![]()
|
|
||||||||
J. Biol. Chem., Vol. 278, Issue 25, 22199-22209, June 20, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


¶


**
From the
Department of Medical Biochemistry and Biophysics, Karolinska Institutet, S-17177 Stockholm, the ¶Department of Bioscience, Karolinska Institutet, Novum, S-141 57 Huddinge, and ||Institute of Environmental Medicine, Karolinska Institutet, S-17177 Stockholm, Sweden
Received for publication, March 28, 2003 , and in revised form, April 1, 2003.
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
A cytosolic GSH-dependent PGES that is functionally linked with PGHS-1 has also been described (11). Furthermore, two cytosolic anionic glutathione transferases that catalyzed GSH-dependent PGES activity have been purified from human brain cytosol (9). Another two cytosolic glutathione transferases of the Mu class that also displayed GSH-dependent PGES activity were purified from human brain cortex (12). PGES activity in the absence of GSH has been described in microsomal fractions from rat heart, spleen, and uterus, and the existence of a distinct, GSH-independent PGES was suggested (10). A GSH-independent PGES was later reported purified from bovine heart microsomes (18), and the corresponding monkey protein was recently cloned and purified (19). Thus it appears that more than one group of microsomal PGE synthases could exist.
Microsomal PGES-1 protein expression was induced in A549 cells, a lung adenocarcinoma-derived cell line, after treatment with the proinflammatory cytokine interleukin-1
(17). The induction of mPGES-1 expression and PGE2 production stimulated by interleukin-1
in A549 cells was demonstrated previously (20) to be in concert with the induction of PGHS-2 expression. Several other studies (2125) in various model systems have reported that mPGES-1 expression and regulation are associated with the inducible PGHS-2 in response to proinflammatory stimuli. Recently, mPGES-1 was also demonstrated to be overexpressed in lung cancer (26), colorectal adenomas and cancer (27), endometrial adenocarcinoma (28), as well as in symptomatic atherosclerotic plaques (29). The role of mPGES-1 in cancer development and atherosclerosis needs to be investigated further.
Membrane-bound PGES has been the subject of many purification attempts by several investigators for over 2 decades with only limited success (810), with the lability of the enzyme being the main obstacle. In this study, we present purification to apparent homogeneity, functional in vitro characterization, hydrodynamic studies, and a projection map demonstrating the oligomeric structure of human mPGES-1.
| EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
-PGE2 was from Cayman Chemical (Ann Arbor, MI). PGE2, PGD2, PGF2
, 5-HpETE, and 5-HETE were from Biomol (Plymouth Meeting, PA). Glutathione, 1-chloro-2,4-dinitrobenzene, glutathione reductase, and Triton X-100 (T9284 (nonreduced) and X-100RS (reduced)) were from Sigma. HiTrap chelating, Sephacryl S-300 high resolution and desalting columns were purchased from Amersham Biosciences. Hydroxyapatite (Bio-Gel HTP), Bradford protein assay dye, and ready-made 15% polyacrylamide gels were from Bio-Rad. HPLC solvents were from Rathburn Chemicals (Walkerburn, Scotland, UK). C18-octadecyl solid phase extraction columns were from J. T. Baker Chemical Co. Gelcode Blue stain was from Pierce. All other chemicals were of reagent grade and obtained from common commercial sources. Synthesis of ProstaglandinsPGH2 was prepared by brief incubation of arachidonic acid with suspensions of the microsomal fraction of homogenate of the sheep vesicular gland essentially as described (30). L-Tryptophan (5 mM) was used as electron donor. Purification was accomplished by straight phase HPLC using a solvent system of 2.5% 2-propanol/hexane containing 0.002% acetic acid. PGG2 was prepared in an analogous way, omitting the L-tryptophan.
15-Hydroperoxy-PGE2 was obtained from prostaglandin G2 (30) followed by purification by reversed phase HPLC. 15-Keto-PGE2 was prepared by MnO2 oxidation of prostaglandin E2 (31) followed by purification by reversed phase HPLC.
Cloning and Bacterial Expression of Human mPGES-1The isolation and cloning of the nucleotide sequence coding for the human mPGES-1 into the expression vector pSP19T7LT has been described previously (17). Insertion of an in-frame 6-histidine tag forming a vector N-terminal coding region of the pSP19T7LT vector was performed by PCR. In the resulting plasmid, the CATATG (NdeI site including the first Met of the expressed protein) was changed to CAAATG followed by CATCACCATCACCATCATATG introducing a new NdeI site (with the ATG underlined). The His6-tagged human mPGES-1 (His6-mPGES-1) was expressed from the His6-pSP19T7LT vector in E. coli BL21(DE3) cells (which harbored the pLysSL plasmid (32)). An overnight culture of BL21(DE3) cells in LB broth containing ampicillin (100 µg/ml) and chloramphenicol (20 µg/ml) was diluted 1:100 into 12 liters of Terrific Broth medium containing ampicillin and chloramphenicol (100 and 20 µg/ml, respectively). The culture was grown at 37 °C with shaking (200 rpm) until the A600 was 0.450.6. When the appropriate A600 was reached, expression of His6-mPGES-1 was induced by the addition of 3 mM isopropyl
-D-thiogalactopyranoside, and the culture was grown for another 3 h at 37 °C. Cells were harvested by centrifugation (5,000 x g, 10 min at 4 °C) and washed once with phosphate-buffered saline. The cell pellets were stored frozen at 20 °C until further use.
