| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 278, Issue 26, 23617-23623, June 27, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Cells*
¶
From the
Department of Internal Medicine and the
Diabetes Center, and Department of Pharmacology,
University of Virginia Health Sciences Center, Charlottesville, Virginia
22903
Received for publication, April 2, 2003 , and in revised form, April 21, 2003.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
cell-specific expression of the
insulin gene, we performed chromatin immunoprecipitation assays using
anti-histone antibodies and extracts from cell lines, non- cell
lines, and ES cells, and quantitated specific histone modifications at the
insulin promoter by real-time PCR. Our studies reveal that the proximal
insulin promoter is hyperacetylated at histone H3 only in cells. This
hyperacetylation is highly correlated to recruitment of the histone
acetyltransferase p300 to the proximal promoter in cells, and is
consistent with the role of hyperacetylation in promoting euchromatin
formation. We also observed that the proximal insulin promoter of cells
is hypermethylated at H3–K4, and that this modification is correlated to
the recruitment of the histone methyltransferase SET7/9 to the promoter. ES
cells demonstrate a histone modification pattern intermediate between that of
cells and non- cells, and is consistent with their potential to
express the insulin gene. We therefore propose a model in which insulin
transcription in the cell is facilitated by a unique combination of
transcription factors that acts in the setting of an open, euchromatic
structure of the insulin gene. |
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
cell is exclusively responsible for the synthesis and
secretion of insulin. The production of insulin appears to be governed by
constraints imposed at the level of transcription of the gene encoding insulin
(Ins),1 and
involves an intricate interplay between transcription factors that are known
to function as transactivators of the gene. In recent years, specific DNA
elements within the proximal 
400 base pairs (bp) of the Ins
promoter have been mapped precisely and shown to be bound by several major
classes of transactivating transcription factors, including homeodomain
factors (Pdx1, Lmx1.1), basic helix loop helix factors (NeuroD1, E47), and
bZip factors (mMafA) (see Ref.
1 for review). In addition,
coactivators such as p300 (by virtue of its interaction with Pdx1, NeuroD1,
and E47) have also been suggested to contribute to Ins gene
regulation (2,
3). Thus, it is hypothesized
that the unique combination of ubiquitous and cell type-specific factors
within the cell results in the transcription of the Ins gene
(3–5).
However, this hypothesis alone cannot explain why heterologous expression of
cell factors results in activation of the endogenous Ins gene
in only limited, "responsive" cell types (e.g. liver,
pancreatic ductal cells, and embryonic and intestinal stem cells)
(6–10).
Although this finding suggests that "unresponsive" cell types are
still missing some critical genetic component (transcription factor or
signaling pathway) that is necessary for gene activation, it also raises the
possibility that epigenetic variables relating to the chromatin structure of
the Ins gene might preclude transcription factor action in these cell
types.
An important paradigm in transcriptional regulation is the influence of the higher order chromatin structure on the rate of gene transcription. In eukaryotes, histones H2A, H2B, H3, and H4 make up the proteins of the core nucleosomal unit of chromatin, around which 146 bp of DNA are wrapped (11). The higher order structure of chromatin is dependent upon the spatial organization of the core nucleosomal units with respect to one another. Although this packaging of chromatin is responsible for the efficient storage of genetic material within the nucleus, it also has the capacity to impede the accessibility of DNA to transcription factors (11, 12). An emerging theme in chromatin structural dynamics is the effect of covalent histone modifications in altering higher order chromatin structure, and hence in altering rates of gene transcription. Several covalent modifications of the basic N-terminal tails of all histones have been described, including acetylation, methylation, phosphorylation, and ubiquitination (see Ref. 13 for review). Of these, acetylation and methylation of specific Lys residues of H3 and H4 have been studied extensively. Chromatin immunoprecipitation (ChIP)2 assays using mammalian and yeast cells have demonstrated that transcriptionally active genes in regions of "open" chromatin ("euchromatin") are correlated with high levels of Lys acetylation of histones H3 and H4, whereas inactive genes in regions of "closed" chromatin ("heterochromatin") are hypoacetylated at these histones (14, 15). Lys acetylation and deacetylation are catalyzed by the action of histone acetyltransferases (HATs) and histone deacetylases, respectively; thus, in addition to serving as a long term epigenetic marker for euchromatin, histone acetylation is also viewed as a dynamic, short term mechanism to control gene transcription (14). At least two mechanisms have been proposed to explain the effect of histone acetylation on chromatin structure and transcription. First, acetylation of Lys residues is known to diminish the positive charge in the N-terminal histone tails, and thereby mitigate electrostatic interactions between histones and DNA and promote chromatin unfolding. Second, the acetylation "mark" of these Lys residues is thought to be recognized by proteins containing the conserved bromodomain. These proteins subsequently recruit components of the basal transcriptional machinery to promote transcriptional activation (16).
