Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M303079200 on April 14, 2003

J. Biol. Chem., Vol. 278, Issue 26, 24026-24032, June 27, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/26/24026    most recent
M303079200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zheng, Y.-l.
Right arrow Articles by Pant, H. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zheng, Y.-l.
Right arrow Articles by Pant, H. C.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Phosphorylation of the Head Domain of Neurofilament Protein (NF-M)

A FACTOR REGULATING TOPOGRAPHIC PHOSPHORYLATION OF NF-M TAIL DOMAIN KSP SITES IN NEURONS*

Ya-li Zheng, Bing-Sheng Li, Veeranna {ddagger} and Harish C. Pant §

From the Laboratory of Neurochemistry, NINDS, National Institutes of Health, Bethesda, Maryland 20892

Received for publication, March 25, 2003


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In neurons the phosphorylation of neurofilament (NF) proteins NF-M and NF-H is topographically regulated. Although kinases and NF subunits are synthesized in cell bodies, extensive phosphorylation of the KSP repeats in tail domains of NF-M and NF-H occurs primarily in axons. The nature of this regulation, however, is not understood. As obligate heteropolymers, NF assembly requires interactions between the core NF-L with NF-M or NF-H subunits, a process inhibited by NF head domain phosphorylation. Phosphorylation of head domains at protein kinase A (PKA)-specific sites seems to occur transiently in cell bodies after NF subunit synthesis. We have proposed that transient phosphorylation of head domains prevents NF assembly in the soma and inhibits tail domain phosphorylation; i.e. assembly and KSP phosphorylation in axons depends on prior dephosphorylation of head domain sites. Deregulation of this process leads to pathological accumulations of phosphorylated NFs in the soma as seen in some neurodegenerative disorders. To test this hypothesis, we studied the effect of PKA phosphorylation of the NF-M head domain on phosphorylation of tail domain KSP sites. In rat cortical neurons we showed that head domain phosphorylation of endogenous NF-M by forskolin-activated PKA inhibits NF-M tail domain phosphorylation. To demonstrate the site specificity of PKA phosphorylation and its effect on tail domain phosphorylation, we transfected NIH3T3 cells with NF-M mutated at PKA-specific head domain serine residues. Epidermal growth factor stimulation of cells with mutant NF-M in the presence of forskolin exhibited no inhibition of NF-tail domain phosphorylation compared with the wild type NF-M-transfected cells. This is consistent with our hypothesis that transient phosphorylation of NF-M head domains inhibits tail domain phosphorylation and suggests this as one of several mechanisms underlying topographic regulation.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Neurofilament (NF)1 proteins assemble into neuron-specific intermediate filaments, the predominant cytoskeletal component in large myelinated axons. Neurofilaments consist of three protein subunits, high (NF-H), middle (NF-M), and low (NF-L) molecular weight, each composed of three domains, an N-terminal head domain, an a-helix rich central rod domain, and C-terminal tail domains (1). NFs are obligate heteropolymers in vivo, with assembly depending on a core NF-L subunit interacting with NF-M or NF-H subunits (2–4). Although head and rod domains are essential for assembly, tail domains are dispensable but may regulate filament length (2, 5).

NF protein phosphorylation plays a key role in the dynamic remodeling of cytoskeletal architecture during axonal growth, guidance, and synaptogenesis (6–8). N-terminal head domains are phosphorylated by second messenger-dependent protein kinases, the cyclic AMP-dependent protein kinase (protein kinase A, PKA), and protein kinase C (PKC) (9–12). The C-terminal tails of NF-M and NF-H, enriched in numerous Lys-Ser-Pro (KSP) repeats, on the other hand, are preferred substrates for the second messenger-independent kinases associated with neurofilaments, such as CKI (13) and GSK3 (14), and the proline-directed kinases Erk1/2 and cdk5 (15–17).

NF phosphorylation is topographically regulated within neurons. N-terminal head domain phosphorylation by PKA at Ser55 in NFL or Ser46 in NF-M inhibits assembly into a heteropolymer in vitro and in vivo (3, 9, 12, 19, 20). It has been suggested that this transient head domain phosphorylation in cell bodies inhibits NF polymerization and filament formation (4, 21). Extensive phosphorylation of KSP repeats in the tail domain of NF-M and NF-H occurs primarily in axons (7, 22, 23). These result in sidearm formation, increased inter-neurofilament spacing, radial growth of axons, and increased conduction velocity (24–26). More recent studies, however, of NF-H null mice, or mice transfected with a NF-H tailless mutant, suggest that neither NF-H nor its phosphorylated tail are essential to the above neuronal properties (27, 28). Nevertheless, deregulation of NF-M and NF-H tail domain phosphorylation is correlated with some pathologies seen in neurodegenerative disorders such as amyotrophic lateral sclerosis (ALS) in which tail domain phosphorylation occurs abnormally in perikarya (29–31).