Preparation of MembranesFrozen BL21(DE3) cell pellets were thawed on ice and suspended in a solution containing 15 mM Tris-HCl, pH 8.0, 0.25 M sucrose, 0.1 mM EDTA, 1 mM GSH (20 ml for a pellet from 1 liter of expression culture). The cells were lysed by freeze-thawing which caused extrusion of internal T7 lysozyme expressed from the pLysSL plasmid (32). DNA was hydrolyzed by the addition of 10 mM MgCl2 and 0.4 µg/ml DNase and incubation on ice for 30 min. The lysate was thereafter sonicated by six 30-s sonication pulses from a MSE Soniprep 150 sonicator (MSE Scientific Instruments, Sussex, UK) at 60% power. The remaining cell debris was removed by centrifugation at 5,000 x g for 10 min. The supernatant was then ultracentrifuged at 250,000 x g for 1 h, and the membrane pellets were finally resuspended in 20 mM sodium phosphate buffer, pH 8.0, and stored at 70 °C.
Solubilization of MembranesFrozen E. coli BL21(DE3) membrane fraction containing recombinant His6-mPGES-1 was thawed, and membrane proteins were solubilized in a solution containing 10 mM sodium phosphate buffer, pH 8.0, 150 mM NaCl, 10% glycerol, 1 mM GSH, and 4% Triton X-100 for 30 min on ice with stirring at a protein concentration of 5 mg/ml. Insoluble material was separated by ultracentrifugation at 100,000 x g for 30 min. The cleared supernatant was filtered through a 0.45-µm filter.
Preparation and Solubilization of Whole Cell ExtractA frozen cell pellet from a 1-liter His6-mPGES-1 expression culture was thawed and resuspended in 20 ml of 10 mM sodium phosphate buffer, pH 8.0, 150 mM NaCl, 10% glycerol, 1 mM GSH. These cells were lysed upon freeze-thawing by the extrusion of the internal T7 lysozyme as described above. The viscous whole cell lysate was sonicated in an ice water bath by the instrument described above in 15-s pulses until homogeneous. Then the lysate was solubilized by the addition of an equal volume of 10 mM sodium phosphate buffer, pH 8.0, 150 mM NaCl, 10% glycerol, 1 mM GSH plus 8% Triton X-100 and was gently stirred on ice for 30 min. The solubilized lysate was cleared from insoluble material by ultracentrifugation and filtration as described for the membrane fraction.
Purification of Human His6-mPGES-1Recombinant His6-mPGES-1 was purified in a two-step combination of hydroxyapatite followed by immobilized metal ion affinity chromatography. Solubilized membrane fraction/whole cell lysate was mixed with hydroxyapatite (1 g/100 mg of membrane protein or liter expression culture) that had been equilibrated with 10 mM sodium phosphate buffer, pH 8.0, 150 mM NaCl, 1 mM GSH, 10% glycerol, 10 mM imidazole, 0.2% reduced Triton X-100. Reduced Triton X-100 was used to minimize the UV absorption of the buffer to facilitate detection of eluted proteins in the later affinity chromatography step. After a 10-min incubation on ice, the hydroxyapatite was pelleted by a short centrifugation pulse, and the supernatant (unbound fraction) was removed and cleared by centrifugation (1,500 x g, 3 min) and filtration (0.45 µm). The cleared, unbound fraction from the hydroxyapatite was immediately loaded on a 1-ml HiTrap chelating column that had been charged with NiCl2 and equilibrated with 10 mM sodium phosphate buffer, pH 8.0, 150 mM NaCl, 10 mM imidazole, 1 mM GSH, 10% glycerol, 0.2% reduced Triton X-100 (start buffer) at a flow rate of 1 ml/min. After loading, the column was washed with start buffer until all unbound proteins were eluted. Thereafter, 60 mM imidazole was added to wash out unspecifically bound proteins. Finally, the histidine-tagged protein that had bound to the affinity column was eluted by a step addition of 350 mM imidazole.
The eluted peak was immediately desalted into 20 mM sodium phosphate buffer, pH 7.5, 50 mM NaCl, 10% glycerol, 1 mM GSH, and 0.2% reduced Triton X-100 on a HiPrep 26/10 desalting column at a flow rate of 8 ml/min.
PGES Activity AssayPGES activity was assayed in 100 µl of reaction mixture, containing 0.1 M potassium phosphate buffer, pH 7.4, 2.5 mM GSH, 10400 µM PGH2 (dissolved in acetone), and 0.5 µg/ml purified His6-mPGES-1, as described previously (20). Also at least 0.1% Triton X-100 was present throughout all measurements in this investigation. 0.1% Triton X-100 is 510-fold higher than required for sustained mPGES-1 activity. Reaction products were purified by solid phase extraction and eluted with 500 µl of acetone followed by evaporation under nitrogen flow. Thereafter the sample was dissolved in 600 µl of 33% (v/v) acetonitrile. When the saturation kinetics for glutathione was determined, activity was assayed with a fixed concentration of 400 µM PGH2 and 0.110 mM GSH. The products were quantified based on the peak areas from known amounts of injected prostaglandins as described (20).
