Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M210620200 on April 17, 2003

J. Biol. Chem., Vol. 278, Issue 26, 23451-23459, June 27, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/26/23451    most recent
M210620200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bevilacqua, A.
Right arrow Articles by Nicolin, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bevilacqua, A.
Right arrow Articles by Nicolin, A.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Bcl-2 Protein Is Required for the Adenine/Uridine-rich Element (ARE)-dependent Degradation of Its Own Messenger*

Annamaria Bevilacqua {ddagger} §, Maria Cristina Ceriani {ddagger} §, Gianfranco Canti {ddagger}, Laura Asnaghi {ddagger}, Roberto Gherzi ¶, Gary Brewer ||, Laura Papucci **, Nicola Schiavone **, Sergio Capaccioli ** and Angelo Nicolin {ddagger} {ddagger}{ddagger}

From the {ddagger}Department of Pharmacology, University of Milan, 20129 Milan, Italy, the National Cancer Institute, 16132 Genoa, Italy, the ||Department of Molecular Genetics and Microbiology, Robert Wood Johnson Medical School, University of Medicine and Dentistry of New Jersey, Piscataway, New Jersey 08854, and the **Department of Experimental Pathology and Oncology, University of Florence, 50134 Florence, Italy

Received for publication, October 17, 2002 , and in revised form, March 31, 2003.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
We have shown previously that the decay of human bcl-2 mRNA is mediated by an adenine/uridine-rich element (ARE) located in the 3'-untranslated region. Here, we have utilized a non-radioactive cell-free mRNA decay system to investigate the biochemical and functional mechanisms regulating the ARE-dependent degradation of bcl-2 mRNA. Using RNA substrates, mutants, and competitors, we found that decay is specific and ARE-dependent, although maximized by the ARE-flanking regions. In unfractionated extracts from different cell types and in whole cells, the relative enzymatic activity was related to the amount of Bcl-2 protein expressed by the cells at steady state. The degradation activity was lost upon Bcl-2 depletion and was reconstituted by adding recombinant Bcl-2. Ineffective extracts from cells that constitutively do not express Bcl-2 acquire full degradation activity by adding recombinant Bcl-2 protein. We conclude that Bcl-2 is necessary to activate the degradation complex on the relevant RNA target.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The bcl-2 gene plays an important role in cell survival, differentiation, and oncogenesis (1, 2). A large number of human cancers, including solid tumors, express abnormally high amounts of Bcl-2 protein (3). Bcl-2 expression has prognostic relevance (4) as well as importance for therapy, since it influences cell sensitivity to chemo- and radiotherapy (5). Despite extensive efforts, the molecular mechanisms leading to increased expression of bcl-2 in human cancer have not been elucidated (6, 7). Both transcriptional and post-transcriptional events might contribute to determining the rationale for overexpression of Bcl-2 in cancer cells (8, 9). Many attempts have been made to develop biological or pharmacological means of controlling bcl-2 expression (10–12), including the use of antisense compounds (13, 14) currently under clinical investigation for chemosensitizing activity (15).

In the regulation of steady-state levels of transcripts in cells, mRNA decay has received much emphasis recently (16). The role of cis elements flanking the coding region has been clearly recognized (17). The adenine/uridine-rich elements (AREs),1 identified in a large number of genes, including immediate-early genes (18), cell-cycle genes (19), and cytokines and their receptors (20), are discrete nucleotide structures located in the 3'-UTR of mRNAs. The importance attributed to ARE results from the discovery of its specific fine-tuning of steady-state levels of many transcripts effectively regulating the level of the encoded protein products in cells (21, 22). Actually, ARE functions as the binding site for a number of proteins, the adenine/uridine binding elements or AUBPs (23–25) that recruit a complex of exonucleases, termed exosome (26).

In previous studies we described an ARE located in the 3'-UTR of bcl-2 mRNA (b-RNA) whose nucleotide structure is similar to the ARE in GM-CSF mRNA (27) and is required for bcl-2 mRNA decay in vivo (28). We have also shown that the activation of an apoptotic program specifically induces ARE-dependent bcl-2 mRNA degradation (29).

Until now, specific ribonuclease activity in extracts of cells from different lineages has not been evaluated using a transcript carrying the ARE motif. It is possible that the nuclease specificity or efficiency in different lineages regulates the amount of the Bcl-2 protein. It might be of practical importance to understand the determinants of mRNA decay of genes such as bcl-2, expressed at different levels in tissue-specific programs (30) or under different metabolic conditions (31). Cell-free degradation assays have been very useful in analyzing mRNA turnover (32, 33), and important findings have been made in recent years by taking advantage of such systems (34, 35, 26).

Here, we investigated the elements that regulate either the decay rate of the ARE-containing b-RNA in cis or in trans, taking advantage of an in vitro degradation assay. In addition to defining the essential cis elements required for the exonuclease activity, an essential role was found for Bcl-2 protein in activating the degradation machinery on the relevant target.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Cell lines, Culture Conditions, and Drug Treatment—Cell lines were maintained in RPMI 1640 supplemented with 1% glutamine, antibiotics, and 10% fetal calf serum added under standard conditions. Viability was monitored by the trypan blue exclusion assay.

The following cell lines were used: three human follicular t (14, 18)-positive B-cell lymphomas DOHH2 (36), SU-DHL-4 (37), and Karpas 422 (38); Burkitt lymphoma Raji (39), Namalwa (40), and Daudi (41), T-cell leukemia MOLT-4 (42); promyelocytic leukemia HL60 (43), mammary gland adenocarcinoma MCF-7 (44), human neuroblastoma SHSY5Y (45), and LAN-5 (46). Jurkat-NEO and Jurkat-BCL-2 cells are polyclonal populations of G418-resistant Jurkat T-cell leukemia cells that were transfected with pZIP-NEO and pZIP-Bcl-2 plasmid DNA, respectively, as described previously (47).

Plasmids—The 5'-primer AGATCTAGTCAACATGCCTGC and the 3'-primer GGATCCGGTGATCCGGCCAACAAC (flanked at the 5'-end by BglII and BamHI restriction sites, respectively) were used in PCR to amplify the 396-bp U1 segment containing the 3'-UTR ARE sequence from the human bcl-2 cDNA fragment (48). This segment was cloned in the TA cloning site of the pCRII plasmid according to the TA Cloning Kit specification (Invitrogen Corp., San Diego, CA), to produce the pCR-U1 plasmid. A fragment from this plasmid amplified with the 5'-primer GACCATGGGTCGAATCAGCTATTTAC and the 3'-primer GACCCGGGGATTTCCAAAGACAGGAG was subcloned in pCRII to produce the pCR-U3 plasmid used for in vitro transcription of b-ARE. pCR-U1 was also amplified with the following pairs of primers: 5'-primer AGATCTAGTCAACATGCCTGC/3'-primer TTCGACGTTTTGCCTGAAGACT; and 5'-primer CAAAACGTCGAACGACCACTAATTGCCAAGC/3' primer GGATCCGGTGATCCGGCCAACAAC. The PCR products are partially complementary, so they were annealed and subsequently amplified with the external primers to generate the {Delta}b-RNA fragment. It was cloned in plasmid pCRII to produce plasmid pCR-U2.