Unlike acetylation, Lys methylation can have divergent effects on transcriptional activation, depending upon the specific residue modified. Thus, methylation of Lys-4 of histone H3 (H3–K4) is associated with euchromatin, whereas methylation of Lys-9 of histone H3 (H3–K9) is observed with heterochromatin (17–19). Lys methylation is catalyzed by the action of histone methyltransferases (HMTs), which demonstrate a high degree of specificity for either H3–K4 (e.g. SET7/9, Refs. 20 and 21) or H3–K9 (e.g. SUV39H1, Ref 22). Because no histone demethylases have yet been described, histone methylation is not generally believed to be dynamically regulated (as acetylation), but rather is viewed as a long term epigenetic marker for chromatin states (23). Although Lys methylation does not alter net charge of histone tails (unlike acetylation), the methyl mark is believed to either enhance or repress the binding of chromatin remodeling complexes that contain the conserved chromodomain (e.g. HP1 and NuRD deacetylase, respectively), thereby contributing to altered chromatin conformation (24, 25). Hence, regions of transcriptionally active genes are characterized by histone acetylation and/or histone H3–K4 methylation, whereas regions of inactive genes are hypoacetylated and/or contain histone H3–K9 methylation.
To explain Ins gene transcription in the cell more fully,
we hypothesized that cells contain a characteristic set of histone
modifications that lend a state of euchromatin in the region of the
Ins gene. To test this hypothesis, we performed quantitative ChIP
assays using anti-histone antisera and extracts from cell lines
(TC3 and MIN6) and several non--cell lines (
TC1.6, mPAC,
NIH3T3, and ES cells) to examine the chromatin structure of the proximal and
distal mouse Ins promoter. Our hypothesis proved correct, as we found
that cells display a characteristic pattern of H3 hyperacetylation in
the proximal Ins promoter, and that this acetylation is highly
correlated to recruitment of the HAT p300 to this promoter region. In
addition, we found that the proximal Ins promoter in cells is
hypermethylated at H3–K4, and that this modification is consistent with
the recruitment of the HMT SET7/9 to this region of the promoter. We therefore
propose a model in which Ins transcription in the cell is
facilitated by a unique combination of transcription factors that acts in the
setting of an open, euchromatic structure of the Ins gene.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
TC3,
TC1.6, mPAC, NIH3T3, MIN6, and embryonic stem (ES) D3 were maintained
as described
(26–29).
Rabbit polyclonal antibodies to acetylated-H3, acetylated-H4, H3-dimethyl-K4,
H3-dimethyl-K9, and SET7/9 were generously provided by Upstate Biotech, Inc.
Rabbit polyclonal antibody to p300 (N-15) was from Santa Cruz
Biotechnology. Multiplex Real-time RT-PCR—Real-time RT-PCR using dual-labeled probes and total RNA from cells lines was performed as described previously (30). Forward primer, reverse primer, and probe sequences (5' to 3'), respectively, for real-time RT-PCRs were: mouse I insulin, TGGCTTCTTCTACACACCCAAG, ACAATGCCACGCTTCTGCC, and (AmC6 + Texas Red)-CCCGCCGTGAAGTGGAGGACCC-(BHQ); actin, AGGTCATCACTATTGGCAACGA, CACTTCATGATGGAATTGAATGTAGTT, and (6-FAM)-TGCCACAGGATTCCATACCCAAGAAGG-(BHQ).