In a model of the dynamics of neurofilament phosphorylation, we postulated that the transient phosphorylation of head domains in cell bodies prevented neurofilament assembly and tail domain phosphorylation (32). Only after dephosphorylation of the head domain in the axon hillock, as NFs assembled into filaments for transport in the axon, do tail domain KSP repeats become accessible to phosphorylation. The hypothesis predicts that phosphorylation of head domain sites of NF-M, for example by PKA, should inhibit phosphorylation of the tail domain KSP repeats. To test this hypothesis, we stimulated PKA phosphorylation of NF-M head domain sites with forskolin in primary cortical neurons and in NIH3T3 cells transfected with NF-M mutated in PKA-specific head domain sites to prevent phosphorylation. We showed that activation of PKA in cortical neurons inhibited growth factor-induced tail domain phosphorylation of endogenous NF-M by Erk1/2, despite significant activation of the MAPK cascade. The results of the transfection experiment were more compelling, because they showed that tail domain phosphorylation of transfected wild type NF-M was inhibited by forskolin and EGF stimulation of the MAPK cascade, whereas tail domain phosphorylation was not inhibited in cells transfected with the mutant NF-M. These findings are consistent with the hypothesis that phosphorylation of specific serine sites in the head domain of NF-M by PKA inhibits phosphorylation of KSP sites in the NF-M tail domain and poses a mechanism for topographic regulation of cytoskeletal protein phosphorylation in neurons.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Reagents—The phospho-Erk1 and -Erk2 polyclonal and monoclonal antibodies (prepared against a peptide phosphorylated at threonine 202 and tyrosine 204, Thr202/Tyr204 Erk1 and Erk2), and the MEK inhibitor PD98059 were obtained from Cell Signaling Technology, Inc. (Beverly, MA). An antibody to NF-M phospho form (RMO-281) was from Zymed Laboratories (San Francisco, CA). SMI31 and SMI32 monoclonal antibodies were obtained from Sternberger Monoclonals Inc. (Lutherville, MD). Anti-NF-M C-terminal polyclonal antibody (phospho-independent) was purchased from Chemicon International (Temecula, CA). The pcDNA/Amp eukaryotic expression vector was purchased from Invitrogen (San Diego, CA). NGF, EGF, dibutyryl-cAMP, and H89 were obtained from Sigma (Louis, MO); forskolin and KT5720 were purchased from Alomone Laboratories (Jerusalem).

Plasmids and Constructs—The full-length pcNDA-NF-M (wild type) construct was prepared as described previously (17). The head domain phosphorylation sites of NF-M were mutated by site-directed substitution of Ser1, Ser23, and Ser46 with alanine according to the methods described previously (33, 34). First, NF-M S23A was generated by polymerase chain reaction mutagenesis. 5' and 3' NF-M primers were used in combination with the mutagenic primers acccggtccgccttcagtcgtggtg and cacacgactgaaggcggcccgggt, respectively. The wild type NF-M was used as a template. Then, the NF-M mutant S1A/S23A was produced by using mutagenic primers S1A, aagatggaattcgcctacacgctg, and mutant NF-M S23A as a template. Finally, the NF-M S1A/S23A/S46A mutant was made by polymerase chain reaction mutagenesis using NF-M S1A/S23A as a template. 5' and 3' NF-M primers were used in combination with the mutagenic primers S46A, ggctcgcccgccaccgtgtcctcc, and ggaggacacggtggcgggcgagcc, respectively. The final PCR product was digested with EcoRI and NotI and inserted into a pGEM-T vector. After confirming the sequence by DNA sequencing, the triple substitution NF-M mutant was made by cloning the EcoRI/NotI fragment of the pGEM-T NF-M S1A/S23A/S46A mutant into the EcoRI/NotI site of CMV (pCDNA3.1) vector. Mutagenesis was verified by sequencing.

Primary Cultures of Cortical Neurons—Primary cultures of rat cortical neurons were prepared from E18 rat fetuses. Brains were dissected and dissociated with papain and DNase I. For immunohistochemistry, cells were plated at a density of 1.0 x 105/cells per cm2 on glass coverslips precoated with 20 µg/ml poly-L-lysine. For Western blot or immunoprecipitation, cells were plated at 5 x 106 per each six wells on Nunc multiwell plates precoated with 20 µg/ml poly-L-lysine. Cells were maintained in B27/neurobasal medium containing 2 mM glutamine, 100 units/ml penicillin, and 100 µg/ml streptomycin in a humidified atmosphere of 95% air and 5% CO2 at 37 °C for 7 days. Under these conditions the contamination of glial cells, measured by staining with glial fibrillary protein antibody, was less than 10%. After 7 days cells were starved in the presence of 0.2% B27/neurobasal medium overnight (to reduce any background stimulation by serum factors) and treated with 20 µM forskolin or 100 µM dibutyryl-cAMP, 50 ng/ml NGF, 2.5 µM KT5720, or 10 µM H89 (PKA inhibitors) and 50 µM PD98059 (MEK inhibitor).

Cell Culture and Transfection—NIH3T3 cells were obtained from the American Type Culture Collection (Rockville, MD) and cultured in Dulbecco's modified Eagle's medium with 10% calf serum supplemented with 100 units/ml penicillin and 100 µg/ml streptomycin. Cells were maintained at 37 °C in a humidified atmosphere of 5% CO2. The cells were transiently transfected with wild type NF-M (wtNF-M) or mutant (serines 1, 23, and 46 and alanines 1, 23, and 46) NF-M (mtNF-M) expression constructs using FuGENE 6 transfection reagent (Roche Applied Science, Indianapolis, IN) according to the manufacturer's instructions. Twenty-four hours post-transfection, cells were starved in the presence of 0.2% calf serum overnight (to reduce any background stimulation by serum factors) and then treated with 25 ng/ml EGF, 20 µM forskolin, or 100 µM dibutyryl-cAMP, 2.5 µM KT5720, or 10 µM H89 (PKA inhibitors) and 50 µM PD98059.

Immunoblotting—Western blot analysis was performed as described previously (35). In brief, cells were harvested by scraping from dishes and lysed in ice-cold lysis buffer (20 mM Tris, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% SDS, 2.5 mM sodium pyrophosphate, 1 mM {beta}-glycerol phosphate, and 2.5 mM Navo4, supplemented with a mixture of protease inhibitors and 1 mM phenylmethylsulfonyl fluoride) by passing though a 21-gauge needle several times and incubating for 30 min on ice. After centrifugation for 20 min at 13,000 x g at 4 °C, the protein concentrations of the supernatants were determined using BCA protein reagent. An equal amount of total protein (25 µg of protein/lane) was resolved on a 4–20% SDS-polyacrylamide gel and blotted onto a polyvinylidene difluoride membrane. This membrane was incubated in blocking buffer containing 20 mM Tris-HCl (pH 7.4), 150 mM NaCl, and 0.1% (v/v) Tween 20 (TTBS) plus 5% dry milk (w/v) for 1 h at room temperature. This was followed by incubation overnight at 4 °C in primary antibodies: anti-SMI-31 (phospho-NF-H and phospho-NF-M antibodies, 1:5000), RMO-281, a specific antibody to NF-M phospho-epitopes (1:3000), anti-NF-M C-terminal polyclonal antibody (phospho-independent, 1:5000), and phospho- or phospho-independent Erk1/2 antibodies (1:2000 and 1:1000). The membranes were then washed four times in TTBS (5 min/each). This was followed by incubation in secondary antibody (goat- anti-mouse or goat anti-rabbit IgG (H+L)-horseradish peroxidase conjugate at a dilution of 1: 3000) for 2 h at room temperature. Western blots were analyzed using the Enhanced Chemiluminescence (ECL) kit following the manufacturer's instructions (Amersham Biosciences).