A 394-bp segment of the human c-myc 3'-UTR, was obtained by PCR amplification using 5'-GCGGGGCCCACTTTTTTATGCTTACCATC-3' and 5'-GCGCCCGGGCAATAGAAAAAAATCAACTT-3' as forward and reverse primers, respectively. The amplification product of the myc 3'-UTR segment was inserted into the cloning vector pGEMT, provided with the easy vector system (Promega Italia, Milan, Italy), to obtain pGEMT-MYC-RNA.

A DNA fragment containing the 3'-UTR of IL-2 (590–780 bp) was subcloned between the HincII and KpnI sites of pCY2 as described previously (49).

The control plasmids pTRI-IGFR and pTRI-GAPDH (Ambion, Austin, TX) were linearized with the restriction enzyme BamHI (Amersham Biosciences) and used for in vitro transcription reactions with SP6 RNA polymerase (Promega Italia, Milan, Italy). The pTRI-GAPDH-Rat antisense control template contains a 316-bp fragment of the rat glyceraldehyde-3-phosphate dehydrogenase gene that is derived from exons 5–8. The pTRI-IGFR-human transcription template contains a 276-bp cDNA fragment of the human insulin-like growth factor-1 receptor gene, which spans exons 7–8 in the antisense orientation. The pSS transcription plasmid, obtained by cloning rat somatostatin cDNA into plasmid pSP65 (Promega Italia, Milan, Italy), was kindly provided by Dr. A. Torsello.

Preparation of Cell Lysates and Immunodepletion—Cells (20 x 106) were centrifuged at 1200 rpm for 10 min at 4 °C; the pellet was washed three times with phosphate-buffered saline at 4 °C and resuspended in 0.25 ml of Buffer A (10 mM Tris acetate, 40 mM potassium acetate, 3 mM magnesium acetate, pH 7.6, 5% glycerol; after autoclaving, we added 2 mM dithiothreitol, 0.57 mM phenylmethylsulfonyl fluoride, 0.1 mM sodium vanadate, 50 mM sodium fluoride, 2 µg/ml leupeptin, and 1 µg/ml aprotinin). The cells were vortexed, incubated at 4 °C for 30 min, and lysed by sonication. The lysate was centrifuged at 12,000 x g for 20 min at 4 °C, and the supernatant was used immediately or frozen. Protein concentrations were measured using the Micro BCA Protein Assay (Pierce). S100 preparation from Jurkat cells and immunodepletion were performed as described previously (26).

In Vitro Transcription—Transcripts were synthesized in vitro using SP6 or T7 (for pGEMT-MYC-RNA) RNA polymerase according to the manufacturer's instructions (Promega Italia) incorporating DIG-labeled NTPs (Roche Diagnostics, Milan, Italy). The 32P transcripts were obtained as described previously (49).

In Vitro Degradation System—The degradation reaction mixture contained 1 µg of lysate, 10 µg of carrier tRNA, and 5 ng of transcript for each time point. Samples of 3 µl of degradation reaction mixture were taken and mixed into 10 µl of urea buffer (7 M urea, 2% sodium dodecyl sulfate, 0.35 M NaCl, 10 mM EDTA, 10 mM Tris-HCl, pH 7.6, and 1 mg/ml carrier tRNA). 10 µl of phenol/chloroform (1:1), 30 µl of deionized formamide, and 5.75 µl of gel loading buffer (50% glycerol, 1 mM EDTA, pH 8.0, 0.25% bromphenol blue, 0.25% xylene cyanol) were added, the mixture was vortexed, heated at 70 °C for 5 min, electrophoresed on a 5% polyacrylamide gel containing 8 M urea, and transferred to a nylon filter (Amersham Biosciences) by a Semi-Dry transfer cell (Bio-Rad). The DIG-labeled transcripts were detected with the digoxigenin system (Roche Diagnostics). For competition experiments, 0.3 µg of cell extract were incubated on ice for 10 min with unlabeled competitor RNAs in 100-fold molar excess over labeled transcript before the incubation with DIG-labeled RNA.

In the experiments using rBcl-2, corresponding to amino acids 1–205 of Bcl-2 of human origin (Santa Cruz Biotechnology, Santa Cruz, CA), the cellular extracts (4 µg) were preincubated with rBcl-2 at 25 °C for 10 min and then incubated with the transcripts. Recombinant Myc protein (rMyc), corresponding to amino acids 1–262 of Myc of human origin (Santa Cruz Biotechnology), was used as control. In vitro analysis of 32P-labeled RNA decay was described previously (49).

Determination of bcl-2 mRNA Decay in Cells—Cells were treated with the transcription blocker 5,6-dichloro-1-{beta}-D-ribofuransoylbenzimidazole (DRB) (Sigma-Aldrich) at a final concentration of 20 µg/ml for 6, 7, 8, 10, 12, and 14 h. Total cellular RNA was extracted at the indicated times using the NucleoSpin RNA II columns (Macherey-Nagel, Düren, Germany) according to the manufacturer's instructions. The RNA was treated with RNase-free DNase (Invitrogen) in order to avoid possible DNA contamination. The purity and integrity of the RNA were checked spectroscopically and by gel electrophoresis, respectively, before carrying out the analytical procedures. Levels of bcl-2 and GAPDH mRNAs were determined by the semi-quantitative RT-PCR method. For synthesis of cDNA, 1 µg of total RNA was reverse-transcribed with Random Hexamers (Promega Italia) using standard manufacturer's conditions. The RT reaction was split into 2 PCR reactions with 2 sets of specific primers. The PCR primer sequences are as follows: bcl-2 (139-bp PCR product) forward: 5'-GTCATGTGTGTGGAGAGCGT-3' and reverse: 5'-ACAGTTCCACAAAGGCATCC-3'; GAPDH (195-bp PCR product) forward: 5'-ATGACAACTTTGGTATCGTG-3' and reverse: 5'-CAGTGAGCTTCCCGTTCA-3'. The PCR reactions were carried out in a total volume of 100 µl in a Hybaid Omn-E thermal cycler under the following conditions: denaturation at 94 °C for 1 min (94 °C for 2 min in the initial cycle), annealing at 60 °C for 1 min, and elongation at 72 °C for 1 min, followed by a final step of 7 min at 72 °C. For every oligonucleotide pair, a preliminary analysis was conducted to define the appropriate range of cycles consistent with an exponential increase in the amount of the DNA product. For each sample 20 µl of PCR amplification product were analyzed on a 3% agarose gel and stained with ethidium bromide. A standard DNA molecular weight ladder (GeneRuler 100-bp DNA Ladder, M-Medical, Genenco, Firenze, Italy) was run to provide appropriately sized markers. The amount of each amplification product was determined by densitometer analysis. The mRNA half-life was determined from a semilogarithmic transformation of the densitometric data plotted against the time of incubation with DRB.