Quantitative ChIP Assays—The quantitative ChIP assays were performed as described previously (26). For harvesting of ES cells, feeder embryonic fibroblasts were removed by trypsinizing cells from 10-cm plates and replating on fresh 10-cm tissue culture dishes. Approximately 30 min later, medium (containing mostly ES cells) was aspirated and replated. This process was repeated a total of 3 times, after which the medium (containing >90% ES cells) was processed for ChIP as described (26). Co-immunoprecipitated promoter fragments were quantitated by real-time PCR using continuous SYBR Green I monitoring as detailed previously (26). Prior to ChIP, 1 µg of a plasmid containing the firefly luciferase coding sequence (pFoxLuc) was added to each cellular extract and was used to correct for differences in DNA recovery between samples after the ChIP procedure. This was accomplished by determining the quantity of recovered luciferase DNA in each sample by realtime PCR, and using this value to correct the recovery of the Ins promoter fragments. Data were expressed as fold-differences relative to control conditions, in which normal rabbit serum was used instead of specific antibody in the ChIP. In practice, DNA fragments are nonspecifically and reproducibly recovered after ChIP in the absence of antibody, but are often amplified 0–6 cycles later than specifically recovered fragments. Thus, data expressed relative to these control conditions allow for (a) correction in the variation of background DNA precipitation from cell line to cell line, and (b) assessment of the absolute enrichment of specific DNA fragments after ChIP in any given cell line (26, 31, 32). ChIP assays were performed on at least 3 independent occasions; for each ChIP assay, promoter samples were quantitated in triplicate on two separate occasions. Thus, for every sample in Figs. 2, 3, 4, 5, data represent the average of at least 6 determinations ± S.D., and are presented as fold-differences relative to control conditions (in which normal rabbit serum is used instead of specific antibody in the ChIP).
|
|
|
|
Forward and reverse primer sequences, respectively, used for PCR were (5' to 3'): proximal Ins1, TCAGCCAAAGATGAAGAAGGTCTC, TCCAAACACTTGCCTGGTGC; distal Ins1, CCTCCATACAGACAAAATACTCTCC, CTCACATCCAAAGCAGAAGTTC; firefly luciferase, TCGCCAGAAAGTAGGGGTCG, GCTTCTGCCAACCGAACGGAC. PCR products were subcloned into the T/A cloning vector pCR2.1 (Invitrogen), and several resulting clones were sequenced to confirm the identity of the amplified fragment. Primer pairs for the proximal mouse Ins1 promoter equally and effectively amplified the corresponding fragment from both the mouse Ins1 and Ins2 genes.
Immunoprecipitation-HAT Assays—Immunoprecipitation-HAT
assays using anti-p300 antibody and extracts from TC3, TC1.6, and
mPAC cells were performed essentially as described
(33). HAT reactions (in 30
µl total volume) consisted of immunoprecipitate or 10 units of purified
p300 catalytic subunit (positive control, Upstate Biotechnology), 10 µg of
calf thymus histones (Worthington) or bovine serum albumin (negative control),
and 0.2 µCi of [3H]acetyl-CoA (Amersham Biosciences). After 30
min, HAT reactions were subject either to filter binding assays
(33) to determine
incorporation of [3H]acetyl group into histones or to
electrophoresis on a 15% SDS-polyacrylamide gel and visualized by fluorography
to determine relative H3 versus H4 [3H]acetate
incorporation. HAT data are presented as picomoles of [3H]acetate
incorporated into histones or bovine serum albumin per min, and are normalized
to the total amount of protein used in each immunoprecipitation.
Western Blot Analysis—Nuclear extracts from all cell lines were prepared from single, confluent 10-cm plates of cells according to methods described previously (34). Whole cell extracts were prepared from confluent 10-cm plates of cells by scraping cells into 1 ml of phosphate-buffered saline containing protease inhibitors (leupeptin, phenylmethylsulfonyl fluoride, and aprotinin) and sonicating briefly. 5 µg of nuclear or whole cell extract were subject to Western blot analysis after electrophoresis on an 8 or 15% SDS-polyacrylamide gel using antiacetylated H3, anti-H3-dimethyl-K4, anti-p300, or anti-SET7/9 antibodies. Western blots were visualized using the ECL-PlusTM system (Amersham Biosciences).
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
-cell-derived lines (MIN6 and TC3, Refs.
28 and
35), a fibroblast line (NIH3T3
cells), an cell line (TC1.6, Ref.