Immunofluorescence—After NIH3T3 cells were transfected on glass coverslips coated with poly-L-lysine, cells were washed twice in PBS and fixed for 30 min at room temperature in 4% paraformaldehyde, PBS, and 10 mM EGTA and permeabilized (with 25 mM Tris, pH 7.4, 150 mM NaCl, and 0.2% Triton X-100) for 15 min. The coverslips were incubated overnight at 4 °C with primary antibody, RMO-281, a specific antibody to NF-M phospho form (1:250). Antibody was diluted in PBS with 0.1% Triton X-100. After a wash in PBS (three times, 15 min each) the coverslips were incubated with fluorescein isothiocyanate-conjugated goat anti-mouse IgG and rhodamine-labeled goat anti-rabbit IgG secondary antibody for 1 h at room temperature, followed by three PBS washes, and mounted in aqueous medium. Fluorescent images were observed with a Zeiss LSM-410 laser-scanning confocal microscope. Images were processed and merged by using Adobe Photoshop software.

Protein Kinase A Assay—PKA was assayed by using Promega's SignaTECTTM cAMP-dependent PKA assay system that uses biotinylated Kemptide (LRRASLG), a peptide substrate derived from pyruvate kinase. This substrate is highly specific for PKA. A total reaction volume of 25 µl of kinase assay mixture was used, containing 5x PKA assay buffer (200 mM Tris-HCl, pH 7.4; 100 mM MgCl2; 0.5 mg/ml BSA), PKA biotinylated peptide substrate, [{gamma}-32P]ATP mix, and enzyme sample in the presence or absence of 0.025 mM cAMP. The reaction was initiated by adding 5 µl of the enzyme extract and incubated at 30 °C for 5min. The reaction was terminated by adding 12.5 µl of termination buffer (7.5 M guanidine hydrochloride), and 10 µl from each tube was spotted onto a pre-numbered SAM2TM membrane square. The membranes were washed four times in 2 M NaCl, four times in 2 M NaCl 1% H3PO4, and one time in de-ionized water then rinsed with 95% ethanol. The radioactivity was measured in a liquid scintillation counter. PKA-specific activity was expressed in picomoles of ATP/min/µg of protein and calculated using the formula, enzyme-specific activity in picomoles of ATP/min/µg of protein = [(cpmreaction with substrate – cpmreaction without substrate) x 37.5]/(10 x timemin x amount of protein in reactionpg x specific activity of [{gamma}-32P]ATP). In this formula 37.5 is the sum of the reaction volume (25 µl) plus the termination buffer volume (12.5 µl). 10 is the volume in microliters of the sample spotted onto SAM2TM membranes.

Specific activity of [{gamma}-32P]ATP = ((37.5/5) X)/2500 (5 is the volume in microliters of the samples spotted onto SAM2TM membranes without washing; X is the average cpm of the 5-µl samples spotted onto SAM2TM membranes without washing; and 2500 is the number of ATP in the reaction).

In Vitro Phosphorylation of NF-M—The NF-M expression vector was obtained from Dr. R. K. H. Liem (Columbia University, NY). The bacterially expressed full-length NF-M was purified as described previously (36). Phosphorylation of NF-M was performed basically as described previously (16, 37). Briefly, phosphorylation was performed in a total volume of 50 µl of reaction mixture containing 50 mM Tris-HCl, pH 7.4, 5 mM MgCl2, 1 mM each of sodium vanadate, EGTA, EDTA, dithiothreitol, and [{gamma}-32P]ATP, and 10 µg of NF-M, plus 0.1 µM okadaic acid or microcystin. 10 µl of enzyme was added, and the mixture was incubated for 1 h. The reaction was terminated by the addition of 10% trichloroacetic acid. After washing 2x with 10% trichloroacetic acid and 2x with 90% alcohol, the pellet was dissolved in SDS-PAGE buffer. Phosphorylation was assayed by autoradiography. The phosphorylation of NF-M by PKA was induced in the presence of 10 µl of catalytic subunit of PKA (Sigma, St. Louis, MO).


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Phosphorylation of the NF-M Head Domain by PKA in Vitro Inhibits NF-M Tail Domain Phosphorylation—To investigate the effect of PKA phosphorylation of the NF-M head domain on phosphorylation of the KSP repeats in the tail domain, we first studied NF-M phosphorylation by PKA and MAPK; i.e. constitutively active MEK/Erk1/2 in vitro. The kinases were used either alone or together in a standard kinase assay system using bacterial expressed NF-M protein as substrate (36). An autoradiograph of the assay is shown in Fig. 1A with a corresponding histogram showing quantitation, Fig. 1C. Incubation of NF-M in the presence of the catalytic subunit of PKA showed head domain phosphorylation of NF-M (Fig. 1A and 1C, lane 2). Phosphorylation of NF-M in the presence of both MEK-activated MAPK and PKA showed elevated phosphorylation due to head and tail domain phosphorylation (Fig. 1A and 1C, lane 3). Significantly increased NF-M phosphorylation was obtained in the presence of MAPK/constitutively active MEK without PKA, due to more extensive tail domain phosphorylation (Fig. 1, A and C, lane 4). A comparison of lane 3 with lane 4 shows almost a 2-fold inhibition of MAPK tail domain phosphorylation by PKA. It is important to note that the order of head and tail domain phosphorylation has an important effect on the outcome of tail domain phosphorylation. When the NF-M was phosphorylated first by MAPK then by PKA there was an increase in total NF-M phosphorylation (data not shown), a result consistent with earlier studies (16). On the other hand, when NF-M was first phosphorylated by PKA then by active MAPK, a significant reduction in phosphorylation was observed (Fig. 1A, compare lanes 3 and 4). These results suggest that PKA phosphorylation of the NF-M head domain inhibits subsequent phosphorylation of the tail domain by a proline-directed kinase.