Western Blot Analysis—Samples of 4 x 106 cells were collected by low-speed centrifugation and washed twice in ice-cold phosphate-buffered saline. The cell pellet was resuspended in 60 µl of lysis buffer (ice-cold radioimmune precipitation assay buffer with freshly added protease inhibitors), vortexed for 3 s, and incubated on ice for 30 min. The lysates were centrifuged at high speed for 20 min at 4 °C. 5 µlofthe supernatant was removed for protein determination, transferred to a microcentrifuge tube, mixed with reducing buffer, and heated to 99 °C for 2 min. Equal amounts of proteins were analyzed by 12% SDS-PAGE, blotted onto polyvinylidene difluoride membranes (Immobilon P, Millipore, Bedford, MA) in a Bio-Rad Trans-blot apparatus at 100 V for 90 min. Blots were processed by an enhanced chemoluminescence (ECL Plus) detection kit as instructed by the supplier (Amersham Biosciences). The blots were probed with a mouse anti-Bcl-2 (Santa Cruz Biotechnology) and a rabbit anti-actin (Sigma-Aldrich) antibody, followed by a horseradish peroxidase-conjugated secondary antibody.

RNA Electrophoretic Mobility Shift Assay (REMSA)—REMSAs were performed by incubating the radiolabeled b-RNA and {Delta}b-RNA riboprobes (5 x 105 cpm) with 100 ng of rBcl-2, which were then digested for 20 min at room temperature with 5 units of RNase T1 (La Roche Ltd.), which cuts RNA downstream to guanosine residues into a number of fragments. Samples were separated on a native polyacrylamide gel (6% polyacrylamide/bisacrylamide, 60:1).

UV Cross-linking Assay (UVCA)—rBcl-2 protein was incubated with the 32P-labeled b-RNA and {Delta}b-RNA riboprobes (109 cpm/µg, 3 x 105 cpm) in the presence of 0.5 mg/ml heparan sulfate and 2 µg of tRNA in a microplate (total volume, 10 µl) at room temperature for 10 min. The RNA-protein complexes were cross-linked on ice by exposure to UVC for 5 min with 3000 milliwatts/cm2 in a Stratalinker 1800 (Stratagene, La Jolla, CA). Samples were incubated with RNase A (1 µl, 1 mg/ml) for 30 min at 37 °C to digest unbound RNA. Proteins were separated by 12% polyacrylamide-SDS gel electrophoresis (SDS-PAGE) under reducing conditions. The images were generated with a Cyclone imager (Packard BioScience).


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
ARE-dependent b-RNA Degradation in Vitro—We previously reported that the bcl-2 ARE located in the 3'-UTR is a cis-acting, regulatory element that can target a reporter mRNA for degradation in vivo (29). To examine ARE-directed RNA decay in a cell-free system, 3'-UTR fragments of bcl-2 obtained by PCR were cloned in a transcription vector and used for in vitro synthesis of transcripts (Fig. 1) that were labeled by incorporation of the precursor DlG-UTP. We chose to utilize transcripts that were neither capped at the 5'-end with 7mGpppG nor polyadenylated at the 3'-end. Our rationale was to examine ARE-directed RNA decay in its simplest form in the absence of these structures, since ARE-directed degradation of an mRNA can occur in a cap-independent fashion (50–52) and in the absence of a poly(A) tract (26, 53). Thus, at least some of the steps in the ARE-directed mRNA decay pathway can be uncoupled from processes that involve the cap structure and poly(A) tract. For decay assays, unfractionated cell lysates, derived from exponentially growing cells, were mixed with the relevant transcripts and incubated at 37 °C for various times. RNA was purified and fractionated in gels for detection and analysis. The in vitro assay shown here, although reproducing findings obtained with the S100 preparations, does not require biochemical fractionations, making the comparisons of extracts from different cell sources easier.



View larger version (17K):
[in this window]
[in a new window]
  		FIG. 1.
Plasmid clones and in vitro RNA substrates. Diagrams show bcl-2 gene clones transcribed in vitro to obtain RNA substrates used in the degradation assays. Thin lines, vector DNA. Dark boxes, SP6 phage RNA polymerase promoter. Open boxes, polylinker sequence. Dashed boxes, bcl-2 3'UTR sequence; transcriptional 5' and 3' termini are noted within the boxes. Appropriate restriction enzyme sites are also noted. Top, b-RNA. Plasmid pCR-U1 contains an SP6 promoter, 78 nucleotides of polylinker sequence, 406 nucleotides from the 3'-UTR of the bcl-2 gene, and 48 nucleotides of polylinker sequence. Middle, {Delta}b-RNA. Plasmid pCR-U2 was obtained from pCR-U1 by excising the core region from bcl-2 RNA (see "Experimental Procedures"). Bottom, b-ARE. Plasmid pCR-U3 contains the bcl-2 ARE core region.

 

Fig. 2A shows that b-RNA was rapidly degraded by a soluble extract prepared from the DOHH2 follicular B-cell lymphoma cell line. The half-life of 30 min was calculated by plotting the intensity of the bands analyzed by densitometry (lanes 1–5 and right panel). In the same assay, the GAPDH control transcript was not significantly degraded, the calculated half-life was longer than 2 h (lanes 6–10 and right panel). The specificity of the reaction was further verified by adding to the same reaction the b-RNA and the ARE-negative IGFR control transcript for the decay assay (Fig. 2B). The two transcripts were degraded with different kinetics. The calculated half-life for the b-RNA was 30 min while that for the IGFR transcript was more than 120 min (Fig. 2B, right panel). Multiple control RNAs were used in Fig. 2, A and B in order to provide substantial evidence that ARE-negative, synthetic RNAs are not significantly degraded under these assay conditions. We conclude from Fig. 2, A and B that an ARE-containing transcript is specifically degraded in this in vitro system.



View larger version (31K):
[in this window]
[in a new window]
  		FIG. 2.
Degradation kinetics of b-RNA, {Delta}b-RNA, and b-ARE and competition assay. A, left panel, b-RNA, 5 ng, was incubated at 37 °C with 5 µg of DOHH2 cell lysate. The reaction was stopped at the indicated times, products were separated by gel electrophoresis, and blotted on a filter for DIG detection (lanes 1–5). The GAPDH transcript, 5 ng, was used under the same conditions for control (lanes 6–10). The positions and lengths of the synthetic RNAs are indicated. Right panel, graph of the time course decay of the transcripts described in the left panel. B, left panel, 5 ng of b-RNA and 5 ng of IGFR RNA were mixed in the same tube before the addition of DOHH2 extracts and incubated at 37 °C for the indicated times. Reaction mixtures were denatured, separated by gel electrophoresis and blotted on a filter for DIG detection. Lane 1 shows the transcripts incubated for 120 min without the cell extract, lanes 2–8 transcripts incubated with cell extract for the indicated times. Right panel, graph of the time course decay of the transcripts described in the left panel. C, the {Delta}b-RNA was generated from plasmid pCR-U2, derived from pCR-U1 as described under "Experimental Procedures." Left panel, 5 ng of b-RNA and 5 ng of {Delta}b-RNA were mixed in the same tube before the addition of DOHH2 extracts and incubation at 37 °C for the indicated times. Reaction mixtures were denatured, separated by gel electrophoresis and blotted on a filter for DIG detection. Right panel, graph of the time course decay of the transcripts described in the left panel. D, b-ARE was obtained by cloning the core element of b-RNA, 99 nt from 938 to 1036 of bcl-2 cDNA containing the three copies of the AUUUA pentamer and one copy of the UUAUUUAUU nonamer, the key destabilization determinants. The irrelevant 5'- and 3'-flanking sequences of the pCR-U3 plasmid were present in the transcript. Left panel, 5 ng of b-ARE and 5 ng of GAPDH RNA were mixed in the same tube before the addition of DOHH2 extracts and incubated at 37 °C for the indicated times. Reaction mixtures were denatured, separated by gel electrophoresis and blotted on a filter for DIG detection. Right panel, graph of the time course decay of the transcripts described in panel A. E, left panel, 0.3 µg of cell extract were incubated on ice for 10 min with unlabeled competitor b-RNA (lanes 4–6) or rSS RNA (lanes 7–9) in a 100-fold molar excess over labeled b-RNA transcript before incubation with DIG-labeled b-RNA. Lane 10 shows the b-RNA in the absence of cell extract. Right panel, graph of the time course decay of the transcripts described in the left panel. The data from three assays are the mean values obtained by scanning laser densitometry. Bars indicate S.E.