Conversion of PGG2 to 15-Hydroperoxy-PGE2PGG2 was assayed as substrate for mPGES-1 in 100 µl of reaction mixture containing 0.1 M potassium phosphate buffer, pH 7.4, 2.5 mM GSH, 10800 µM PGG2, and 0.22.0 µg/ml of purified His6-mPGES-1. The reaction was terminated by the addition of 6 µl of 1 M HCl and 45 µl of acetonitrile lowering the pH to 3, followed by centrifugation at 14,000 x g for 1 min to remove the protein. To determine the formation of PGE2 and 15-hydroperoxy-PGE2, an aliquot (100 µl) was immediately analyzed by reversed phase HPLC, combined with UV detection at 195 nm. The products were quantified based on the peak areas from known amounts of injected prostaglandins.
Glutathione-dependent Peroxidase Activity AssaysPeroxidase activity toward 5-hydroperoxyeicosatetraenoic acid (5-HpETE) (40 µM) was assayed in 100 µl of reaction mixture, containing 0.1 M potassium phosphate buffer, pH 7.4, 5 mM GSH, 0.005% (w/v) bovine serum albumin, and 0.0250.1 mg/ml of purified His6-mPGES-1. The reaction was terminated by addition of 200 µl of acetonitrile containing 0.2% acetic acid. 100 µl of H2O was then added, and the protein was removed by centrifugation at 14,000 x g for 1 min. An aliquot (200 µl) was analyzed by reversed phase HPLC equipped with a Nova-Pak C18 column (3.9 x 150 mm, 4-µm particle size), obtained from Waters. The mobile phase was water, acetonitrile, and trifluoroacetic acid (40:60:0.007, by volume). The flow rate was 1.0 ml/min, and the products were quantified based on the peak areas at 236 nm from known amounts of injected 5-HpETE and 5-HETE.
Peroxidase activity with cumene hydroperoxide as substrate was determined by a coupled assay with 0.05 mg/ml purified His6-mPGES-1, 1 mM GSH, 0.2 mM NADPH, 0.5 mM cumene hydroperoxide (dissolved in alcohol), and an excess amount of glutathione reductase as the linear decrease in NADPH absorption at 340 nm (33).
Peroxidase activity toward 15-hydroperoxy-PGE2 was assayed identically as described for PGG2 with 0.1 mg/ml purified His6-mPGES-1 and 0.16 mM 15-hydroperoxy-PGE2 at 37 °C.
Glutathione Transferase AssayActivity was measured spectrophotometrically at 340 nm (34) in 0.1 M phosphate buffer, pH 6.5, containing 0.1% Triton X-100, 5 mM glutathione, 2 mM 1-chloro-2,4-dinitrobenzene (CDNB), and 0.0250.05 mg/ml purified His6-mPGES-1 at 30 °C. The reaction mixture also contained 5% ethanol since that was the solvent for CDNB. The non-enzymatic conjugation of CDNB to GSH (n = 4) was subtracted from the enzymatic conjugation at two different enzyme concentrations yielding a specific activity value with an S.D. of less than 5% (n = 6).
Calculation and Presentation of Kinetic DataThe rates of all enzymatic reactions were calculated after subtracting the non-enzymatically produced products.
Michaelis-Menten constants (Km) and maximum activity (Vmax) were calculated by the use of GraphPad Prism software (version 3.02, GraphPad Software Inc., San Diego, CA). All values presented are means ± S.D. of at least triplicate determinations except for the values for PGG2 that are means of duplicates ± the min/max span.
Electron CrystallographyPurified His6-mPGES-1 in 1% Triton X-100 was subjected to two-dimensional crystallization trials by adding phospholipids prior to reduction of the detergent content (35, 36). Specimens showing crystallinity, as judged from analysis of negatively stained samples by transmission electron microscopy and optical diffraction, were subjected to preparation by the back injection method (37, 38) using a 1% tannin solution as stabilizing agent. The specimens were frozen at 175 °C and kept at approximately this temperature in a Gatan 626 cryo holder throughout the data collection. Electron micrographs were recorded on Kodak SO-163 film using a Philips CM120 electron microscope operated at 120 kV. Selected areas were digitized in a Zeiss Scai scanner at 7-µm pixel size corresponding to 1.4 Å on the specimen level. The data were subjected to several steps of image processing essentially as described previously (39) using programs from the MRC suite (40).
