|
Advertisement | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
J. Biol. Chem., Vol. 278, Issue 25, 22309-22315, June 20, 2003
Zinc-binding Sites in the N Terminus of Mycoplasma arthritidis-derived Mitogen Permit the Dimer Formation Required for High Affinity Binding to HLA-DR and for T Cell Activation*![]() ![]() From the Centre de Recherche en Rhumatologie et Immunologie, Centre Hospitalier de l'université Laval, Faculté de Médecine, Université Laval, Quebec G1V 4G2, Canada
Received for publication, January 24, 2003 , and in revised form, April 1, 2003.
Zinc-dependent superantigens can be divided into two subfamilies based on how they use zinc ions for interactions with major histocompatibility complex (MHC) class II molecules. Members of the first subfamily use zinc ions for interactions with histidine 81 on the -chain of MHC class II molecules, whereas members of the second subfamily use zinc ions for dimer formation. The zinc-binding motif is located in the C terminus of the molecule in both subfamilies. While our recent studies with Mycoplasma arthritidis-derived mitogen (MAM) have provided the first direct evidence demonstrating the binding to MHC class II molecules in a zinc-dependent manner, it still not known how zinc coordinates the interaction. Data presented here show that the zinc ion is mainly required to induce MAM/MAM dimer formation. Residues in the N terminus of MAM are involved in dimer formation and MHC class II binding, while histidine 14 and aspartic acid 31 of the MAM sequence are the major residues mediating MAM/MAM dimerization. Zinc-induced dimer formation is necessary for MAM binding, MHC class II-induced cell-cell adhesion, and efficient T cell activation. Together these results depict the unique mode of interaction of MAM in comparison with other superantigens.
Superantigens (SAgs)1 were first identified over 14 years ago (1) and are known to be produced by a wide variety of microorganisms such as bacteria and viruses (2). Upon binding to their natural ligand, MHC class II molecules, they are capable of the polyclonal activation of a large pool of T lymphocytes sharing a compatible, common V region of the TCR (1). Their presentation to T cells by MHC class II molecules is necessary because the affinity of SAgs for V in the absence of presentation is generally very low (1, 3). The discovery of SAgs offered hope for effective T cell-based therapies (46), provided insight into some diseases caused by SAgs such as food poisoning and toxic shock syndrome (7), and, more importantly, proved to be an effective tool for studying interactions within the trimolecular complex: MHC class II-peptide-TCR (810). These toxins have been used extensively over the past years as tools for identifying numerous key pathways implicated in immunological responses such as T cell and antigen-presenting cell (APC) activation mechanisms (11), defining minimal thresholds for T cell activation (3, 12, 13), identifying key residues responsible for peptide recognition in the TCR complementary determination region 3 (1416), characterizing T cell proliferation, tolerance, anergy, and apoptosis (1720), defining intracellular signaling in APCs activated via cross-linking of MHC class II molecules (2123), profiling cytokines released when APCs are activated via MHC class II (24), elucidating peptide presentation pathways in MHC class II-positive cells (2527), and studying lipid raft formation and signaling, which is currently a topic of much interest (28).
To stringently monitor the behavior of experimental systems using SAgs, it is essential to possess a maximum of biochemical and structural data on how they interact with their receptors. Much effort has been devoted to resolving the crystalline structures of certain SAgs alone or bound to MHC class II molecules (2937). These studies have provided a wealth of data needed to design experimental procedures. However, we still have very little information on the modes of interaction of most members of the SAg family. It is well known that each SAg has a unique way of interacting with the TCR, MHC class II molecules, and the presented antigen. While several SAgs share common binding residues to MHC class II and TCR V
Based on co-crystal analysis, site-directed mutagenesis, and competitive binding studies, it has become clear that three different modes of interaction can govern SAg binding: 1) SAgs that bear one MHC class II-binding site and interact mostly with the Mycoplasma arthritidis-derived mitogen (MAM) is a less studied SAg initially neglected because it was thought to act exclusively in mice and rats but has generated much interest since it was shown to bind human MHC class II molecules (38). This particular SAg is produced by mycoplasmas and has the unique property of inducing a spontaneous, chronic form of arthritis in genetically susceptible strains of rodents that histologically resembles rheumatoid arthritis in humans (42). Unlike current murine models of human arthritis such as K/BxN mice (43) or collagen-induced arthritic mice (44), serum from MAM-induced arthritic mice does not cause the disease when injected into healthy mice and is more representative of the human form of the disease (4548). This feature is essential in developing a representative model for arthritis because adoptive transfer experiments should not cause disease when transferring serum from an arthritic subject to a normal host. MAM may therefore offer hope for developing a more representative murine model of human rheumatoid arthritis. A comprehensive, detailed model of MAM interactions with both MHC class II-positive and T cells is therefore essential.