 

To directly investigate the contribution of the bcl-2 ARE (b-ARE) to b-RNA decay in vitro, the central core of the 107-nt ARE was deleted ({Delta}b-RNA). {Delta}b-RNA was incubated with the DOHH2 extract for the decay assay. As shown in Fig. 2C, the {Delta}b-RNA lacking the consensus sequence degraded more slowly (half-life, 75 min) than the wild-type b-RNA (half-life, 30 min). This result suggests that, while the b-ARE is required for b-RNA decay, ARE-flanking regions in the 3'-UTR contribute to the full destabilizing potency of the bcl-2 3'-UTR.

The relevance of b-ARE shown in these studies prompted us to evaluate its decay kinetics. The b-ARE transcript and an unrelated transcript were prepared and incubated with the DOHH2 extract. Fig. 2D shows that the b-ARE was degraded much faster than the control RNA. The calculated 40–45 min half-life of b-ARE shows the crucial relevance of b-ARE for the nuclease activity (Fig. 2D, right panel). There was no measurable degradation of both transcripts when incubated under the same conditions in buffer alone.

The effects of competitor RNAs on b-RNA degradation in vitro were next evaluated. Extracts were preincubated with up to a 100-fold molar excess of unlabeled b-RNA or with equivalent amounts of a 500-nt rat somatostatin (rSS) synthetic RNA for 10 min prior to adding DIG-labeled b-RNA. Reactions were then incubated at 37 °C for various times to assess RNA decay. Fig. 2E shows the effects of the competitors on the half-life of the labeled b-RNA in the decay assays. The unlabeled b-RNA competitor slowed the decay rate significantly in a dose-responsive fashion compared with the somatostatin RNA (compare lanes 4–6 with lanes 1–3 and 7–9). Table I summarizes these results together with the measured half-lives of all the transcripts used. Taken together, these results suggest that the b-ARE may function through interactions with one or more factors that specifically recognize the ARE.


View this table:
[in this window]
[in a new window]
  		TABLE I
Degradation of b-RNA, mutated and control transcripts incubated with the DOHH2 cell extract

DOHH2 extracts were incubated with the transcripts for 2 h. At 0, 15, 30, 60, and 120 min the degradation reaction mixtures were electrophoresed on a 5% polyacrylamide gel. The degree of RNA decay was determined by autoradiography followed by scanning laser densitometry.

Data are representative of at least three independent experiments; average half-lives and S.E. are indicated.

 

Decay Activity of Extracts from Different Cell Lines—Using this cell-free mRNA decay system, b-RNA decay was investigated using extracts from a variety of human cell lines representing a spectrum of cell types. Our two goals were, first, to validate the cell-free system by comparing the relative decay rates obtained in vitro with those obtained in whole cells and, second, to determine if cell type-specific degradation of b-RNA occurs. The decay kinetics of RNA in extracts derived from different cell types, evaluated during a 60-min time course, are shown in Fig. 3. Although extracts from all the cell lines degraded b-RNA faster than the control IGFR RNA (half-life >120 min), the b-RNA half-lives varied widely as shown at the left in Fig. 3.



View larger version (52K):
[in this window]
[in a new window]
  		FIG. 3.
Degradation of b-RNA and IGFR transcripts by extracts from cell lines of different cell type. Cell extracts were incubated with the transcripts as indicated in the legend to Fig. 2. The degradation reactions were arrested at the indicated times. The reaction products were separated by electrophoresis on 5% polyacrylamide and gel blotted for detection. Experiments were performed with at least three preparations of each extract.

 

Extracts from the three cell lines containing a t (14, 18) translocation (DOHH2, DHL-4, and Karpas 422) and the two neuroblastoid cell lines (LAN-5 and SHSY5Y) displayed the fastest decay rates (b-RNA half-life: 25–30 min). Extracts from the B- and T-lymphoid cell lines (Namalwa, Raji, and MOLT-4) displayed intermediate decay rates (b-RNA half-life: 50–60 min), and extracts from myeloid (HL60) and epithelial (MCF-7) cell lines displayed the slowest decay rates (b-RNA half-life: 70–80 min). These differences were not due to differences in the quality of the extracts, since at least three preparations for each cell line were assayed, and the decay of the stable IGFR RNA was included as a standard control (Table II).


View this table:
[in this window]
[in a new window]
  		TABLE II
Comparison of b-RNA half-life in vitro and cellular Bcl-2 protein levels

The average half-lives and S.E. were calculated from the experiments shown in Fig. 3. Bcl-2 levels were evaluated by Western blotting (Fig. 6B) and shown by others. The degree of RNA decay was determined by autoradiography followed by scanning laser densitometry. Data are representative of three independent experiments.

 



View larger version (19K):
[in this window]
[in a new window]
  		FIG. 6.
Accelerated b-RNA degradation by Jurkat cell extracts overexpressing Bcl-2. A, left panel, b-RNA and IGFR control transcript, 5 ng, were incubated with 4 µg of Jurkat-BCL-2 (lanes 1–4) or with 4 µg of Jurkat-NEO cell lysates (lanes 5–8). Control sample without Jurkat lysate (lane 9). The assays were performed as indicated in the legend to Fig. 2, and data are representative of five experiments. Right panel, graph of the time course decay of the b-RNA transcript described in the left panel. The data are the mean values obtained by scanning laser densitometry. Bars indicate S.E. B, Bcl-2 protein levels were evaluated by Western blot, as indicated under "Experimental Procedures." Cell lines are indicated above each lane.

 
For comparison, the stability of bcl-2 mRNA was examined in vivo by treating cells with DRB, a selective inhibitor of RNA polymerase II, which can prevent transcriptional initiation with little effect on mRNA stability (54). An RT-PCR assay was used to measure levels of bcl-2 and GAPDH mRNAs versus time. The logarithmic phase of bcl-2 and GAPDH cDNA amplification was determined by PCR using progressive numbers of cycles (Fig. 4B).