Sedimentation CoefficientThe sedimentation coefficient of the mPGES-1-Triton X-100 complex was determined by adding 25 µg of purified His6-mPGES-1 together with 0.1 mg of cytochrome c and 1 mg of bovine serum albumin in a total volume of 200 µl on top of a 10-ml linear gradient containing 520% sucrose, 10 mM potassium phosphate buffer, pH 7.4, 2 mM GSH, 1% Triton X-100. Cytochrome c and bovine serum albumin were used as standards with sedimentation coefficients of 1.7 S and 4.6 S, respectively. Centrifugation was performed at 160,000 x gav in a Beckman SW40 Ti rotor for 45 h at 20 °C. Fractions were collected from the bottom of the tubes with a syringe using a pump, and 0.4-ml aliquots were saved for activity assays and protein determination. These fractions were assayed for PGES activity as described earlier, and the refractive index of the sucrose content was determined. Cytochrome c was determined from the absorbance at 405 nm, and bovine serum albumin was localized by measuring protein according to Pande and Murthy (41) due to the high detergent concentration in these samples.
Partial Specific VolumeThe partial specific volume of the mPGES-1-Triton X-100 complex was determined by equilibrium density gradient centrifugation. 15 µg of purified His6-mPGES-1 was added to a 3.8-ml gradient containing 2050% sucrose, 10 mM potassium phosphate buffer, pH 7.4, 1 mM GSH, 1% Triton X-100. The tubes were centrifuged at 246,000 x gav in a Beckman SW60 Ti rotor at 20 °C for both 72 and 96 h to ensure that equilibrium had been reached. Fractions of 0.16 ml were collected and analyzed as described above.
Stokes RadiusThe Stokes radius of the mPGES-1-Triton X-100 complex was determined by gel exclusion chromatography on a column (1.6 x 60 cm) of Sephacryl S-300 HR in 50 mM sodium phosphate buffer, pH 7.4, 150 mM NaCl, 1 mM GSH, 0.2% Triton X-100, and 0.5% glycerol at 20 °C. 3050 µg of purified His6-mPGES-1 was loaded on the column together with marker enzymes in 1.0 ml of buffer. A HMW gel filtration calibration kit from Amersham Biosciences was used with the marker enzymes albumin, catalase, ferritin, and thyroglobulin. Fractions of 1.0 ml were collected and analyzed with regard to protein content (A280 and Bradford), heme-containing proteins (A405), catalase, and PGES activities. Results from absorbance at 405 nm and catalase activity were only used to identify chromatographic peaks (not shown). Neither of the markers has been shown to bind significant amounts of detergents. The Stokes radius was estimated according to the gel filtration kit instruction manual from Amersham Biosciences.
Triton Binding to His6-mPGES-1Fractions from Ni2+-IMAC columns were analyzed with regard to both Triton X-100 and protein content. The column was equilibrated with a buffer containing Triton X-100 just above critical micelle concentration in order to minimize the spectrophotometric background absorbance of Triton X-100.
In order to determine the amount of Triton X-100 bound to mPGES-1, the theoretical extinction coefficient for mPGES-1 at 280 nm was calculated (42). The absorbance (280 nm) of the buffer samples containing only Triton X-100 was subtracted from the absorbance of the samples containing both mPGES-1 and Triton X-100. The absorbance of mPGES-1 was calculated using the theoretical extinction coefficient, and the amount of protein present was determined by Bradford (43). The remaining absorbance originates from Triton X-100 bound to mPGES-1, and the corresponding concentration of Triton X-100 was determined by the use of a standard curve at 280 nm. Relating the amount of protein-bound Triton X-100 to the amount of protein in each sample gives the amount of detergent per His6-mPGES-1 in grams/gram.
Calculation of Molecular MassThe molecular mass of a protein-detergent complex can be calculated from the Svedberg Equation 1 (59),
![]() | (Eq. 1) |
20,w is the viscosity of water at 20 °C; s20,w is the sedimentation coefficient; a is the stokes radius; N is Avogadro's number;
is the partial specific volume; and
20,w is the density of water at 20 °C. Gel Electrophoresis and Western BlottingSDS-PAGE was performed in 15% polyacrylamide gels as described (44). Protein bands were detected by silver staining or Gelcode Blue Coomassie stain. Western blots and immunodetection using rabbit polyclonal peptide antiserum directed against mPGES-1 was performed as described previously (20).
| RESULTS |
|---|
|
|
|---|
|
Activity of the Solubilized mPGES-1
PGES activity was assayed in membranes solubilized in phosphate buffer with/without the addition of 1 mM GSH and 10% glycerol, respectively (Fig. 2A). The addition of GSH was important for activity. Glycerol had a positive effect alone for the PGES activity (Fig. 2A) and was thereafter added in all buffers. The PGES activity in solubilized membranes remained stable for a prolonged time in the presence of GSH and glycerol. After 24 h at 4 °C,
70% of the activity (determined as pmol of PGE2 formed/min) remained, and after 10 days 50% of the original activity could still be determined (Fig. 2B). In the absence of GSH and glycerol the PGES activity in solubilized membranes rapidly declined.