We have unraveled some of the mystery surrounding MAM interactions with human cells over the past few years. Although M. arthritidis is thought to be essentially a murine pathogen, we have shown that MAM binds to human MHC class II with an affinity similar to that of other staphylococcal SAgs and can potently activate APCs and T cells (38, 50). We also have discovered that MAM can cross-link MHC class II in the presence of zinc ions (51). The results presented in this report indicate that MAM forms dimers in the presence of zinc ions. By generating MAM deletion mutants, we identified key residues involved in zinc binding to MHC class II, which is required for APC activation. We also show that, even in absence of zinc binding residues, MAM can be presented as monomers at undetectable levels by MHC class II and can activate certain V
Cell LinesThe human Epstein-Barr virus-transformed B lymphoblastoid cell line LG2 (DR1/DR1) and the murine T cell clones 3DT (V 8.2), RG17 (V 6), and Kmls (V 15.8) were provided by Dr. R. P. Sékaly (Institut de Recherches Cliniques de Montréal, Montreal, Canada). The human B cell line LAD (derived from a LFA-1-deficient patient) was kindly donated by Dr. R. Geha (Children's Hospital, Boston, MA). The B cell lines and murine T cell clone 3DT were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum, L-glutamine, penicillin, streptomycin, and 2-mercaptoethanol. The murine T cell clones RG17 and Kmls 15.8 were maintained in Iscove's medium supplemented with 10% fetal bovine serum, L-glutamine, penicillin, streptomycin, and 2-mercaptoethanol. The IL-2-dependent CTLL-2 T cell clone was cultured in RPMI 1640 medium supplemented with 10% fetal calf serum and 5 units/ml IL-2. Antibodies, Peptides, and SuperantigensRecombinant SEA and MAM (wild type MAM (MAMwt), MAM-21, and MAM-15) were produced as GST fusion proteins as described previously (38, 41). MAMwt is the wild-type, full-length 213-amino acid protein with a molecular mass of 25 kDa. MAM-15 and MAM-21 have deletions from residues 132 to 213 and 177 to 213, respectively, in their C termini. Histidine 14 and aspartic acid 31 substitutions were generated by PCR using specific primers: 5'-CATTAGGATCCATGAAACTTAGAGTTGAAAGTCCTAAAAAAGCTCAAAAGGCTTTTGTGCAAAATTTAAATAATGTTGTATTTACTAATAAAGAGCTTGAAGCTATCTACAATT-3' and 5'-GTTATATGAATTCAATATTAATCTTC-3'. The PCR products were digested with EcoR1 and BamH1 and ligated into the pGEX-6P-1 plasmid. Based on the MAM sequence (52), three different peptides corresponding to various MAM regions were synthesized by Alpha Diagnostic (San Antonio, TX). Peptide 1, amino acids 1431: HFVQNLNNVVFTNKELED; peptide 2, amino acids 7690: FNMMFLKLSVVFDTQ; and peptide 3, amino acids 197211: DIELKTTSDFAKAVF. SDS-PAGE Analysis of Zn2+-induced MAM DimerizationAll toxins were incubated in the presence of 2 mM dithiothreitol for 30 min. The cross-linking agent bismaleimidohexane (BMH, Pierce) was dissolved in sodium phosphate buffer (pH 7.0) in the presence of 10 mM Me2SO prior to coupling with the proteins. Dithiothreitol was removed by dialysis with zinc-free PBS. The samples were then incubated in the presence or absence of 1 µM Zn2+ for 1 h. BMH was added to a final concentration of 1 mM, and the reaction was incubated for a further 2.5 h at 4 °C. Reactions were stopped with SDS sample buffer, boiled, and separated by electrophoresis in a 12% Tris/glycine acrylamide gel. The separated proteins were then stained with Coomassie Blue. Radiolabeling of SAgsTen micrograms of each toxin were iodinated in 30 µl of phosphate buffer (0.5 M, pH 7.4) with 0.25 µCi of 125I (PerkinElmer Life Sciences, 1 Ci = 37 GBq) and 0.1 M chloramine T (Sigma) for 2 min. The reaction was stopped by adding sodium metabisulfite and KI. The labeled protein samples were separated from free iodine on Sephadex G-25 columns (Bio-Rad) blocked previously with 2% bovine serum albumin. Specific activity for all experiments varied between 12,000 and 18,000 cpm/nmol.