View larger version (41K):
[in this window]
[in a new window]
  		FIG. 4.
Half-life of bcl-2 mRNA in different cell types. A, left panel, total RNA from cells exposed for 6 h to 20 µg/ml DRB was isolated at the indicated time points. RT-PCR was performed with bcl-2 (lanes 2–6) as well as GAPDH (lanes 7–11) primers as described under "Experimental Procedures." Lane 1, 100-bp DNA size marker; lane 12, no RNA in the reverse transcription step. Right panel, gels from the left panel were analyzed by densitometry and plotted in a semilogarithmic scale expressing the percentage of mRNA remaining (mean ± S.E.) versus time. The half-lives of bcl-2 mRNA are also indicated. The data shown are from three independent experiments. B, cDNA aliquots of reverse transcribed RNA from DOHH2 cells were amplified using various numbers of PCR cycles, as described under "Experimental Procedures." Amplification linearity for each five cycle increments was assessed by agarose gel-electrophoresis, analyzed by densitometry, and plotted.

 

Based upon these results, 20 cycles for GAPDH and 30 cycles for bcl-2 were employed for quantification. Fig. 4A shows the decay kinetics of bcl-2 mRNA as obtained from the semiquantitative RT-PCR assay along with the data quantified by densitometry (right panel). Similar to the in vitro results, the DOHH2 B-cell line and the neuroblastoid SHSY5Y cell line displayed the shortest bcl-2 half-lives of the group (~3 h), while HL60 and MCF-7 cells displayed the longest in vivo half-lives (6 and 8 h, respectively). We conclude that the cell-free system reproduces the rank order of bcl-2 mRNA decay rates exhibited among the different cell types.

Bcl-2 Is Required for the Rapid Degradation of b-RNA—First we investigated the role of the Bcl-2 protein in regulating b-RNA degradation using the cell-free system. While extracts prepared from Daudi cells that do not express the Bcl-2 protein (Ref. 55 and Fig. 6B) were ineffective to degrade the b-RNA (Fig. 5A and B, lanes 1–4), they were able to degrade myc-RNA (Fig. 5A). Most relevant, the addition of rBcl-2 protein to the degradation mixture makes Daudi cell extracts able to degrade b-RNA (Fig. 5B, lanes 5–8). In contrast, the addition of rMyc protein was unable to activate the degradation complex (Fig. 5B, lanes 9–12). Therefore, findings in Fig. 5, A and B show that the Daudi cell lysates are endowed with a functional degradation machinery although they require Bcl-2 protein to degrade b-RNA.



View larger version (20K):
[in this window]
[in a new window]
  		FIG. 5.
b-RNA degradation by rBcl-2-activated Daudi cell extracts. A, left panel, b-RNA and myc-RNA, 5 ng, were incubated at 37 °C with 4 µg of Daudi cell lysate (lanes 2–5). Control sample without Daudi lysate (lane 1). The assays were performed as indicated in the legend to Fig. 2, and data are representative of three experiments. Right panel, graph of the time course decay of the transcripts described in the left panel. B, left panel, b-RNA and control IGFR RNA, 5 ng, were incubated at 37 °C with 4 µg of Daudi cell lysate (lanes 1–4); with 4 µg of Daudi cell lysate preincubated with 32 ng of rBcl-2 (lanes 5–8); with 4 µg of Daudi cell lysate preincubated with 32 ng of rMyc (lanes 9–12). The assays were performed as indicated in the legend to Fig. 2, and data are representative of five experiments. Right panel, graph of the time course decay of the transcripts described in the left panel. The data are the mean values obtained by scanning laser densitometry. Bars indicate S.E.

 

Three independent factors further substantiated the specificity of the role of Bcl-2 in b-RNA degradation. First, extracts from Jurkat cells over-expressing Bcl-2 degrade b-RNA faster than extracts from mock-transfected cells (Fig. 6A). Second, Jurkat S100 extracts from which Bcl-2 was removed by immunodepletion (Fig. 7C), were not capable of degrading the radiolabeled b-RNA (Fig. 7A). In contrast, another ARE-containing RNA (IL-2 3'-UTR) was efficiently degraded by Bcl-2-depleted S100. Furthermore, while 32 ng of rBcl2 were able to reconstitute the b-RNA degradation activity of Bcl-2-depleted extracts, the same amount of rMyc was ineffective (Fig. 7B). Third, the b-RNA transcript but not the core-deleted {Delta}b-RNA can directly bind rBcl-2 in the REMSA assay, as shown in Fig. 8A. The UVCA confirmed the dose-dependent binding of the Bcl2-protein to its own RNA. The rBcl-2 binding to the mutated RNA deleted of the core ARE element is significantly reduced (Fig. 8B). The physical association of Bcl-2 with b-RNA might be the basic elements for the activation of the degradation complex.



View larger version (30K):
[in this window]
[in a new window]
  		FIG. 7.
Reconstitution of b-RNA decay in Bcl-2-depleted extract. A, b-RNA degradation by Bcl-2-depleted Jurkat cell extracts. Left panel, 0.5 ng of radiolabeled b-RNA and 0.5 ng of radiolabeled IL-2 RNA were incubated with 15 µg of S100 Jurkat cell lysate anti-Bcl-2-depleted or mouse IgG-depleted as indicated under "Experimental Procedures." Data are representative of three experiments. Right panel, graph of the time course decay of the b-RNA transcript described in the left panel. The data are the mean values obtained by scanning laser densitometry. Bars indicate the S.E. B, b-RNA degradation by Bcl-2-depleted Jurkat cell extracts reconstituted with rBcl-2. Left panel, b-RNA and IGFR control transcript, 5 ng, were incubated with 4 µg of S100 Bcl-2-depleted Jurkat cell extracts supplemented with 32 ng of rBcl-2 protein or with 32 ng of rMyc protein. Assays were performed as indicated in the legend to Fig. 2, and data are representative of three experiments. Right panel, graph of the time course decay of the b-RNA transcript described in the left panel. The data are the mean values obtained by scanning laser densitometry. Bars indicate the S.E. C, Jurkat extracts mouse IgG depleted (lane 1), anti-Bcl-2-depleted (lane 2), or anti-Bcl-2 precipitate (lane 3) were immunoblotted with antibody against Bcl-2.

 


View larger version (52K):
[in this window]
[in a new window]
  		FIG. 8.
Bcl-2 binding to b-RNA. A, the b-RNA or the {Delta}b-RNA mixed with rBcl-2 were analyzed for gel mobility retardation by REMSA as indicated under "Experimental Procedures." Left panel, b-RNA riboprobe (lane 1), b-RNA riboprobe incubated with 100 ng of rBcl-2 protein (lane 2). Right panel, {Delta}b-RNA riboprobe (lane 1), {Delta}b-RNA riboprobe incubated with 100 ng of rBcl-2 protein (lane 2). B, UVCA: rBcl-2, at the indicated doses, was UV cross-linked to b-RNA (lanes 1–4)orto {Delta}b-RNA (lanes 5–8) riboprobes.