|
Purification of Human His6-mPGES-1
Recombinant His6-mPGES-1 was purified to apparent homogeneity from solubilized membrane extract by a two-step combination of hydroxyapatite followed by immobilized metal ion affinity chromatography on a chelating Sepharose column charged with Ni2+. The solubilized extract was mixed with a batch of hydroxyapatite followed by loading the unbound fraction from the hydroxyapatite on the nickel column. All His6-mPGES-1 was retained on the nickel column, and the remaining unspecifically bound proteins could be removed by a wash step of 60 mM imidazole (Fig. 3). Pure His6-mPGES-1 was then eluted as a single peak by a step addition of 350 mM imidazole (Fig. 3). The eluted protein was immediately desalted to avoid any possible damage by the high imidazole concentration. The results were equal using isolated membrane fractions or whole cell extract as starting material for the purification. In either case a 17,500 protein purified to apparent homogeneity on silver-stained SDS-PAGE was recovered (Fig. 4A). The yield was 0.21.0 mg of purified protein from isolated membrane fractions and 1.03.5 mg when purifying from whole cell lysate per 1 liter of BL21(DE3) expression culture. The purified protein was identified as mPGES-1 by immunoblot analysis using rabbit polyclonal peptide antiserum directed against mPGES-1 (Fig. 4B, right panel) and PGES activity determination. The molecular weight of the purified protein was calculated from its electrophoretic mobility relative to standards to 17,500, which is in agreement with the theoretical molecular weight of human His6-mPGES-1 (17,900). Identical results were obtained when calculating from a stained SDS-PAGE or a Western blot (Fig. 4B). By using the purified His6-mPGES-1 as standard for a quantitative Western blot (Fig. 5), the relative amounts of recombinant protein recovered in the membrane fractions were determined by densitometry. Relative amounts of His6-mPGES-1 varying from 0.5 to 2% of the total membrane protein were observed in different membrane preparations.
|
|
|
The purified His6-mPGES-1 catalyzed glutathione-dependent conversion of PGH2 to PGE2. Activity was assayed with His6-mPGES-1 freshly prepared, stored at 4 °C, and frozen at 20 °C for 5 days or with unsolubilized bacterial membrane fraction. The activity of the purified enzyme was resistant to freeze-thawing. After 5 days of storage at 4 °C, the activity was unchanged compared with the freshly prepared enzyme, and after 34 days at 4 °C about 50% of the original activity remained. A pure enzyme preparation that was thawed after 6 months of storage at 20 °C did not show any loss of PGES activity compared with the freshly purified enzyme. Samples intended for long time storage were kept under nitrogen to prevent damage of the protein by oxidation. mPGES-1 in unsolubilized membrane fraction (where the His6-mPGES-1 content had been determined by quantitative immunoblotting) showed a similar activity as the solubilized, purified enzyme. This strongly indicates that the recombinant His6-mPGES-1 is kept stable in its functional conformation upon solubilization and purification.
Kinetic Characterization of mPGES-1
Conversion of PGH2 into PGE2Purified human His6-mPGES-1 showed Michaelis-Menten rate behavior toward PGH2 in the presence of GSH (Fig. 6A). The activity was stimulated by GSH in a concentration-dependent manner, and no PGES activity could be detected in the absence of GSH. Michaelis-Menten constants Km and kcat for PGH2 and GSH are presented in Table I, and specific activity/Vmax is presented in Table II. When GSH was substituted by other sulfhydryl compounds such as N-acetylcysteine, dithiothreitol, or 2-mercaptoethanol, or when the purified His6-mPGES-1 was heated at 100 °C for 10 min, no PGES-activity could be detected. Preincubation of purified His6-mPGES-1 with 5 mM N-ethylmaleimide in the absence of GSH for 1 min reduced the PGES activity by almost 100%.
|
|
|
Conversion of PGG2 into 15-Hydroperoxy-PGE2In the search for additional activities, we investigated whether human His6-mPGES-1 catalyzed the isomerization of PGG2 into 15-hydroperoxy-PGE2. Purified His6-mPGES-1 was incubated with PGG2 (10 µM) in the presence of GSH (2.5 mM). After 30 s of incubation a major peak of 15-hydroperoxy-PGE2 was observed (Fig. 7B). The corresponding buffer control demonstrated a smaller amount of 15-hydroperoxy-PGE2 (Fig. 7C). If the enzyme was incubated in the absence of GSH (Fig. 7F)orin the presence of GSH but first denatured by boiling, no increased formation of 15-hydroperoxy-PGE2 was observed. After 10 min of incubation there is a non-enzymatic formation of PGE2 and PGD2 in the buffer control (Fig. 7E), while in the 10-min incubation containing His6-mPGES-1, PGE2 but no PGD2 is produced (Fig. 7D). Knowing that PGG2 constitutes a substrate for mPGES-1, further analysis demonstrated a similar Michaelis-Menten behavior toward PGG2 as with PGH2 (Fig. 6B). Km and kcat values for PGG2 are presented in Table I and specific activity/Vmax in Table II. Furthermore, His6-mPGES-1 catalyzed the reduction of 15-hydroperoxy-PGE2 although at a very low rate compared with the high-efficient isomerization of PGG2 to 15-hydroperoxy-PGE2 (Table II and see "Glutathione Peroxidase Activity" below). Due to the hydrophobic properties of PGG2 and PGH2, the Km values are given as apparent.