36), a pancreatic ductal cell
line (mPAC, Ref. 27), and ES
cells. To verify the presence or absence of Ins gene expression, we
isolated total RNA from each cell line and performed 50 cycles of real-time
RT-PCR to amplify Ins message. As demonstrated in
Fig. 1, only MIN6 and TC3
cells showed detectable transcript levels, consistent with the observation
that Ins gene transcription is highly specific for cells.
|
We used a real-time PCR-based ChIP assay
(26) to quantitate the
association of covalently modified histones with the Ins promoter in
each cell line. Because only the proximal 400 bp of the Ins
promoter appears to be necessary to direct exclusive expression of
Ins in cells
(37), we designed PCR primer
pairs to amplify a fragment of DNA within this region (bp –126 to
–296 relative to the Ins1 transcriptional start site) following
ChIP. For comparison, we also designed PCR primer pairs to amplify a distal
genomic fragment (from bp –4653 to –4812 relative to the
Ins1 transcriptional start site) in a region known not to be critical
for Ins regulation (for simplicity, we refer to this region as the
distal Ins promoter). The relative association of acetylated H3 and
acetylated H4 with the distal and proximal Ins promoters was assessed
by ChIP in TC3, MIN6, NIH3T3, TC1.6, mPAC, and ES cells.
Fig. 2A demonstrates
that cells (TC3 and MIN6) show striking levels of H3 acetylation
at the proximal (10.5- and 18-fold, respectively, over controls) and, to a
lesser extent, the distal promoter. By contrast, little or no Ins
promoter H3 acetylation was observed in NIH3T3, TC1.6, or mPAC cells.
Importantly, ES cells contain a moderate level of H3 acetylation at the
proximal promoter (about 5-fold over control), consistent with a more
intermediate conformation of chromatin in this undifferentiated cell type.
Fig. 2B demonstrates
that there is little difference in H4 acetylation at the proximal promoter
between cells and the other cell types. Interestingly, ES cells contain
relatively high levels of H4 acetylation (20-fold over control) at the
proximal promoter, again consistent with a more open conformation of chromatin
in this cell type. Overall, these data demonstrate that the Ins
promoter of cells is distinguished by hyperacetylation of H3.
The H3 and H4 acetylation patterns of the distal Ins promoter of
all cell types seem to parallel the patterns observed in their corresponding
proximal promoter regions (compare Fig. 2,
A and B). However, hyperacetylation of H3
relative to H4 may be the more indicative of the regulatory role of
the proximal Ins promoter. As shown in
Fig. 2C, the ratio of
H3 to H4 acetylation is significantly greater (by 5–10-fold) in the
proximal Ins promoter of cells compared with all other cell
types, whereas there is no significant difference in this ratio among the cell
types in the distal Ins promoter. Thus, these data demonstrate that
the proximal Ins promoter is hyperacetylated at H3 relative to H4 in
cells, suggesting a more open chromatin conformation of the promoter in
these cells.
p300 Directs Proximal Ins Promoter H3 Hyperacetylation in
Cells—It has been shown previously that the coactivator p300
physically interacts with several important cell transcription factors
(Pdx1, NeuroD1, and HNF), and is capable of augmenting transactivation
of the Ins promoter by these factors
(2,
3,
38). Because p300 contains
intrinsic HAT activity (39),
we sought to determine by ChIP if p300 is directly recruited to the proximal
Ins promoter of cells and whether its catalytic activity could
account for the relative H3 hyperacetylation we observed. For these studies,
we used 3 representative pancreatic cell lines: TC1.6, mPAC, and
TC3. As shown in Fig.
3A, p300 is directly associated only with the proximal
Ins promoter in TC3 cells (but not TC1.6 or mPAC cells),
notwithstanding that p300 protein and HAT activity are detectable in all cell
types examined (Fig. 3, B and
C, respectively). Fig.
3D demonstrates that whereas the recombinant p300
catalytic subunit acetylates H3 and H4 equally in vitro (lane
1), full-length p300 immunoprecipitated from TC3 cells
preferentially acetylates H3 (lane 3). This finding is similar to
other in vitro studies showing preferential acetylation of H3 by p300
(20,
39), and is therefore
consistent with the concept that p300 recruitment is responsible for H3
hyperacetylation at the proximal Ins promoter.