 

These findings also indicate the equivalence between the cell-free system based on the S100 extract-radiolabeled b-RNA and the modified method as proposed in this work. Taken together the data provide strong evidence for a specific role of the Bcl-2 protein to activate the degradation complex on the relevant RNA.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
The turnover of mRNA is an important means of regulating both the level and the timing of gene expression (16) along with the metabolic state of the cells and during differentiation (1, 2). Along this line, the amount of cellular Bcl-2 protein is finely tuned, and its deregulation can be associated with the pathogenesis of many human diseases and with the responsiveness to cancer therapy (3, 5).

In a previous work we showed that the rapid decay of b-RNA in the cells is dependent on a conserved ARE motif (27). Although the ARE-dependent decay of mRNAs has been extensively studied, the efficiency of the elements able to regulate the decay of a given transcript both in cis and in trans in different cell lines has not been evaluated in detail. Here we have investigated some mechanistic aspects by which the b-RNA turnover is regulated.

We used a cell-free system in which the decay kinetics of the synthetic b-RNA are regulated by the ARE motif to investigate the b-RNA decay activity in extracts from different cell types. The transcripts utilized for our degradation studies do not contain a poly(A) tract, since we decided to focus on the degradation of the mRNA body which follows deadenylation (50). Indeed, ARE-mediated mRNA deadenylation in the eukaryotic cells can be uncoupled from degradation of the mRNA body (53, 56) as recently discussed in detail (26).

We found that unfractionated cellular extracts degraded ARE-containing b-RNA faster than other transcripts of similar length not containing the ARE motif. Since {Delta}b-RNA was still degraded faster than control RNAs, it could be argued that the regions flanking the ARE motif also contribute to the decay rate. Specificity of the decay system was further demonstrated by mixing b-RNA with unlabelled RNA in the same reaction. The rank order of RNA degradation is similar in vitro and in whole cells. These observations suggest that the soluble-based biochemical system performs with the same fidelity as a polysome-based system and can thus reconstitute physiologically relevant mRNA decay processes.

In vitro decay assays might prove invaluable for investigating the mechanistic aspects of RNA turnover and for assisting studies of alterations associated with metabolic or pathological conditions (32, 33).

By using different cell lines, we thought to get some insight into the mechanism by which the AUBPs and the exosome complex might modulate the rate of degradation of b-RNA. Moreover, understanding of how each cell line can degrade b-RNA at a different rate may shed light on how the degradation complex distinguishes its substrates and target mRNAs specifically.

It was found that the degradation rate depends on the cell lineage. The half-life of b-RNA was between 25–30 min and 70–80 min and was highly reproducible in different preparations from each cell type. The highest decay rate was exhibited by extracts from the three t (14, 18) cell lines and the two neuroblastoid cell lines. These cells typically contain the highest levels of Bcl-2 protein at the steady state, as reported by other authors (57–61) and confirmed by Western blotting (Fig. 6B). A second group of extracts obtained from the t (14, 18)-negative B-cell lines or from one T-cell line, showed slower decay rates, the b-RNA half-life being 50–60 min. In these cells the level of Bcl-2 is constitutively lower than the Bcl-2 levels in the cell types described above. The slowest decay was shown by extracts from cells that express hardly detectable amounts of Bcl-2. The half-lives of the control transcripts were regularly longer than 120 min, consistent with the long half-life in cells (62).

The differences in activities between fast and slow degradation observed with the in vitro RNA decay assays reflect the in vivo situation. These findings indicate the possibility that metabolic conditions of the cells might regulate the rate of the mRNA decay.

The cell-free assay was used to test the concept of whether the level of Bcl-2 controls the decay rate of b-RNA. Daudi cells do not express Bcl-2 and their extracts are not able to degrade b-RNA quickly in the cell-free assay. The addition of recombinant Bcl-2 to the Daudi cell extracts fully activates the degradation process. Therefore, Daudi cell extracts contain the entire enzymatic machinery, capable of degrading myc-RNA, although requiring exogenous Bcl-2 for the b-RNA degradation.

Six distinct pieces of evidence indicate that Bcl-2 specifically activates b-RNA degradation: (a) extracts from Daudi, a cell line not expressing Bcl-2, degrade myc-RNA, while having no effect on b-RNA stability, (b) Daudi extracts supplemented with rMyc protein do not degrade b-RNA, but by Bcl-2 protein, they acquire full-degrading activity on b-RNA, (c) cellular extracts immunodepleted of Bcl-2 lose b-RNA degradation activity, (d) rBcl-2 reconstitutes the degrading activity in Bcl-2-depleted extracts, (e) Jurkat cell extracts, genetically modified to overexpress Bcl-2, degrade b-RNA faster than extracts from mock-transfected cells, and (f) rBcl-2 protein binds the b-RNA in vitro.

Together, these data show that Bcl-2 is crucial in permitting the ARE-dependent degradation of bcl-2 RNA and is essential in regulating the decay rate of its messenger. The most recent models of the ARE-dependent rapid degradation of unstable mRNAs depict the 3'-to-5' degradation by the exosome complex recruited by the AUBPs (24, 26). This stimulating model does not involve the different rate of degradation of a given transcript by different cell types. Most importantly, previous models have not been focused on how the exosome, recruited by the AUBPs, might degrade the relevant RNA among a large pool of messengers endowed with the ARE motif. Here, evidence is provided on the role of the Bcl-2 protein to address the enzymatic activity to the correct target. Moreover, a negative feedback mechanism based upon the concentration of the Bcl-2 protein might not be excluded.

The molecular mechanism by which Bcl-2 regulates the fast degradation of its own RNA remains unknown. The specificity of the reaction might suggest the displacement of a stabilizing factor or, alternatively, the recruitment of a destabilizing factor caused by the presence of Bcl-2 within the b-RNA. Although the findings discussed here may have implications for other ARE-containing RNAs, the molecular mechanism by which a protein can regulate its own RNA degradation remains to be determined.


   FOOTNOTES
 
* This work was supported by grants from Associazione Italiana per la Ricerca sul Cancro, Consiglio Nazionale delle Ricerche, Ministero Istruzione, Università e Ricerca, Ministero Sanità. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

§ Both authors contributed equally to this work. Back

{ddagger}{ddagger} To whom correspondence should be addressed: Dept. of Pharmacology, University of Milan, Via Vanvitelli 32, 20129 Milan, Italy. Tel.: 39-02-5031-6999; Fax: 39-02-5031-7000; E-mail: angelo.nicolin{at}unimi.it.