|
Glutathione Peroxidase Activity
Because MGST1, MGST2, and MGST3 all catalyze the GSH-dependent reduction of lipid hydroperoxides into the corresponding alcohols, we tested 5-HpETE, 15-hydroperoxy-PGE2, and cumene hydroperoxide as substrates for His6-mPGES-1. Purified His6-mPGES-1 catalyzed a low specific glutathione peroxidase activity toward 5-HpETE (Table II). All GSH-dependent peroxidase activity disappeared upon heating the enzyme at 100 °C for 10 min. His6-mPGES-1 also catalyzed the reduction of 15-hydroperoxy-PGE2 in the presence of GSH although at a rate magnitudes lower than the production of 15-hydroperoxy-PGE2 (Table II). Furthermore, purified His6-mPGES-1 catalyzed GSH-dependent peroxidase activity toward cumene hydroperoxide (0.17 µmol min1 mg1, Table II). As a control, the enzyme was boiled for 10 min, which abolished all activity.
Glutathione S-Transferase Activity
GST activity toward CDNB was investigated with purified His6-mPGES-1. We found that the enzyme catalyzes a small but significant GSH-CDNB conjugating activity (Table II). As a control, purified His6-mPGES-1 was heated at 100 °C for 10 min, after which no GST activity could be detected. The GST activity increased linearly up to 2 mM CDNB, which is the limit of solubility, and an apparent Km for CDNB could thus not be determined. Preincubation of purified His6-mPGES-1 with 5 mM N-ethylmaleimide in the absence of GSH for 1 min caused 50% reduction of the enzyme activity. No leukotriene (LT)C4 synthase activity could be detected when the purified His6-mPGES-1 was incubated with LTA4 and GSH.
Electron Crystallography
Two-dimensional crystals of human His6-mPGES-1 had unit cell parameters, a = 97.0, b = 98.0 Å,
= 90.0°. The present data were consistent with assigning projection symmetry pgg with an overall phase residual of 25.7° between symmetry related diffraction spots to a resolution of 10 Å (Table III). The glide lines parallel to the a and b axes of the crystal give rise to horizontal and vertical rows of symmetry-related protein units in alternating up and down orientations as depicted in Fig. 8. The projection map was obtained by merging data from 18 crystalline areas.
|
|
Molecular Mass of the mPGES-1-Triton X-100 Complex
The sedimentation coefficient, partial specific volume, and Stokes radius of the mPGES-1-Triton X-100 complex were determined by the use of sucrose gradients and gel filtration on Sephacryl S-300 HR. At 20 °C, the sedimentation coefficient (s20, w) of the mPGES-1-Triton X-100 complex was found to be 4.1 ± 0.1S(n = 4) (Fig. 9A) and the partial specific volume was 0.891 ± 0.005 cm3/g (n = 2), which corresponds to a density of 1.12 ± 0.01 g/ml (29 ± 1% sucrose) and a refractive index of 1.380 ± 0.001, demonstrated in Fig. 9B, which shows one of two independent experiments. Fig. 9C shows the gel filtration elution profile with 0.25% Triton X-100 at 20 °C. As evident from Fig. 9C the mPGES-1-Triton X-100 complex almost co-chromatographed with catalase on the Sephacryl S-300 HR column. The square root of log Kav values were plotted against the known Stokes radii of the marker enzymes (not shown) and the Stokes radius of the mPGES-1-Triton X-100 complex was shown to be 5.09 ± 0.04 at 20 °C. Gel filtration was also performed with marker enzymes alone, which were not affected by Triton X-100 in the elution buffer.
|
These data were then substituted into the Svedberg equation (Eq. 1), and the molecular weight of the mPGES-1-Triton X-100 complex was calculated to be 215,000 at 20 °C.
To determine the amount of bound detergent in the mPGES-1-Triton X-100 complex, UV absorbance and protein content was measured on the eluted fractions from the immobilized metal ion affinity column. From the known protein content (59 ± 2 µg/ml; n = 6) and the theoretical extinction coefficient of mPGES-1 (19,300 M1 s1; 280 nm) (42), the absorbance value for mPGES-1 was calculated to be 0.021 ± 0.001 AU. The background and the calculated value for mPGES-1 was subtracted from the measured absorbance of the mPGES-1-Triton X-100 complex (0.354 ± 0.005; n = 3), and thus the amount of detergent bound to mPGES-1 resulted in a value of 0.333 ± 0.006 AU. According to a standard curve of Triton X-100 (not shown), 0.333 AU corresponds to 166 µg/ml, which gives a ratio of 2.8 ± 0.1 µg of Triton X-100/µg of mPGES-1 (n = 3). As a trimer mPGES-1 weighs 53,700 and thus binds 150,400 units of detergent, and the resulting weight of the complex (204,000) agrees best with a trimeric quaternary structure (215,000).