View larger version (14K):
[in this window]
[in a new window]
  		FIG. 1.
Head domain phosphorylation of NF-M decreases tail domain phosphorylation in vitro. The phosphorylation of NF-M protein by PKA and MEK/MAPK was performed in the presence or absence of bacterially expressed and purified NF-M protein. The kinases were used either alone or together in a standard kinase assay system as described under "Materials and Methods." A, an autoradiograph showing head domain phosphorylation of NF-M in lane 2 in the presence of PKA alone. In lane 3, both head domain and tail domain phosphorylations of NF-M were seen in the presence of activated MAPK and PKA. In lane 4, tail domain phosphorylation of NF-M was expressed in the presence of MAPK alone. In all these experiments a mixture of constitutively active MEK and expressed Erk1/2 kinases were used as a source of active MAPK. B, total NF-M proteins stained with silver. C, quantification of NF-M phosphorylation as seen in A. Data represent mean ± S.D. of three experiments.

 

Head Domain Phosphorylation of NF-M Inhibits the Tail Domain Phosphorylation of NF-M in Primary Cortical Neurons—To determine whether PKA activation and phosphorylation of the NF-M head domain in neuronal cells affects tail domain phosphorylation, we cultured E18 primary cortical neurons in the presence and absence of forskolin. After 7 days of culture, cells were starved and some were then treated with forskolin (20 µM), whereas others were treated with forskolin plus KT5720 (2.5 µM), a PKA inhibitor. The cell lysates were assayed for PKA kinase activity and showed that forskolin stimulated activity 6-fold (Fig. 2A, lanes 1 and 2), whereas the addition of the specific inhibitor restored activity to the control level (lane 3). The same cell lysates were subjected to Western blot analysis using antibody specific for NF-M phospho-epitopes in the tail domain (RMO-281) and anti NF-M antibody (for total NF-M). We found that activation of PKA decreases the tail domain phosphorylation of NF-M (Fig. 2B, lane 2). The PKA inhibitor (Fig. 2B, lane 3) reversed this inhibitory effect. Because it is well established that forskolin activation of PKA activity affects the MAPK pathway in most cells, including neurons (up-regulation or down-regulation, depending on specific neuron type) (38, 39), it was essential to determine how the MAPK pathway was affected by forskolin in these cortical neurons. In Fig. 2C the data show that forskolin significantly activates Erk1/2 activity more than 2-fold (lane 2), which is inhibited by the PKA inhibitor (lane 3). This suggests that, despite forskolin activation of the MAPKs, known to phosphorylate KSP repeats in rat NF-M (16), PKA phosphorylation of the head domain of NF-M did inhibit tail domain phosphorylation.



View larger version (24K):
[in this window]
[in a new window]
  		FIG. 2.
Activation of PKA by forskolin inhibits the tail domain phosphorylation of NF-M in primary cortical neurons. A, analysis of PKA kinase activity. Primary cortical neurons cultured from E18 rat embryos for 7 days in B27/neurobasal medium then starved in 0.2% B27/neurobasal medium overnight before treatment with 20 µM forskolin for 1 h (lane 2). Lane 1 is a lysate from non-treated cells. Other cells were treated for 1 h with 2.5 µM KT5720, then with 20 µM forskolin for 1 h(lane 3). Protein concentrations were determined (25 µg/lane). PKA activity was determined using Promega's SignaTECTTM cAMP-dependent PKA assay system with Kemptide as substrate. B, tail domain phosphorylation of NF-M of the same lysates was assayed by Western blot analysis using a specific NF-M tail domain phosphoantibody, RMO-281, and an antibody that recognizes total NF-M. Lane 1 is a lysate from non-treated cells; lane 2, cells treated with forskolin; lane 3, cells treated with KT5720/forskolin. Quantification is seen in the histogram below. C, using the same cell lysates, the phospho-Erk1/2 and total Erk1/2 were measured with specific antibodies. The data show that phospho-Erk1/2 levels were elevated by forskolin treatment. Lanes are identical to those in B. The histogram shows corresponding quantification of NF-M phosphorylation. Data represent mean ± S.D. of three experiments.

 

NGF Stimulation of MAPK Phosphorylation of the NF-M Tail Domain Was Inhibited by Activation of PKA in Primary Cultured Cortical Neurons—Studies on PC12 and neuroblastoma cells showed that NGF induces the MAPK cascade via receptor-linked protein tyrosine phosphorylation of the Ras-Raf pathway (40–42). In a previous study we showed that the activated MAPK cascade induced tail domain phosphorylation of NF-M in transfected NIH3T3 cells (17). We assumed that, if the MAPK cascade can be induced in cortical neurons as in PC12 cells, it may result in elevated NF-M tail domain phosphorylation. This activated system could then be used to study the effect of forskolin stimulation of PKA phosphorylation on NF-M tail domain phosphorylation. We first treated neurons with NGF and showed a significant activation of Erk1/2 phosphorylation, suggesting that the MAPK cascade had indeed been stimulated (Fig. 3A, lane 2). Use of the MEK1 inhibitor PD98059 eliminated this activation (lane 3), suggesting that NGF could induce MAPK activity in primary cortical neurons. Moreover, activation of Erk1/2 by NGF resulted in increased phosphorylation of NF-M as seen in the Western blots of the same lysates using NF-M phospho-specific antibody RMO-281 (Fig. 3B, lane 2), and this also could be inhibited by the MEK1 kinase inhibitor PD98059 (Fig. 3B, lane 3). These results confirmed that the Ras/Raf/MAPK signaling pathway was involved in mediating endogenous NF-M tail domain phosphorylation in primary cortical neurons (16, 17).



View larger version (34K):
[in this window]
[in a new window]
  		FIG. 3.
PKA inhibits the tail domain phosphorylation of the NF-M induced by NGF activation of Erk1/2 in primary cortical neurons. E18 rat cortical neurons cultured for 7 days in B27/neurobasal medium then starved in 0.2% B27/neurobasal medium overnight before treatment with NGF (50 ng/ml) for 20 min in the presence or absence of PD98059 (50 µM) for 1 h. Cell lysates were prepared, and protein concentrations were determined (25 µg/lane). A, phospho-Erk1/2 and total Erk1/2 were detected by Western blot analysis using specific antibodies. Histogram below shows quantification of Erk1/2 phosphorylation. Data represent mean ± S.D. of three experiments. B, phosphorylation of NF-M tail domain and total NF-M were assayed in the same cell lysates by Western blot analysis using NF-M tail domain phospho-specific antibody RMO-281 and anti-NF M antibody. C, E18 cortical neurons treated with forskolin and NGF as follows: lane 1, NGF alone for 20 min; lane 2, forskolin for 1 h, then NGF for 20 min; lane 3, cells were treated with KT5720 inhibitor for 1 h, followed by Forskolin for 1 h, and then NGF for 20 min. Cell lysates were prepared and subjected to Western blot to detect phospho- and total Erk1/2 levels using specific antibodies. D, tail domain phosphorylation of NF-M of the same lysates using specific antibodies. E, analysis of PKA kinase activity. Aliquots from the same cell lysates were used for PKA kinase assay. Data represent mean ± S.D. of three experiments.

 

To determine whether the activation of PKA inhibits tail domain phosphorylation of NF-M induced by NGF stimulation of MAPK, we treated neurons with NGF only, forskolin plus NGF, or forskolin, NGF, and KT5720. With this regimen, it was evident that forskolin plus NGF significantly enhanced Erk1/2 phosphorylation (lane 2, Fig. 3C), which was restored to basal levels by the PKA inhibitor KT5720 (Fig. 3C, lane 3). Western blot analysis of these same lysates was performed using RMO-281, SMI31, SMI32, and anti-NF-M antibodies to detect the tail domain phospho-NF-M, dephospho-NF-M and total NF-M, respectively. Results showed that the induced tail domain phosphorylation of NF-M by NGF (Fig. 3D, lane 1) was markedly inhibited by forskolin (Fig. 3D, lane 2, compared with lane 1), but it was reversed by the PKA inhibitor, KT5720 (Fig. 3D, lane 3, compared with lane 2). In vitro PKA kinase assay was performed in same cell lysates to show the activity of PKA (Fig. 3E). Here again, as in the previous experiment, despite the stimulated activity of Erk1/2, tail domain phosphorylation was decreased in the presence of activated PKA. These results are consistent with the hypothesis that head domain phosphorylation of NF-M by PKA inhibits the tail domain phosphorylation of NF-M induced by NGF via the MAPK cascade. Although the activity of MAPK (Erk1/2) was elevated by PKA activation in these experiments, NF-M tail domain phosphorylation was reduced suggesting that a conformational change induced by PKA phosphorylation limits KSP domain phosphorylation.

Mutation of Serine 1, 23, and 46 Residues to Alanine in the Head Domain of NF-M Prevents PKA Phosphorylation and Fails to Inhibit Tail Domain Phosphorylation Induced by Erk1/2 Activation in Transfected NIH3T3 Cells—Previous studies have clearly shown that Ser23 is a specific NF-M head domain site for PKA phosphorylation (43), whereas Ser1 and Ser46 were confirmed as PKA phosphorylation sites in the N-terminal head domain of NF-M (44). To obtain direct evidence of head domain phosphorylation of NF-M by PKA as it affects tail domain phosphorylation of NF-M in vivo, we constructed a site-directed mutation of the NF-M head domain, substituting alanines at residues Ser1, Ser23, and Ser46 (mtNF-M), as described under "Materials and Methods." NIH3T3 cells were transiently transfected with a wild type NF-M (wtNF-M) expression construct, or with the mtNF-M. The hypothesis predicts that PKA stimulation by forskolin will fail to phosphorylate these mutated, sites and, as a result, EGF activation of the MAPK pathway should significantly phosphorylate the NF-M tail domain sites in contrast to the cells with wild type NF-M. The details of the experimental protocol are included in the figure legend, and the results are shown in Fig. 4 (A–C). The phosphorylation of tail domain NF-M was detected by Western blot analysis and immunocytochemistry using phospho-specific antibodies, RMO-281 and SMI31 (Fig. 4, A and D). In wtNF-M-transfected cells, the results showed that induced tail domain phosphorylation of NF-M by EGF stimulation of the MAPK cascade (Fig. 4, A and B, lane 4) was inhibited more than 6-fold by forskolin treatment (Fig. 4, A and B, lane 2). PKA inhibitor KT5720 (Fig. 4, A and B, lane 3) reversed this inhibitory effect. These results are in agreement with the experiments on cortical neurons (Fig. 3). It should be noted that, contrary to previous reports that forskolin inhibits the EGF-induced MAPK cascade in NIH3T3 cells (45, 46), we found that in all cases of forskolin treatment Erk1/2 was equally activated by EGF (data not shown). What is most significant, however, is that in cells transfected with the head domain mutant (mtNF-M), the induced tail domain phosphorylation of NF-M by EGF was not inhibited by forskolin (Fig. 4, A and B, lane 5). These results suggest that activation of PKA (Fig. 4C, lane 5) does not inhibit tail domain phosphorylation of NF-M in the absence of phosphorylation at PKA-specific serine residues in the NF-M head domain.



View larger version (32K):
[in this window]
[in a new window]
  		FIG. 4.
PKA activation does not inhibit the tail domain phosphorylation induced by EGF activation of Erk1/2 in head domain mutated NF-M (mtNF-M) in transfected NIH3T3 cells. NIH3T3 cells were transiently transfected with wtNF-M (A and B, lanes 1–4; D, panels a–c) and mutant NF-M (mtNF-M), S1A/S23A and S46A mutated in the head domain (A and B, lanes 5–7; D, panel d). After 24 h, cells were starved overnight with 0.2% serum and were treated as follows (A–C): in the cells transfected with wtNF-M, no treatment (lane 1); forskolin (20 µM, 1 h), then added EGF (25 ng/ml) for 20 min (lane 2); KT5720 (2.5 µM) for 1 h, then forskolin was added (20 µM) for 1 h, followed by EGF (25 ng/ml) for 20 min (lane 3); and EGF only (25 ng/ml) for 20 min (lane 4); in the cells transfected with mtNF-M, forskolin (20 µM), 1 h then added EGF (25 ng/ml) for 20 min (lane 5); EGF only (25 ng/ml) for 20 min (lane 6); and PD98095 first for 1 h then EGF for 20 min (lane 7). A, the levels of tail domain phosphorylation of NF-M and total NF-M were detected by Western blot using phospho-NF-M antibody, SMI31, and anti-NF-M antibody, respectively. B, the quantification of NF-M phosphorylation. C, analysis of PKA activity. The same cell lysates were used for the PKA assay using Promega's SignaTECTTM cAMP-dependent PKA assay system. Data represent mean ± S.D. of three experiments. D, the tail domain phosphorylation of NF-M was detected by immunocytochemistry staining using phospho-specific NF-M antibody, SMI31. NIH3T3 cells were transiently transfected with wild type NF-M (a–c) and mutant NF-M (d). The cells were treated as follows: EGF only (a); forskolin followed by EGF (b and d); KT5720, then forskolin was added followed by EGF (c).

 

In Fig. 4C assays of PKA activity corresponding to each lysate in Fig. 4 (A and B) are shown to indicate the levels of forskolin activation. Fig. 4D represents the results of an immunocytochemistry (ICC) analysis of the expression of phospho-NF-M in wtNF-M-transfected cells exposed to (panel a) EGF alone, (panel b) EGF plus forskolin, and (panel c) EGF, forskolin, and KT5720, the PKA inhibitor. Panel d shows expression of NF-M in cells transfected with mutant NF-M and treated with EGF plus forskolin. A comparison of panel b with panel d shows the significantly greater expression of phosphorylated NF-M in the cells with mutant NF-M, which is consistent with the Western blot data in Fig. 4 (A and B).


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Based on our studies of the squid giant axon and mammalian brains, we proposed that phosphorylation of cytoskeletal components in neurons is compartmentalized and topographically regulated (47–49). Although the NF subunits and their relevant kinases are synthesized in cell bodies, stable phosphorylation of most KSP repeats in the NF-M and NF-H C-terminal tail domains by proline-directed kinases occurs primarily in the axon during slow transport (7, 16, 50–53). On the other hand, phosphorylation of N-terminal head domain motifs by PKA and PKC occurs transiently in cell bodies and prevents NF assembly (3, 4, 9, 10, 12, 19, 21, 55). If this occurs immediately after synthesis, premature cell body assembly is inhibited thereby protecting the neuron from abnormal accumulations of phosphorylated cytoskeletal aggregates, as seen in such neurode-generative disorders as ALS (56). This would suggest that dephosphorylation of head domains must occur before NF assembly and extensive tail domain phosphorylation can begin. In fact, few NFs are seen in cell bodies; only small oligomers can be detected, which suggests that consequential neurofilament assembly is restricted to axons during transport (57). Results of a study in which dephosphorylation of NF-L Ser55 was prevented (by mutation to Asp to mimic permanent phosphorylation), resulted in pathological accumulation of NF aggregates in brain neuronal cell bodies, are certainly consistent with this model (58).

The mechanisms underlying compartment-specific patterns of phosphorylation are not understood. We have proposed that transient head domain phosphorylation of NF-L and presumably of NF-M by PKA occurs within neuronal cell bodies to prevent NF assembly and tail domain phosphorylation by proline-directed kinases (8, 32). As partially assembled subunits enter the axon hillock and proximal axon, the hypothesis poses dephosphorylation of head domain sites, followed by NF assembly within the axon, where KSP repeats in C-terminal tail domains of NF-M and NF-H are extensively phosphorylated (6, 7).

The experimental results to test this model are, indeed, consistent with a key prediction of the hypothesis, that PKA phosphorylation of head domain sites in NF-M should inhibit phosphorylation of KSP repeats in the NF-M C-terminal tail domain. In vitro, the addition of PKA to an activated MAPK assay with NF-M as substrate resulted in a 50% reduction in tail domain phosphorylation, a result that could be attributed to simultaneous head domain phosphorylation by PKA. Instead of an additive effect, as one might expect if the kinases acted synergistically, an inhibition of phosphorylation was seen instead.

The in vivo experiments are much more compelling, however. It is well established that there is considerable cross-talk between the PKA and MAPK signaling pathways in a variety of cell types, including neurons (38). The response is specific to cell type; in some cases forskolin activation of PKA can down-regulate the MAPK cascade as in NIH3T3 cells (59), whereas in primary neurons, depending on developmental age, MAPKs are either unaffected (1 day in culture) or are significantly activated (7 days in culture) (39). In agreement, the cortical neurons in our experiments, cultured for 7 days, did in fact respond with activation of the MAPK pathway after forskolin treatment (Fig. 2C). Nevertheless, the endogenous level of NF-M tail domain phosphorylation was reduced, instead of increased, as one might expect, because MAPKs are the principal proline-directed kinases that phosphorylate KSP repeats in rat NF-M and NF-H (16).

Experimental stimulation of the MAPK pathway by the addition of NGF to these primary cortical neurons resulted in a 3-fold activation of Erk1/2 kinase activity, with a concomitant increase in C-terminal tail domain phosphorylation of NF-M. Surprisingly, NGF is primarily a sympathetic and sensory neuron trophic factor with few reported instances of cortical neuron effects. Nevertheless, despite almost 2-fold further activation of the Erk1/2 pathway after the addition of forskolin and PKA stimulation, NF-M tail domain phosphorylation was inhibited, rather than activated (Fig. 3). The reduced phosphorylation of NF-M tail domain phosphorylation after forskolin treatment in both of these in vivo experiments may be interpreted as an intramolecular inhibition of tail domain phosphorylation by phosphorylation of PKA motifs in the head domain.