1 The abbreviations used are: AREs, adenine/uridine rich-elements; 3'-UTR, 3'-untranslated region; AUBP, ARE-binding protein; b-ARE, bcl-2 ARE; b-RNA, bcl-2 3'-UTR RNA; myc-RNA, myc 3'-UTR RNA; IL-2 RNA, IL-2 3'-UTR RNA; DIG, digoxigenin; IGFR, insulin-like growth factor-I receptor; rSS, rat somatostatin; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; rBcl-2, human recombinant Bcl-2; rMyc, human recombinant Myc; DRB, 5,6 dichloro-1-(D-ribofuranosyl)-benzimidazole; REMSA, RNA electrophoretic mobility shift assay; UVCA, UV-cross-linking assay; nt, nucleotides. Back


   ACKNOWLEDGMENTS
 
We thank Dr. Jeff Ross for excellent comments, Dr. Anna Mondino and Dr. Alessandro Quattrone for suggestions, Dr. Mary Forrest and Dr. Peter Woodford for revision of the manuscript, and Dr. Antonio Torsello for the pSS plasmid.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Reed, J. C. (1999) Curr. Opin. Oncol. 11, 68–75[CrossRef][Medline] [Order article via Infotrieve]
  2. Kroemer, G. (1997) Nat. Med. 3, 614–620[CrossRef][Medline] [Order article via Infotrieve]
  3. Vaux, D. L., Cory, S., and Adams, J. M. (1988) Nature 335, 440–442[CrossRef][Medline] [Order article via Infotrieve]
  4. Silvestrini, R., Veneroni, S., Daidone, M. G., Benini, P., Boracchi, P., Mezzetti, M., Di Fronzo, G., Rilke, F., and Veronesi, U. (1994) J. Natl. Cancer Inst. 86, 499–504[Abstract/Free Full Text]
  5. Reed, J. C., Miyashita, T., Takayama, S., Wang, H. G., Sato, T., Krajewski, S., Aime-Sempe, C., Bodrug, S., Kitada, S., and Hanada, M. (1996) J. Cell. Biochem. 60, 23–32[CrossRef][Medline] [Order article via Infotrieve]
  6. Graninger, W. B., Seto, M., Boutain, B., Goldman, P., and Korsmeyer, S. J. (1987) J. Clin. Invest. 80, 1512–1515[Medline] [Order article via Infotrieve]
  7. Lampert, I. A. (1999) Mol. Pathol. 52, 29–31[Medline] [Order article via Infotrieve]
  8. Srivastava, R. K., Mi, Q. S., Hardwick, J. M., and Longo, D. L. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 3775–3780[Abstract/Free Full Text]
  9. Hu, Z. B., Minden, M. D., and McCulloch, E. A. (1996) Leukemia 10, 410–416[Medline] [Order article via Infotrieve]
  10. Konig, A., Schwartz, G. K., Mohammad, R. M., Al-Katib, A., and Gabrilove, J. L. (1997) Blood 90, 4307–4312[Abstract/Free Full Text]
  11. Itano, Y., Ito, A., Uehara, T., and Nomura, Y. (1996) J. Neurochem. 67, 131–137[Medline] [Order article via Infotrieve]
  12. Siegel, D. S., Zhang, X., Feinman, R., Teitz, T., Zelenetz, A., Richon, V. M., Rifkind, R. A., Marks, P. A., and Michaeli, J. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 162–166[Abstract/Free Full Text]
  13. Reed, J. C., Stein, C., Subasinghe, C., Haldar, S., Croce, C. M., Yum, S., and Cohen, J. (1990) Cancer Res. 50, 6565–6570[Abstract/Free Full Text]
  14. Morelli, S., Delia, D., Capaccioli, S., Quattrone, A., Schiavone, N., Bevilacqua, A., Tomasini, S., and Nicolin, A. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 8150–8155[Abstract/Free Full Text]
  15. Jansen, B., Wacheck, V., Heere-Ress, E., Schlagbauer-Wadl, H., Hoeller, C., Lucas, T., Hoermann, M., Hollenstein, U., Wolff, K., and Pehamberger, H. (2000) Lancet 356, 1728–1733[CrossRef][Medline] [Order article via Infotrieve]
  16. Van Hoof, A., and Parker, R. (1999) Cell 99, 347–350[CrossRef][Medline] [Order article via Infotrieve]
  17. Coburn, G. A., Miao, X., Briant, D. J., and Mackie, G. A. (1999) Genes Dev. 13, 2594–2603[Abstract/Free Full Text]
  18. Chen, C. Y., and Shyu, A. B. (1994) Mol. Cell. Biol. 14, 8471–8482[Abstract/Free Full Text]
  19. Chen, C. Y., and Shyu, A. B. (1995) Trends Biochem. Sci. 20, 465–470[CrossRef][Medline] [Order article via Infotrieve]
  20. Caput, D., Beutler, B., Hartog, K., Thayer, R., Brown-Shimer, S., and Cerami, A. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 1670–1674[Abstract/Free Full Text]
  21. Laroia, G., Cuesta, R., Brewer, G., and Schneider, R. J. (1999) Science 284, 499–502[Abstract/Free Full Text]
  22. Nair, A. P., Hirsch, H. H., Colombi, M., and Moroni, C. (1999) Mol. Cell. Biol. 19, 889–898[Abstract/Free Full Text]
  23. Donnini, M., Lapucci, A., Papucci, L., Witort, E., Tempestini, A., Brewer, G., Bevilacqua, A., Nicolin, A., Capaccioli, S., and Schiavone, N. (2001) Biochem. Biophys. Res. Commun. 287, 1063–1069[CrossRef][Medline] [Order article via Infotrieve]
  24. Wilusz, C. J., Wormington, M., and Peltz, S. W. (2001) Nat. Rev. Mol. Cell. Biol. 2, 237–246[CrossRef][Medline] [Order article via Infotrieve]
  25. Buzby, J. S., Brewer, G., and Nugent, D. J. (1999) J. Biol. Chem. 274, 33973–33978[Abstract/Free Full Text]
  26. Chen, C. Y., Gherzi, R., Ong, S. E., Chan, E. L., Raijmakers, R., Pruijn, G. J., Stoecklin, G., Moroni, C., Mann, M., and Karin, M. (2001) Cell 107, 451–464[CrossRef][Medline] [Order article via Infotrieve]
  27. Shaw, G., and Kamen, R. (1986) Cell 46, 659–667[CrossRef][Medline] [Order article via Infotrieve]
  28. Capaccioli, S., Quattrone, A., Schiavone, N., Calastretti, A., Copreni, E., Bevilacqua, A., Canti, G., Gong, L., Morelli, S., and Nicolin, A. (1996) Oncogene 13, 105–115[Medline] [Order article via Infotrieve]
  29. Schiavone, N., Rosini, P., Quattrone, A., Donnini, M., Lapucci, A., Citti, L., Bevilacqua, A., Nicolin, A., and Capaccioli, S. (2000) FASEB J. 14, 174–184[Abstract/Free Full Text]
  30. Lind, E. F., Wayne, J., Wang, Q. Z., Staeva, T., Stolzer, A., and Petrie, H. T. (1999) J. Immunol. 162, 5374–5379[Abstract/Free Full Text]
  31. Garland, J. M., and Rudin, C. (1998) Blood 92, 1235–1246[Abstract/Free Full Text]
  32. Ross, J. (1999) Methods Mol. Biol. 118, 459–476[Medline] [Order article via Infotrieve]
  33. DeMaria, C. T., and Brewer, G. (1997) in Progress in Molecular & Subcellular Biology (Jeanteur, P., ed) pp. 65–91, Springer-Verlag, Berlin