Binding Assays and Kd EvaluationBinding assays, affinity measurements, and competition curves were performed as described elsewhere (40). Standard binding assays used 5 x 105 LG2 cells incubated with a 20-nM concentration of radiolabeled toxin in a 200-µl final volume of PBS containing 1% bovine serum albumin, 1 µM zinc, and 0.02% NaN3 for 2 h at room temperature. To purify samples by the removal of unbound toxins, the cell suspension was transferred to tubes containing an oil cushion (84% silicon oil, 16% mineral oil). Cell pellets containing intact cells bound to toxins were recovered after centrifugation, and their activity (cpm) was determined using a Cell-Cell Adhesion AssayA 100-µl suspension of LAD cells (106 cells/ml) was added to the wells of a 96-well microtiter plate. SAgs were then added to a final concentration of 5µg/ml. After 3 h of stimulation at 37 °C in a CO2 incubator, cell-cell adhesion was monitored using a light microscope, and photographs were taken.
T Cell Proliferation ([3H]Thymidine Incorporation)The assay was performed as described elsewhere (38). Briefly, 2 x 104 APCs were added to 8 x 104 T cell clones (3DT, RG17, or Kmls) in a 96-well microtiter plate in the presence of different concentrations of MAMwt and mutant MAM (MAMmut). After a 24-h incubation at 37 °C, the supernatants were collected and added to IL-2-dependent CTLL-2 cells. [3H]Thymidine (0.5 µCi/well) was then added, and the plate was incubated for a further 16 h. After the final incubation, [3H]thymidine incorporation was measured using a Coulter
Zinc Ions Are Required for MAM/MAM Homodimer FormationWhile our recent studies indicated that zinc is an absolute requirement for MAM/MHC class II interactions, zinc ions do not coordinate MAM binding to HLA-DR molecules through histidine 81 of the -chain as demonstrated for other zinc-dependent SAgs (22, 41). Based on these observations, we hypothesized that zinc ions may be required for the formation of MAM/MAM homodimers as reported previously for SED (22, 41) or for the coordination of MAM binding to HLA-DR through a zinc-binding motif other than histidine 81 as suggested for SEH (53). To investigate the first possibility, zinc was added to the recombinant MAM protein followed by the BMH cross-linker. This cross-linker creates a covalent link between cysteines of two SAgs brought in close proximity by zinc ions. Protein complexes were then analyzed by SDS-PAGE as described for SED (41). The SDS-PAGE analysis (Fig. 1A) shows that, like SED, MAM could only be detected as a dimer when samples were treated with zinc followed by BMH cross-linker. In contrast, and as expected, SEA failed to form dimers under these conditions.
Involvement of Histidine and Aspartic Acid in Dimer FormationIn recent studies, we demonstrated that the MAM/HLA-DR interaction is completely inhibited by peptides encompassing MAM residues 1431 (peptide 1) and residues 7691 (peptide 2) but is not affected by a peptide encompassing residues 197211 (peptide 3) (51). It was also reported that peptides 1 and 2 can inhibit MAM-induced lymphocyte proliferation (52). Based on these observations and the above results, we looked at whether one of these MAM regions is involved in dimer formation. To address this issue, we tested the three peptides for MAM dimer inhibition. Interestingly peptide 1, which encompasses residues 1431, inhibited dimer formation by 69%, whereas the other two peptides had no effect (Fig. 1B). These results indicate that amino acid residues located in peptide 1 might play an important role in coordinating binding to zinc ions through dimer formation. To identify the residues specifically involved in zinc coordination, we referred to previous studies with SED showing a critical role of histidine (His) and aspartic acid (Asp) in SED/SED dimer formation (41). According to the literature, at least two different residues from each molecule coordinating a zinc ion are required for homodimer formation. Known amino acids capable of coordinating zinc are histidine, glutamic acid, and aspartic acid (54). Peptide 1 (HFVQNLNNVVFTNKELED) has a histidine at position 1 (His-14) and an aspartic acid at position 18 (Asp-31). We therefore hypothesize that these are the most likely residues involved in MAM dimerization. By site-directed mutagenesis, a codon coding for alanine (GCT) was substituted at positions occupied by His-14 (CAT) and Asp-31 (GAT) in MAM cDNA. MAMmut recombinant protein was produced in Escherichia coli as described for MAMwt. Both MAMwt and MAMmut were tested for dimer formation in the presence of zinc. Fig. 2A shows that substitution of His-14 and Asp-31 by alanine completely abolished zinc-induced MAM/MAM dimer formation. In contrast, zinc-induced dimer formation using MAM deletion mutants (38) MAM-21 (deletion of residues 197213) and MAM-15 (deletion of residues 131213) was unaffected as dimers can be seen at the expected sizes (Fig. 2B). These results now allowed us to conclude that His-14 and Asp-31 residues are critical for dimer formation. Indeed, since MAMwt and MAM-15 have a similar binding affinity to MHC class II molecules and MAM-15 is deleted of the C terminus (residues 132231), it is obvious that all MAM residues involved in MHC class II binding are located in this fragment, which is in accordance with our recent published observation (38).
MAM-21, MAM-15, and MAMwt Have Similar HLA-DR Binding AffinitiesWe then examined the binding affinities of truncated MAM-21 and MAM-15 to MHC class II to determine whether there were any other key binding residues implicated in the binding of truncated proteins. Binding assays were done in PBS containing bovine serum albumin and sodium azide thereby preventing internalization and turnover of receptors on the cell surface (38). Fig. 3A shows the results of a MAM/MHC class II binding competition assay using labeled MAMwt, cold MAM-21 and MAM-15, and MHC class II expressed on LG2 cells. Our results indicate that MAMwt binding to LG2 cells was inhibited by MAMwt, MAM21, and MAM15 in a dose-dependent fashion. Similar amounts of the inhibitors were required to achieve 50% inhibition, which strongly suggests these three forms of MAM had a comparable binding affinity to MHC class II expressed on LG2 cells. To further confirm this data, the binding affinities of labeled MAM-21 (Fig. 3B) and MAM-15 (Fig. 3C) were evaluated on LG2 cells. Our results show that MAM-21 had a 47 nM affinity (Kd) for HLA-DR1 on LG2 cells, and MAM-15 had a 76 nM affinity. These are comparable to the values reported previously for MAMwt (25 nM) (51). Binding of MAM and MAM mutants is specific for HLA-DR and can be completely blocked by the DR-specific L243 monoclonal antibody (data not shown) as reported previously (51). These results strongly indicate that all critical residues involved in the interaction with HLA-DR and in zinc coordination were located within the first 131 amino acid residues of MAM.
Substitution of His-14 and Asp-31 by Alanine Abolishes Dimer Formation and the MAM/MHC Class II Interaction Having identified the role of His-14 and Asp-31 in dimer formation, we assessed the binding of MAMmut to MHC class II. LG2 cells were incubated with 125I-radiolabeled MAMmut in the presence or absence of a 100-fold excess of unlabeled MAMmut. Experiments were performed as described under "Experimental Procedures." Interestingly our results indicate that, unlike MAMwt, substitution of His-14 and Asp-31 for alanine also abolished the ability of MAMmut to interact with MHC class II molecules (Fig. 4A). However, when MAMmut was used to inhibit binding of labeled MAMwt to LG2 cells, a slight inhibition was observed at high doses (Fig. 4B), suggesting MAMmut was still able to interact with MHC class II but with a low binding affinity that was not detectable in our binding assays.