H3 Methylation at the Ins Promoter—H3–K4 methylation
indicates regions of euchromatin and active genes, whereas H3–K9
methylation is associated with regions of heterochromatin and inactive genes.
To determine whether H3 methylation is linked to activity of the Ins
promoter, we performed quantitative ChIP assays using anti-H3-dimethyl-K4 and
anti-H3-dimethyl-K9 antibodies and extracts from cells and
non--cells. As illustrated in Fig.
4A high levels of H3–K4 methylation are present in
the proximal Ins promoter of TC3 and MIN6 cells (36- and
22-fold, respectively, relative to controls), whereas all
non-insulin-producing cell types showed 2–6-fold relative methylation.
H3–K4 methylation was significantly lower in the distal promoter of
TC3 and MIN6 cells (9- and 12-fold, respectively, over controls), but
was still statistically greater than that observed for the other cell types in
the distal promoter (3–4-fold over controls). There was no difference in
H3–K9 methylation in the proximal promoter among any of the cell types
studied (Fig. 4B).
However, the distal promoter in MIN6 cells contains significantly higher
H3–K9 methylation (11-fold over control) than all other cell types
(1–3-fold over controls). This latter finding suggests a progressive
opening of chromatin structure from the distal to proximal promoter in MIN6
cells.
Just as with H3 and H4 acetylation, we observed striking differences
between distal and proximal promoter regions when the ratio of H3–K4 to
H3–K9 methylation was considered
(Fig. 4C). This ratio
may reflect the relative "propensity" for a given chromatin
segment to occupy a euchromatin conformation
(18). Thus,
Fig. 4C demonstrates
that cells display a much higher H3–K4/H3–K9 methylation
ratio (by up to 14-fold) in the proximal Ins promoter than in
non-insulin-producing cells. The same ratio in the distal Ins
promoter reveals little cell-type heterogeneity. Therefore, consistent with
the H3 acetylation data, the H3 methylation patterns suggest that the proximal
Ins promoter of cells adopts a euchromatin conformation
contributing to a more active state of Ins transcription.
SET7/9 Is Recruited to the Proximal Ins Promoter of
Cells— The remarkable level of H3–K4 methylation
at the proximal Ins promoter in cells led us to consider the
possibility that the HMT SET7/9 might be responsible for this enzymatic
modification. SET7/9 belongs to the SET family of proteins
(40) and exhibits
methyltransferase activity that is highly specific for H3–K4
(20,
21). We show by Western blot
(Fig. 5A) that SET7/9
is present in TC1.6, mPAC, and TC3 cells, in addition to HeLa
cells (from which it was originally isolated, Refs.
20 and
21). Despite this broad
expression pattern, we observed by ChIP that SET7/9 binds to the proximal
Ins promoter only in TC3 cells
(Fig. 5B), suggesting
that a transcription factor(s) specific to cells likely recruits this
protein to the Ins promoter. We found no statistically significant
SET7/9 recruitment to the distal promoter, notwithstanding the H3–K4
hypermethylation in this region (albeit much less than in the proximal
promoter, 9-versus 36-fold relative to controls, see
Fig. 4A). This finding
suggests that either our ChIP assay using the SET7/9 antibody is not sensitive
enough to detect binding in this region or that a different HMT(s) is
involved.
Global H3 Acetylation and Methylation Patterns—To rule out
the possibility that the observed H3 hyperacetylation and H3–K4
hypermethylation at the Ins promoter in cells was not
secondary to events causing global acetylation and methylation of H3, we
performed Western blot analysis on cellular extracts using specific anti-H3
antibodies. Fig. 6 demonstrates
that levels of acetylated H3 are similar in all cell lines examined, and
levels of H3-dimethyl-K4 are at least as high in non- cells as in
cells. In addition, we performed H3 acetylation and methylation analysis for
the promoter of a ubiquitously expressed gene, c-fos. These results
demonstrated that all cell lines exhibited similar histone modification
patterns for this gene (data not shown). Taken together, these results confirm
that the H3 acetylation and methylation patterns we observed at the
Ins promoter in cells are not secondary to nonspecific histone
modifications.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Acetylation is perhaps the most extensively studied histone modification.