  34. Doyle, G. A., Betz, N. A., Leeds, P. F., Fleisig, A. J., Prokipcak, R. D., and Ross, J. (1998) Nucleic Acids Res. 26, 5036–5044[Abstract/Free Full Text]
  35. Wang, Z. R., and Kiledjian, M. (2000) EMBO J. 19, 295–305[CrossRef][Medline] [Order article via Infotrieve]
  36. Kluin-Nelemans, H. C., Limpens, J., Meerabux, J., Beverstock, G. C., Jansen, J. H., De Jong, D., and Kluin, P. M. (1991) Leukemia 5, 221–224[Medline] [Order article via Infotrieve]
  37. Cleary, M. L., Smith, S. D., and Sklar, J. (1986) Cell 47, 19–28[CrossRef][Medline] [Order article via Infotrieve]
  38. Dyer, M. J., Fischer, P., Nacheva, E., and Labastide, W. (1990) Blood 75, 709–714[Abstract/Free Full Text]
  39. Lenoir, G. M., Preud'homme, J. L., Bernheim, A., and Berger, R. (1982) Nature 298, 474–476[CrossRef][Medline] [Order article via Infotrieve]
  40. Klein, G., Dombos, L., and Gothoskar, B. (1972) Int. J. Cancer 10, 44–57[Medline] [Order article via Infotrieve]
  41. Klein, E., Klein, G., Nadkarni, J. S., Nadkarni, J. J., Wigzell, H., and Clifford, P. (1968) Cancer Res. 28, 1300–1310[Abstract/Free Full Text]
  42. Minowada, J., Onuma, T., and Moore, G. E. (1972) J. Natl. Cancer Inst. 49, 891–895[Medline] [Order article via Infotrieve]
  43. Gallagher, R., Collins, S., Trujillo, J., McCredie, K., Ahearn, M., Tsai, S., Metzgar, R., Aulakh, G., Ting, R., Ruscetti, F., and Gallo, R. (1979) Blood 54, 713–733[Abstract/Free Full Text]
  44. Brooks, S. C., Locke, E. R., and Soule, H. D. (1973) J. Biol. Chem. 248, 6251–6253[Abstract/Free Full Text]
  45. Biedler, J. L., Roffler-Tarlov, S., Schachner, M., and Freedman, L. S. (1978) Cancer Res. 38, 3751–3757[Abstract/Free Full Text]
  46. Sonnenfeld, K. H., and Ishii, D. N. (1982) J. Neurosci. Res. 8, 375–391[CrossRef][Medline] [Order article via Infotrieve]
  47. Torigoe, T., Millan, J. A., Takayama, S., Taichman, R., Miyashita, T., and Reed, J. C. (1994) Cancer Res. 54, 4851–4854[Abstract/Free Full Text]
  48. Seto, M., Jaeger, U., Hockett, R. D., Graninger, W., Bennett, S., Goldman, P., and Korsmeyer, S. J. (1988) EMBO J. 7, 123–131[Medline] [Order article via Infotrieve]
  49. Chen, C. Y., Gherzi, R., Andersen, J. S., Gaietta, G., Jurchott, K., Royer, H. D., Mann, M., and Karin, M. (2000) Genes Dev. 14, 1236–1248[Abstract/Free Full Text]
  50. Bernstein, P., and Ross, J. (1989) Trends Biochem. Sci. 14, 373–377[CrossRef][Medline] [Order article via Infotrieve]
  51. Brewer, G. (1998) J. Biol. Chem. 273, 34770–34774[Abstract/Free Full Text]
  52. Detich, N., Ramchandani, S., and Szyf, M. (2001) J. Biol. Chem. 276, 24881–24890[Abstract/Free Full Text]
  53. Lai, W. S., and Blackshear, P. J. (2001) J. Biol. Chem. 276, 23144–23154[Abstract/Free Full Text]
  54. Chodosh, L. A., Fire, A., Samuels, M., and Sharp, P. A. (1989) J. Biol. Chem. 264, 2250–2257[Abstract/Free Full Text]
  55. Degli Esposti, M., Hatzinisiriou, I., McLennan, H., and Ralph, S. (1999) J. Biol. Chem. 274, 29831–29837[Abstract/Free Full Text]
  56. Voeltz, G. K., and Steitz, J. A. (1998) Mol. Cell. Biol. 18, 7537–7545[Abstract/Free Full Text]
  57. Steube, K. G., Jadau, A., Teepe, D., and Drexler, H. G. (1995) Leukemia 9, 1841–1846[Medline] [Order article via Infotrieve]
  58. Chen-Levy, Z., Nourse, J., and Cleary, M. L. (1989) Mol. Cell. Biol. 9, 701–710[Abstract/Free Full Text]
  59. Reed, J. C., Meister, L., Tanaka, S., Cuddy, M., Yum, S., Geyer, C., and Pleasure, D. (1991) Cancer Res. 51, 6529–6538[Abstract/Free Full Text]
  60. Aiello, A., Delia, D., Borrello, M. G., Biassoni, D., Giardini, R., Fontanella, E., Pezzella, F., Pierotti, M., and Della Porta, G. (1992) Cytometry 13, 502–509[CrossRef][Medline] [Order article via Infotrieve]
  61. Campos, L., Sabido, O., Viallet, A., Vasselon, C., and Guyotat, D. (1999) Leuk. Lymphoma 33, 499–509[Medline] [Order article via Infotrieve]
  62. Dani, C., Piechaczyk, M., Audigier, Y., El Sabouty, S., Cathala, G., Marty, L., Fort, P., Blanchard, J. M., and Jeanteur, P. (1984) Eur. J. Bioch. 145, 299–304[Medline] [Order article via Infotrieve]
  63. Teixeira, C., Reed, J. C., and Pratt, M. A. (1995) Cancer Res. 55, 3902–3907[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Anticancer ResHome page
A. SZANTO, Z. BOGNAR, A. SZIGETI, A. SZABO, L. FARKAS, and F. GALLYAS Jr.
Critical Role of Bad Phosphorylation by Akt in Cytostatic Resistance of Human Bladder Cancer Cells
Anticancer Res, January 1, 2009; 29(1): 159 - 164.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Pharmacol.Home page
A. Bevilacqua, L. Ghisolfi, S. Franzi, G. Maresca, R. Gherzi, S. Capaccioli, A. Nicolin, and G. Canti
Stabilization of Cellular mRNAs and Up-Regulation of Proteins by Oligoribonucleotides Homologous to the Bcl2 Adenine-Uridine Rich Element Motif
Mol. Pharmacol., February 1, 2007; 71(2): 531 - 538.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Pharmacol.Home page
L. Ghisolfi, L. Papucci, A. Bevilacqua, G. Canti, G. Tataranni, A. Lapucci, N. Schiavone, S. Capaccioli, and A. Nicolin
Increased Bcl2 Expression by Antisense Oligoribonucleotides Targeting the Adenine-Uridine-Rich Element Motif
Mol. Pharmacol., September 1, 2005; 68(3): 816 - 821.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
J.-H. Lee, M.-H. Jeon, Y.-J. Seo, Y.-J. Lee, J. H. Ko, Y. Tsujimoto, and J.-H. Lee
CA Repeats in the 3'-Untranslated Region of bcl-2 mRNA Mediate Constitutive Decay of bcl-2 mRNA
J. Biol. Chem., October 8, 2004; 279(41): 42758 - 42764.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/26/23451    most recent
M210620200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bevilacqua, A.
Right arrow Articles by Nicolin, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bevilacqua, A.
Right arrow Articles by Nicolin, A.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement