[Abstract/Free Full Text]
30. Riethof, D. A., and Balakrishnan, R. (2003) BioComputing: Computer Tools for Biologists, Eaton Publishing, Westboro, MA

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				J. H. Chang, J. J. Kim, J. M. Choi, J. H. Lee, and Y. Cho Crystal structure of the Mus81-Eme1 complex Genes & Dev., April 15, 2008; 22(8): 1093 - 1106. [Abstract] [Full Text] [PDF]

				K. T. Ehmsen and W.-D. Heyer Saccharomyces cerevisiae Mus81-Mms4 is a catalytic, DNA structure-selective endonuclease Nucleic Acids Res., April 1, 2008; 36(7): 2182 - 2195. [Abstract] [Full Text] [PDF]

				K. Inagaki, C. Ma, T. A. Storm, M. A. Kay, and H. Nakai The Role of DNA-PKcs and Artemis in Opening Viral DNA Hairpin Termini in Various Tissues in Mice J. Virol., October 15, 2007; 81(20): 11304 - 11321. [Abstract] [Full Text] [PDF]

				A. Pamidi, R. Cardoso, A. Hakem, E. Matysiak-Zablocki, A. Poonepalli, L. Tamblyn, B. Perez-Ordonez, M. P. Hande, O. Sanchez, and R. Hakem Functional Interplay of p53 and Mus81 in DNA Damage Responses and Cancer Cancer Res., September 15, 2007; 67(18): 8527 - 8535. [Abstract] [Full Text] [PDF]

				K. Trowbridge, K. McKim, S. J. Brill, and J. Sekelsky Synthetic Lethality of Drosophila in the Absence of the MUS81 Endonuclease and the DmBlm Helicase Is Associated With Elevated Apoptosis Genetics, August 1, 2007; 176(4): 1993 - 2001. [Abstract] [Full Text] [PDF]

				F. Hartung, S. Suer, T. Bergmann, and H. Puchta The role of AtMUS81 in DNA repair and its genetic interaction with the helicase AtRecQ4A Nucleic Acids Res., September 11, 2006; 34(16): 4438 - 4448. [Abstract] [Full Text] [PDF]

				C. Allen, S. Buttner, A. D. Aragon, J. A. Thomas, O. Meirelles, J. E. Jaetao, D. Benn, S. W. Ruby, M. Veenhuis, F. Madeo, et al. Isolation of quiescent and nonquiescent cells from yeast stationary-phase cultures J. Cell Biol., July 3, 2006; 174(1): 89 - 100. [Abstract] [Full Text] [PDF]

				T. Hiyama, M. Katsura, T. Yoshihara, M. Ishida, A. Kinomura, T. Tonda, T. Asahara, and K. Miyagawa Haploinsufficiency of the Mus81-Eme1 endonuclease activates the intra-S-phase and G2/M checkpoints and promotes rereplication in human cells Nucleic Acids Res., February 2, 2006; 34(3): 880 - 892. [Abstract] [Full Text] [PDF]

				N. Dendouga, H. Gao, D. Moechars, M. Janicot, J. Vialard, and C. H. McGowan Disruption of Murine Mus81 Increases Genomic Instability and DNA Damage Sensitivity but Does Not Promote Tumorigenesis Mol. Cell. Biol., September 1, 2005; 25(17): 7569 - 7579. [Abstract] [Full Text] [PDF]

				G.-F. Richard, A. Kerrest, I. Lafontaine, and B. Dujon Comparative Genomics of Hemiascomycete Yeasts: Genes Involved in DNA Replication, Repair, and Recombination Mol. Biol. Evol., April 1, 2005; 22(4): 1011 - 1023. [Abstract] [Full Text] [PDF]

				K. Komori, M. Hidaka, T. Horiuchi, R. Fujikane, H. Shinagawa, and Y. Ishino Cooperation of the N-terminal Helicase and C-terminal Endonuclease Activities of Archaeal Hef Protein in Processing Stalled Replication Forks J. Biol. Chem., December 17, 2004; 279(51): 53175 - 53185. [Abstract] [Full Text] [PDF]

				L. Ha, S. Ceryak, and S. R. Patierno Generation of S phase-dependent DNA double-strand breaks by Cr(VI) exposure: involvement of ATM in Cr(VI) induction of {gamma}-H2AX Carcinogenesis, November 1, 2004; 25(11): 2265 - 2274. [Abstract] [Full Text] [PDF]

				J. P. McPherson, B. Lemmers, R. Chahwan, A. Pamidi, E. Migon, E. Matysiak-Zablocki, M. E. Moynahan, J. Essers, K. Hanada, A. Poonepalli, et al. Involvement of Mammalian Mus81 in Genome Integrity and Tumor Suppression Science, June 18, 2004; 304(5678): 1822 - 1826. [Abstract] [Full Text] [PDF]

				V. Blais, H. Gao, C. A. Elwell, M. N. Boddy, P.-H. L. Gaillard, P. Russell, and C. H. McGowan RNA Interference Inhibition of Mus81 Reduces Mitotic Recombination in Human Cells Mol. Biol. Cell, February 1, 2004; 15(2): 552 - 562. [Abstract] [Full Text] [PDF]

				N. M. Hollingsworth and S. J. Brill The Mus81 solution to resolution: generating meiotic crossovers without Holliday junctions Genes & Dev., January 15, 2004; 18(2): 117 - 125. [Full Text] [PDF]

This Article Abstract Full Text (PDF) Data Supplement All Versions of this Article: 278/24/21715    most recent M302484200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Ögrünç, M. Articles by Sancar, A. Search for Related Content PubMed PubMed Citation Articles by Ögrünç, M. Articles by Sancar, A. Social Bookmarking                      What's this?