Several Lys residues in H3 and H4 are known to be acetylated in response to
the action various HATs. In some systems, important differences have been
noted in the relative acetylation of H3 versus H4, suggesting that
acetylation of these two histones can be independently regulated
(14). For example, activation
of the steroidogenic acute regulatory protein gene in mouse Leydig tumor cells
is associated with rapid acetylation of H3 in the proximal promoter, with no
accompanying changes in either the distal promoter or in H4 acetylation
(31). In this regard, our
studies suggest that relative H3 hyperacetylation occurs in the proximal
Ins promoter region of cells. This finding is consistent with
the well established regulatory role of this promoter region in Ins
transcription (37). Our
studies demonstrate a pattern of H3 acetylation and p300 binding that strongly
implicates a direct role for the HAT activity of p300 in maintaining a
euchromatin environment in the proximal Ins promoter of cells.
Consistent with this finding, recent studies have shown the direct interaction
of p300 with the cell factors Pdx1, NeuroD1, and HNF1
(2,
3,
38) as a possible explanation
for how p300 might be recruited specifically to the Ins promoter.
An equally important finding in our studies is the relative absence of H3
acetylation at the Ins promoter of most non--cells. This
hypoacetylation may contribute to a state of inaccessible,
"silent" chromatin (heterochromatin) in these cell types
(41–43),
and might explain why expression of cell transcription factors in
heterologous cell types does not always lead their binding and activation of
the endogenous Ins promoter
(26). ES cells are a notable
exception, because they have the potential to express the endogenous
Ins gene (6,
29,
44,
45). In this regard, we
observed both H3 acetylation and high level H4 acetylation at the proximal
Ins promoter in this highly undifferentiated cell type. It is likely
that histone acetylation, particularly of H4, in ES cells may prevent
chromatin from adopting a closed state until such time that transcription
factors and other chromatin modifying enzymes gain access to make more
permanent adjustments in chromatin conformation
(14). A similar mechanism
involving H4 acetylation has been demonstrated for maintenance of the active X
chromosome in differentiating ES cells
(46).
H3 methylation can also promote the formation of either euchromatin or
heterochromatin, depending upon which residues are methylated. Several Lys
residues of H3 and H4 have been demonstrated to be targets for methylation
(47). It is believed that
H3–K4 methylation promotes transcriptional activation and euchromatin
formation by enhancing the acetylation of neighboring histones by HATs and by
simultaneously preventing the binding of heterochromatin-forming proteins
(e.g. NuRD deacetylase complex)
(20,
47). By contrast, H3–K9
methylation is believed to promote transcriptional repression and
heterochromatin formation through both the recruitment of
heterochromatin-forming proteins (e.g. HP1) and the prevention of
histone acetylation by HATs
(47). In the latter regard,
H3–K9 is also a known target for acetylation; thus, methylation of this
residue would preclude its acetylation, and vice versa
(48). Recent biochemical and
ChIP data (18,
20,
21) suggest that methylation
of H3–K4 and H3–K9 antagonize one another, implying that
co-occurrence of eu- and heterochromatin is mutually exclusive. Our data on
the histone methylation and acetylation patterns of the Ins promoter
support these observations. We found that (a) cell types with active
Ins transcription (TC3 and MIN6) demonstrate a pattern of
H3–K4 hypermethylation, H3 hyperacetylation, and H3–K9
hypomethylation at the proximal Ins promoter, (b) cell types
with inactive Ins transcription (TC1.6, NIH3T3, and mPAC) are
characterized by a pattern of H3–K4 hypomethylation and H3
hypoacetylation, and (c) a cell type with the potential for
Ins transcription (ES cells) demonstrates an intermediate level of
H3-K4 methylation and histone hyperacetylation.
To explain the H3–K4 hypermethylation pattern of the Ins
promoter in cells, we propose that the H3–K4-specific
methyltransferase SET7/9 is specifically recruited to the proximal
Ins promoter. Because we observe SET7/9 expression in all cell types
examined, it is unclear exactly how SET7/9 is exclusively recruited to the
promoter in cells. Although it is possible that the interaction of
SET7/9 with -cell-specific transcription factors (such as Pdx1, NeuroD1,
etc.) might lead to its recruitment to the proximal Ins promoter (as
with p300), recent ChIP analysis of the collagenase gene in glioblastoma cells
suggests that SET7/9 might be recruited to active genes by components of the
pre-initiation complex. It is hypothesized that the recruitment of SET7/9
serves to stabilize the pre-initiation complex by histone methylation and
thereby promote transcription
(49).
Taken together, our data point to the existence of a histone code
underlying Ins gene transcription in cells. Although our
studies have focused on general H3 and H4 acetylation and H3–K4 and
H3–K9 methylation patterns, we propose this code will likely involve an
intricate network of several types of histone modifications that is
established early in development and becomes more refined as differentiation
of cells proceeds. This epigenetic mechanism likely complements the
well established genetic mechanism of transcription factor-mediated activation
that is believed to regulate Ins transcription. Accordingly, we
propose the preliminary model for Ins gene activation shown in
Fig. 7. This model makes the
assumption that activation of the Ins promoter in a previously
inactive environment is accompanied by specific changes in histone
modifications. This assumption would appear to be a reasonable one, as dynamic
changes in histone modifications have clearly been observed in several other
systems (31,
32,
46,
50–52),
and even recently in the case of the Ins gene upon induction with
glucose (53). We propose that
chromatin exists in a "precursor state" similar to that observed
in undifferentiated ES cells, and is characterized predominantly by H4
hyperacetylation. This state might be envisioned to be euchromatin in nature,
because ES cells can be induced to express the Ins gene under
specific conditions (6,
29,
44,
45). However, this precursor
state is likely to be transient, as stem cells rapidly differentiate, and two
possible fates can be envisioned. In the non- cell fate, the activity of
histone deacetylases may predominate, such that deacetylation occurs and
chromatin is condensed to the heterochromatin form (right arm of
Fig. 7). This condensed
chromatin impedes accessibility of DNA to transcription factors, so that the
gene remains silenced even in the face of heterologous expression of
cell transcription factors (Pdx1, NeuroD1, etc.). In the cell fate
(left arm of Fig. 7),
the activity of HATs (e.g. p300) and HMTs (e.g. SET7/9)
predominate, thus stabilizing the euchromatin state and allowing access to
transactivating transcription factors. Although
Fig. 7 indicates that the
action of HATs and HMTs precedes the action of transcription factors, it is
possible that both events are variably interrelated, because HATs or HMTs
might be recruited to the promoter by transcription factors. We anticipate
that this model will serve as a framework for further studies to define more
precisely the histone code of the Ins gene and to identify additional
enzymes and chromatin remodeling complexes participating in the establishment
of Ins chromatin states.
|
|
FOOTNOTES |
|---|
¶ To whom correspondence should be addressed: University of Virginia Health Sciences Center, 450 Ray C. Hunt Dr., Box 801407, Charlottesville, VA 22903. Tel.: 434-243-9373; Fax: 434-982-3796; E-mail: mirmira{at}virginia.edu.
1 Throughout the text, the gene symbol Ins refers to both the mouse
Ins1 and Ins2 genes.
2 The abbreviations used are: ChIP, chromatin immunoprecipitation; Ins,
insulin; HAT, histone acetyltransferase; HMT, histone methyltransferase; ES,
embryonic stem; RT, reverse transcriptase.
|
ACKNOWLEDGMENTS |
|---|
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  E. S. Pentz, M. L. S. Sequeira Lopez, M. Cordaillat, and R. A. Gomez Identity of the renin cell is mediated by cAMP and chromatin remodeling: an in vitro model for studying cell recruitment and plasticity Am J Physiol Heart Circ Physiol, February 1, 2008; 294(2): H699 - H707. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. S. Lalmansingh and R. M. Uht Estradiol Regulates Corticotropin-Releasing Hormone Gene (crh) Expression in a Rapid and Phasic Manner that Parallels Estrogen Receptor-{alpha} and - Recruitment to a 3',5'-Cyclic Adenosine 5'-Monophosphate Regulatory Region of the Proximal crh Promoter Endocrinology, January 1, 2008; 149(1): 346 - 357. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Mutskov, B. M. Raaka, G. Felsenfeld, and M. C. Gershengorn The Human Insulin Gene Displays Transcriptionally Active Epigenetic Marks in Islet-Derived Mesenchymal Precursor Cells in the Absence of Insulin Expression Stem Cells, December 1, 2007; 25(12): 3223 - 3233. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 |