This conclusion is strongly supported by the demonstration that NF-M mutants with three alanine-blocked and PKA-specific serine head domain sites, when transfected into EGF-stimulated NIH3T3 cells, exhibited normal tail domain phosphorylation in the presence of forskolin-activated PKA. Tail domain phosphorylation of wild type NF-M, on the other hand, was markedly inhibited by forskolin. Here, too, the level of EGF-induced MAPK activity after forskolin treatment was unchanged compared with controls, so that the reduction in tail domain phosphorylation could not be attributed to reduced Erk1/2 activation. One hypothesis to explain these data is that phosphorylation of at least one (possibly all three head domain sites) is sufficient to change the conformation of the subunit protein so that tail domain KSP sites are less accessible to proline-directed kinases Erk1/2. Additional experiments are necessary to determine whether phosphorylation at one specific PKA site, or all sites, is essential in this intramolecular modulation.

Sequential phosphorylation of large molecules with many potential sites depends on the action of several different mutually dependent kinases that usually interact synergistically (18). In these instances, phosphorylation of one site by one kinase often activates phosphorylation of another site by an unrelated kinase. Presumably, this results from intramolecular conformational changes that facilitate kinase-substrate interactions. It is not too much of a speculative leap to postulate that a similar mechanism can inhibit phosphorylation in one domain (C-terminal tail?) by prior phosphorylation at specific N-terminal domain sites.

An alternative explanation, and one probably more likely, considering the large size of the NF-M substrate with its rigid coiled-coil rod, is an intermolecular model of inhibition, based on the role of NF-head domains in filament assembly (5, 60). According to models of filament formation, dimers interact longitudinally head to tail to form protofilaments, and subsequently, these lead to staggered interactions to form larger protofibrils (60). This polymerization is inhibited by phosphorylation of the head domain sites by PKA. Hence, according to our model, inhibition of assembly would prevent proline-directed kinase phosphorylation of NF-M and NF-H tail domains. Tail domains are not integral to assembly of the core filament but are collapsed and extend laterally as cross-bridges as they are slowly phosphorylated in the axon. Head domain phosphorylation, by preventing assembly of oligomers, could result in conformational changes of the tail domains such that they are inaccessible to the kinase. The tail domains, in the absence of assembly, may either retain or assume a globular configuration, which prevents association with the kinase.

In a highly asymmetrical cell such as the neuron, where compartments are morphologically quite distinct, topographic regulation of phosphorylation of cytoskeletal proteins is tightly regulated. NF proteins are localized in soma, dendrites, and axons, but their states of assembly and phosphorylation differ and are compartment-specific. We suggest that transient phosphorylation of the head domain by PKA and PKC in the soma prevents assembly and tail domain phosphorylation until NFs enter the axon. If this tight topographic regulation is compromised by a variety of exogenous factors, then abnormal filament assembly and tail domain phosphorylation are induced in cell bodies with severe pathological consequences.


   FOOTNOTES
 
* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

{ddagger} Current address: Center for Dementia Research, Nathan Kline Institute for Psychiatric Research, Orangeburg, NY 10962. Back

§ To whom correspondence should be addressed: Laboratory of Neurochemistry, NINDS, National Institutes of Health, Bldg. 36, Rm. 4D04, 9000 Rockville Pike, Bethesda, MD 20892-4130. Tel.: 301-402-2124; Fax: 301-496-1339; E-mail: panth{at}ninds.nih.gov.

1 The abbreviations used are: NF, neurofilament; NF-H, high molecular weight NF protein subunit; NF-M, middle molecular weight NF protein subunit; NF-L, low molecular weight NF protein subunit; PKA, protein kinase A; PKC, protein kinase C; ALS, amyotrophic lateral sclerosis; EGF, epidermal growth factor; MAPK, mitogen-activated protein kinase; Erk1/2, extracellular signal-regulated kinases 1 and 2; MEK, MAPK/ERK kinase; NGF, nerve growth factor; wt, wild type; mt, mutant; PBS, phosphate-buffered saline; pcDNA, mammalian expression vector. Back