MAMmut Is Incapable of Inducing Cell-Cell AdhesionEngagement of MHC class II molecules on B cells, monocytes, fibroblast-like synoviocytes, and activated T cells by SAgs leads to various cellular events that modulate cell functions. One of these events can be the induction of cell-cell adhesion mediated by the LFA-1-dependent and -independent systems, a phenomenon that is well characterized for SEA, SEE, SED, SPE-C, MAMwt, and TSST-1 (38, 5559). TSST-1-induced cell-cell adhesion does not require the dimerization of MHC class II molecules on the cell surface, whereas adhesion induced via the other SAgs is linked to the dimerization of MHC class II molecules. To analyze the functional consequences of substituting alanine for His-14 and Asp-31, we examined the ability of MAMmut to trigger cell-cell adhesion. To this end, the LAD B cell line (derived from a LFA-1-deficient patient) was plated alone (Fig. 5A) or was stimulated with SEA (Fig. 5B), SEB (Fig. 5C), MAMwt (Fig. 5D), or MAMmut (Fig. 5E) and analyzed for cell-cell adhesion. Fig. 5 shows that MAMwt induced homotypic aggregation of LAD cells similar to that observed with SEA, whereas MAMmut and SEB failed to induce a detectable response. These results indicate that MAMwt formed zinc-dependent dimers in solution, enabling the engagement of two HLA-DR molecules on the cell surface. The presence of His-14 and Asp-31 is a critical requirement for such a response.
Substitution of His-14 and Asp-31 for Alanine Significantly Affects MAM-induced T Cell ActivationWe used a functional assay to investigate the effect of the His-14 and Asp-31 mutations on T cell activation. To this end, we examined IL-2 production by murine T cell hybridomas expressing different V
MAM Interaction with MHC Class II and the TCRWe propose the first MAM binding model in Fig. 7 based on data presented here and previously published observations on the MAM SAg. This model shows the interaction of MAM with TCR and MHC class II molecules in the presence and absence of zinc. When in the presence of zinc, MAM forms dimers capable of activating APCs through MHC class II dimerization. The histidine residue at position 81 of the HLA-DR
Over the past few years, an extensive effort has been made to study the structure/function interactions of SAgs with MHC class II molecules. Based on co-crystal structure analysis and site-directed mutagenesis studies, it is now well established that SAgs can be divided into two major families. The first family requires zinc for binding to MHC class II molecules, whereas the second family binds to these molecules in a zinc-independent fashion. Although MAM belongs to the first group of SAgs, it is not yet known how zinc coordinates its interactions. In this study, we demonstrated that zinc was required for MAM/MAM dimer formation. We identified two key residues (histidine 14 and aspartic acid 31) in the MAM sequence that were part of the zinc-binding motif. Alanine substitution for residues His-14 and Asp-31 abolished zinc-induced MAM dimer formation with dramatic effects on MAM binding to MHC class II molecules and T cell activation. While numerous SAgs are capable of zinc binding, their actual relationships with zinc ions as well as the distance between residues involved in the interaction are extremely divergent (54). Zinc appears to play two major roles in the SAg world: the first is to bridge two MHC class II molecules, resulting in signal transduction and APC activation, and the other is to stabilize and augment the binding affinity of the SAg for MHC class II molecules. The effects of zinc on SAg-mediated T cell activation are as diverse as SAgs themselves. Some SAgs that depend on zinc for MHC class II binding, like SPE-C or SEC for example, do not require zinc ions for T cell activation (54, 62), while others like SEA need zinc to adopt the right conformation for V engagement (49). MAM, on the other hand, is unique because it can still bind MHC class II and activate certain repertoires of T cells in the absence of zinc although to a much lesser degree. It is therefore highly likely that zinc-induced MAM dimerization can also lead to a change in the conformation of the derived MAM/MAM dimers. This would result in significant binding to MHC class II molecules and a significant modification in MAM topology that would be recognized by the specific V element of TCRs, particularly those that exhibit a low affinity interaction with MAM. What is surprising with MAM is that it has very little homology with any other SAgs; only a few short motifs are shared with SEA, SEB, SEC1, and MMTV-7 (52). Another intriguing feature of MAM is that the MHC- and zinc-binding domains are in the N terminus of the protein, while they are located more toward the C terminus with all other zinc-binding SAgs (54). These particular features could enable MAM to function as a T cell mitogen in all circumstances and environments with an intensity that is a direct function of zinc levels. Zinc binding may have played an evolutionary role for M. arthritidis by modulating the potency of MAM and thus preventing disastrous consequences to the host.