| DISCUSSION |
|---|
|
|
|---|
We have introduced a 6-histidine tag at the N terminus of the expression construct (His6-mPGES-1) for affinity purification on metal-chelating resins. In combination with hydroxyapatite chromatography on the solubilized extract as a first step, recombinant His6-mPGES-1 could be purified to apparent homogeneity on a nickel-chelating column (Figs. 3 and 4). Equally good results were obtained whether isolated membranes or whole cell lysate was used as the starting material. Excluding the tedious preparation of membranes considerably shortened the overall time for the process and also minimized losses because the yield was higher when purifying from whole cell extract. The amount of His6-mPGES-1 recovered in the bacterial membrane (up to 2% of the total membrane protein) (Fig. 5) is relatively high being a recombinant heterologous membrane-bound protein and demonstrates the efficiency of the expression system. Purified His6-mPGES-1 protein was stable and insensitive to freeze-thawing in the chosen buffer/detergent composition. Recently, we assayed purified His6-mPGES-1 that had been stored for 6 months at 20 °C without any notable loss of activity. A major problem during earlier purification attempts of microsomal PGES-1 has been the lability of the enzyme. The use of Triton X-100 as detergent and the addition of GSH and glycerol throughout the process appears to have solved this obstacle. This opens new possibilities and clearly facilitates continued enzymological and structural studies.
The Vmax value of purified His6-mPGES-1 was 170 µmol min1 mg1 for the conversion of PGH2 to PGE2 at 37 °C, which is magnitudes higher than other terminal prostaglandin synthases (Table IV). Km for PGH2 (0.16 mM) is comparable with other PG synthases reported, whereas the turnover number and catalytic efficiency, kcat/Km, are magnitudes higher (Table IV). Although further studies are needed to determine the situation in vivo, our findings suggest a major role for the microsomal PGES-1 in the production of PGE2 in humans.
|
Purified His6-mPGES-1 catalyzed a small but significant CDNB-GSH conjugating activity not observed earlier (Table II). Other cytosolic enzymes that have been reported as PGE synthases such as the Mu class GSTs M2-2 and M3-3 in the human brain (12), and the two forms of anionic cytosolic PGH-E isomerases (9) also catalyzed GST activity toward CDNB. However, their PGES activities were modest (Table IV). Purified His6-mPGES-1 had low specificity for CDNB, and the enzyme could not be saturated with CDNB within the limit of solubility (
2 mM). Earlier we reported that native mPGES-1 expressed in E. coli did not possess any GST activity toward CDNB when assayed in bacterial membranes (17), an observation that can now be explained by the low activity of the enzyme. Of the human MAPEG proteins, MGST1 and MGST2 also catalyze CDNB-GSH conjugating activity, and the GST activity of His6-mPGES-1 may reflect its relationship to MGST1.
Another observation in support of the relationship to MGST1 was that purified His6-mPGES-1 catalyzed GSH-dependent peroxidase activity toward cumene hydroperoxide. Interestingly, the specific activity determined (0.17 µmol min1 mg1) was identical to that determined with recombinant rat MGST1 (45). Purified His6-mPGES-1 catalyzed a modest GSH-dependent peroxidase activity toward 5-HpETE, an observation earlier found with both MGST2 and MGST3 (14).
Furthermore, we found that purified His6-mPGES-1 could efficiently catalyze the conversion of PGG2 to 15-hydroperoxy-PGE2 in the presence of GSH. Reduction of the hydroperoxide into PGE2 could be catalyzed by mPGES-1 although at a much slower rate. The non-enzymatic contribution to the total PGE2 produced from 15-hydroperoxy-PGE2 in the presence of GSH (Fig. 7E) is significant. GSH is a relatively poor reducing agent, but because it is present in most cells at high concentrations non-enzymatic reduction by GSH is likely to occur in vivo (46). It is more likely, however, that the reduction of 15-hydroperoxy-PGE2 into PGE2 is catalyzed by glutathione-dependent peroxidases (47, 48), alternatively by the peroxidase activity of PGHS-1/-2. Interestingly, the specific activity and catalytic efficiency for the enzymatic conversion of PGG2 to 15-hydroperoxy-PGE2 by His6-mPGES-1 were actually higher than for the PGE2 formation from PGH2 (Tables I and II). Our findings thus indicate that the formation of PGE2 from PGG2 can proceed through two possible pathways (Fig. 10). Either PGG2 can be reduced into PGH2 by the peroxidase activity of PGHS and then transformed selectively to PGE2 catalyzed by mPGES-1, or first transformed into 15-hydroperoxy-PGE2 by mPGES-1 followed by reduction to PGE2 by other enzymes or in a non-enzymatic fashion as has actually been suggested earlier (49). Other enzymes beside mPGES-1, such as the thromboxane A2 synthase, have also been reported to use PGG2 as substrate (50). PGHS-1 and PGHS-2 catalyze the cyclooxygenase reaction and peroxidase reaction at distinct but functionally interconnected sites. The peroxidase reaction occurs at a heme-containing active site located near the protein surface, whereas the cyclooxygenase reaction takes place in the hydrophobic core of the enzyme. PGG2 consequently needs to diffuse to the peroxidase pocket on the other side of the enzyme (7). On the other hand, Eling and co-workers (51) have reported efficient channeling of PGG2 from the cyclooxygenase to the peroxidase site in microsomal PGHS. Thus, in the situation with both mPGES-1 and PGHS-2 present in the cell, a competition for PGG2 will occur, and further studies are required to elucidate the specific roles of the two enzymes in vivo. An intriguing interplay would be if the substrate could be shuttled between PGHS-2 and mPGES-1. In such a scenario, PGG2 could be transferred to mPGES-1, which catalyzes the formation of 15-hydroperoxy-PGE2. Then the 15-hydroperoxy-PGE2 is shuttled back to PGHS-2 and reduced to PGE2. This would enable further regulating mechanisms.