Using competitive binding assays between MAMwt, MAM-21, and MAM-15, we established that crucial MHC class II-binding motifs are all located within the first 131 amino acids of the MAM sequence, while TCR binding residues are located within the C-terminal region (38). This interesting feature could be exploited in assays requiring interactions between APCs activated via MHC class II and resting T cells. Binding assays also reveal that only a single binding site is detectable on MHC class II molecules the in the presence of zinc. We believe that MAM forms homodimers by interacting with zinc ions using at least two critical residues (His-14 and Asp-31) on each MAM molecule. However, high affinity binding to MHC class II molecules in the presence of zinc is mediated via a single residue on the HLA-DR Competitive binding assays between MAMwt and MAMmut revealed that, while no MAMmut binding was detectable, MAMmut was successful in partially competing with MAMwt for HLA-DR binding. For certain hybridomas, T cell activation was also observed using high concentrations of MAMmut. These results suggest that the main biological role for zinc might be to induce a conformational change in the MAM structure when zinc-dependent dimers form. These new structures would then expose new MHC class II- and TCR-binding epitopes. Although MAM monomers appear to bind with low affinity to MHC class II molecules, they do not induce APC activation as seen in the adhesion assays. It is also likely that both high and low affinity binding sites are on the same HLA-DR chain since, in the absence of zinc, MAMwt does not induce homotypic adhesion. Because of the growing interest in MAM as a tool to develop a new arthritic mouse model, it has become urgent to unravel the intricacies of MAM binding to MHC class II molecules and to the TCR. The sum of evidence gathered on the matter now suggests that MAM binding affinity and the potency of T cell activation is modulated by two important factors: zinc availability and bound HLA-DR antigens (51). Reduced binding of MAM to cells expressing HLA-DR1 molecules loaded with the influenza hemagglutinin peptide or with the MHC class II-associated invariant chain (Clip) may hint at a possible tissue-specific role of MAM as we would expect of this murine arthritogenic agent (51). Data reported here will allow us to propose the first detailed binding model for MAM in the presence and absence of zinc. Restricting zinc usage does not abolish MHC class II binding but rather inhibits MHC class II cross-linking and greatly diminishes the ability of MAM to activate T cells. MAM could thus be used as tool for studying second signal activation mechanisms or T cell activation thresholds. While much is now known about MAM binding and its functional characteristics, we still have not identified the MHC class II binding residues. Based on the results reported here and other recent observations pointing to the important role of residues 7690 in MAM binding, we made an extensive effort to determine the exact residues involved in the interaction (51). To this end, we generated a panel of single amino acid mutants to study binding to MHC class II molecules. Unfortunately our results suggest that several amino acids were involved in the MAM/MHC class II interaction. To overcome this difficulty and definitely determine the residues involved, we are currently working on defining the co-crystal structure of MAM bound to HLA-DR in the presence of zinc. Identification of these residues will provide a wealth of information regarding allele usage and general target binding availability within a polymorphic population, which should lead to a better understanding of the mechanisms involved in human rheumatoid arthritis pathogenesis.
* This work was supported by grants (to W. M.) from the Canadian Arthritis Society, the Canadian Arthritis Network, and the Canadian Institutes of Health Research. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 The abbreviations used are: SAg, superantigen; MHC, major histocompatibility complex; APC, antigen-presenting cell; MAM, Mycoplasma arthritidis-derived mitogen; TCR, T cell receptor; IL, interleukin; BMH, bismaleimidohexane; MAMwt, wild type MAM; MAMmut, mutant MAM; PBS, phosphate-buffered saline; LFA-1, leukocyte function antigen-1; SEASEH, staphylococcol enterotoxin AH; TSST-1, toxic shock syndrome toxin-1; MMTV-7, mouse mammary tumor virus-7; SPE-C, streptococcal pyrogenic enterotoxin C.
We thank Dr. Rafick Sékaly (Unversité de Montréal) for providing the human Epstein-Barr virus-transformed B lymphoblastoid cell line LG2 (DR1/DR1) and the murine T cell clones 3DT (V 8.2), RG17 (V 6), and Kmls 15.8 (V ). We also thank Dr. Pierre Étongué-Mayer for technical assistance with the MAM dimerization experiments and with generating the MAM mutants.
This article has been cited by other articles:
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
Advertisement | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||