|
Independently from our study, a report (52) was recently published describing purification of human mPGES-1 expressed in a baculovirus system. They reported steady-state kinetic parameters for PGE synthase activity and that GSH was not oxidized during catalysis. In contrast to our study they reported a lower apparent Km value for PGH2 (14 µM at 0 °C with differences in the enzyme activity assay). In our study, the apparent Km value was determined at 37 °C, and recently, Lazarus et al. (53) found a relatively high Km value for mouse mPGES-1 expressed in E. coli at 24 °C (130 µM), which is in line with our data. These discrepancies in Km require further investigations. Possible explanations can be the difference in lipid composition between eukaryotic and prokaryotic cells, alternatively different post-transcriptional processing. In addition, we report significant but low GST and peroxidase activities in contrast to Ouellet et al. (52), findings that are principally very important for the further understanding of the mPGES-1 reaction.
mPGES-1 forms well ordered two-dimensional crystals suitable for electron crystallography. The molecular weight of the His6-mPGES-1 protein in relation to the unit cell size suggests that each of the protein units in the two-dimensional map (circled in Fig. 8) corresponds to the projection of three monomers along the direction perpendicular to the plane of the membrane. The resulting packing density is 22.7 Da/Å2, which is comparable with two-dimensional crystals of many other small integral membrane proteins. Thus, reconstituted mPGES-1 forms a trimer in the crystal. In the case of MGST1 two different types of two-dimensional crystals have been observed. The hexagonal form has a perfect 3-fold axis relating the three monomers in the trimer (54, 55), whereas the orthorhombic type has a local non-crystallographic 3-fold axis (56). The high degree of 3-fold symmetry between the monomers displayed by that protein is less pronounced in the present projection map of mPGES-1.
Hydrodynamic studies of the mPGES-1-Triton X-100 complex demonstrated properties similar to the related MGST1-Triton X-100 complex (57). mPGES-1 was found to bind 2.8 g of Triton X-100/g of protein at 20 °C. The corresponding detergent binding for MGST1 at 4 °C is 1.5 g/g, in agreement with independent data reporting that Triton X-100 micelle size and hydration is dependent on temperature (58). Also, the stronger detergent binding by mPGES-1 is consistent with a more pronounced hydrophobic character evident from hydropathy plots (not shown). The amount of bound detergent to mPGES-1 and the calculated values of the molecular weight clearly suggest a trimeric quaternary structure of mPGES-1.
In summary, we have purified recombinant human microsomal GSH-dependent PGES-1 to apparent homogeneity with conserved high activity of the solubilized enzyme. In comparison, it appears to be one of the most efficient human PGE synthases, which in conjunction with co-regulation and colocalization with PGHS-2 underscores its importance in eicosanoid triggered pathophysiological reactions. Furthermore, purified His6-mPGES-1 could catalyze the conversion of PGG2 to 15-hydroperoxy-PGE2 with high efficiency in the presence of GSH as well as utilize xenobiotic substrates. Analysis of twodimensional crystals by electron crystallography revealed a 10-Å projection structure demonstrating a trimeric organization of reconstituted mPGES-1. The calculated molecular weight from hydrodynamic studies at 20 °C (215,000) closely corresponded to the expected value for a trimer-detergent complex (204,000). As two independent methods agree, the trimeric quaternary structure is well supported.
| FOOTNOTES |
|---|
Both authors contributed equally to this work. ![]()
** To whom correspondence should be addressed: Dept. of Medical Biochemistry and Biophysics, Karolinska Institutet, S-17177 Stockholm, Sweden. Tel.: 46-8-728-7652; Fax: 46-8-736-0439; E-mail: per-johan.jakobsson{at}mbb.ki.se.
1 The abbreviations used are: PG, prostaglandin; CDNB, 1-chloro-2,4-dinitrobenzene; GST, glutathione S-transferase; His6-mPGES-1, His6-tagged human prostaglandin E synthase; 5-HpETE, 5-hydroperoxyeicosatetraenoic acid; LT, leukotriene; MAPEG, membrane-associated proteins in eicosanoid and glutathione metabolism; MGST, microsomal glutathione transferase; mPGES-1, microsomal prostaglandin E synthase-1; PGES, prostaglandin E synthase; PGHS, prostaglandin H synthase; HPLC, high pressure liquid chromatography; AU, absorbance units; 5-HETE, 5-hydroxyeicosatetraenoic acid. ![]()
| REFERENCES |
|---|
|
|
|---|