   ACKNOWLEDGMENTS
 
We thank Dr. Philip Grant for his helpful suggestions and critical review of the manuscript.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Shaw, G. (1991) in Neuronal Cytoskeleton (Burgoyne, R. D., ed) pp. 185–214, John Wiley and Sons, Inc, New York
  2. Ching, G. Y., and Liem, R. K. (1993) J. Cell Biol. 122, 1323–1335[Abstract/Free Full Text]
  3. Hisanaga, S., and Hirokawa, N. (1990) J. Mol. Biol. 211, 871–882[CrossRef][Medline] [Order article via Infotrieve]
  4. Lee, M. K., Xu, Z., Wong, P. C., and Cleveland, D. W. (1993) J. Cell Biol. 122, 1337–1350[Abstract/Free Full Text]
  5. Heins, S., Wong, P. C., Muller, S., Goldie, K., Cleveland, D. W., and Aebi, U. (1993) J. Cell Biol. 123, 1517–1533[Abstract/Free Full Text]
  6. Carden, M. J., Trojanowski, J. Q., Schlaepfer, W. W., and Lee, V. M. (1987) J. Neurosci. 7, 3489–3504[Abstract]
  7. Nixon, R. A., and Shea, T. B. (1992) Cell Motil. Cytoskeleton 22, 81–91[CrossRef][Medline] [Order article via Infotrieve]
  8. Grant, P., and Pant, H. C. (2000) J. Neurocytol. 29, 843–872[CrossRef][Medline] [Order article via Infotrieve]
  9. Sihag, R. K., and Nixon, R. A. (1989) J. Biol. Chem. 264, 457–464[Abstract/Free Full Text]
  10. Sihag, R. K., and Nixon, R. A. (1990) J. Biol. Chem. 265, 4166–4171[Abstract/Free Full Text]
  11. Dosemeci, A., and Pant, H. C. (1992) Biochem. J. 282, 477–481
  12. Hisanaga, S., Matsuoka, Y., Nishizawa, K., Saito, T., Inagaki, M., and Hirokawa, N. (1994) Mol. Biol. Cell 5, 705–709
  13. Floyd, C. C., Grant, P., Gallant, P. E., and Pant, H. C. (1991) J. Biol. Chem. 266, 4987–4994[Abstract/Free Full Text]
  14. Guidato, S., Bajaj, N. P., and Miller, C. C. (1996) Neurosci. Lett. 217, 157–160[Medline] [Order article via Infotrieve]
  15. Nixon, R. A., and Sihag, R. K. (1991) Trends Neurosci. 14, 501–506[CrossRef][Medline] [Order article via Infotrieve]
  16. Veeranna, Amin, N. D., Ahn, N. G., Jaffe, H., Winters, C. A., Grant, P., and Pant, H. C. (1998) J. Neurosci. 18, 4008–4021[Abstract/Free Full Text]
  17. Li, B. S., Veeranna, Gu, J., Grant, P., and Pant, H. C. (1999) Eur. J. Biochem. 262, 211–217[Medline] [Order article via Infotrieve]
  18. Roach, P. J. (1991) J. Biol. Chem. 266, 14139–14142[Abstract/Free Full Text]
  19. Sihag, R. K., and Nixon, R. A. (1991) J. Biol. Chem. 266, 18861–18867[Abstract/Free Full Text]
  20. Nakamura Y., Hashimoto, R., Kashiwagi, Y., Aimoto, S., Fukusho, E., Matsumoto, N., Kudo, T., and Takeda, M. (2000) J Neurochem. 74, 949–959[CrossRef][Medline] [Order article via Infotrieve]
  21. Ching, G. Y., and Liem, R. K. (1999) J. Cell Sci. 112, 2233–2240[Abstract]
  22. Lee, V. M., Otvos, L., Jr., Carden, M. J., Hollosi, M., Dietzschold, B., and Lazzarini, R. A. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 1998–2002[Abstract/Free Full Text]
  23. Sternberger, L. A., and Sternberger, N. H. (1983) Proc. Natl. Acad. Sci. U. S. A. 80, 6126–6130[Abstract/Free Full Text]
  24. de Waegh, S. M., Lee, V. M., and Brady, S. T. (1992) Cell 68, 451–463[CrossRef][Medline] [Order article via Infotrieve]
  25. Nakagawa, T., Chen, J., Zhang, Z., Kanai, Y., and Hirokawa, N. (1995) J. Cell Biol. 129, 411–429[Abstract/Free Full Text]
  26. Yin, X., Crawford, T. O., Griffin, J. W., Tu, P., Lee, V. M., Li, C., Roder, J., and Trapp, B. D. (1998) J. Neurosci. 18, 1953–1962[Abstract/Free Full Text]
  27. Rao, M. V., Garcia, M. L., Miyazaki, Y., Gotow, T., Yuan, A., Mattina, S., Ward, C. M., Calcutt, N. A., Uchiyama, Y., Nixon, R. A., and Cleveland, D. W. (2002) J. Cell Biol. 158, 681–693[Abstract/Free Full Text]
  28. Rao, M. V., Houseweart, M. K., Williamson, T. L., Crawford, T. O., Folmer, J., and Cleveland, D. W. (1998) J. Cell Biol. 143, 171–181[Abstract/Free Full Text]
  29. Manetto, V., Sternberger, N. H., Perry, G., Sternberger, L. A., and Gambetti, P. (1988) J. Neuropathol. Exp. Neurol. 47, 642–653[Medline] [Order article via Infotrieve]
  30. Sobue, G., Hashizume, Y., Yasuda, T., Mukai, E., Kumagai, T., Mitsuma, T., and Trojanowski, J. Q. (1990) Acta Neuropathol. (Berl) 79, 402–408[CrossRef][Medline] [Order article via Infotrieve]
  31. Cleveland, D. W., and Rothstein, J. D. (2001) Nat. Rev. Neurosci. 2, 806–819[CrossRef][Medline] [Order article via Infotrieve]
  32. Pant, H. C., and Veeranna (1995) Biochem. Cell Biol. 73, 575–592[Medline] [Order article via Infotrieve]
  33. Philpott, A., Porro, E. B., Kirschner, M. W., and Tsai, L. H. (1997) Genes Dev. 11, 1409–1421[Abstract/Free Full Text]
  34. Patrick, G. N., Zhou, P., Kwon, Y. T., Howley, P. M., and Tsai, L. H. (1998) J. Biol. Chem. 273, 24057–24064[Abstract/Free Full Text]
  35. Zheng, Y. L., Li, B. S., Amin, N. D., Albers, W., and Pant, H. C. (2002) Eur. J. Biochem. 269, 4427–4434[Medline] [Order article via Infotrieve]
  36. Veeranna, Shetty, K. T., Amin, N., Grant, P., Albers, R. W., and Pant, H. C. (1996) Neurochem. Res. 21, 629–636[Medline] [Order article via Infotrieve]
  37. Shetty, K. T., Link, W. T., and Pant, H. C. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 6844–6848[Abstract/Free Full Text]
  38. Stork, P. J., and Schmitt, J. M. (2002) Trends Cell Biol. 12, 258–266[CrossRef][Medline] [Order article via Infotrieve]
  39. Vogt Weisenhorn, D. M., Roback, L. J., Kwon, J. H., and Wainer, B. H. (2001) Exp. Neurol. 169, 44–55[CrossRef][Medline] [Order article via Infotrieve]
  40. Pang, L., Sawada, T., Decker, S. J., and Saltiel, A. R. (1995) J. Biol. Chem. 270, 13585–13588[Abstract/Free Full Text]
  41. Svensson, B., and Ekstrom, P. A. (1998) J. Neurosci. Res. 52, 453–457[CrossRef][Medline] [Order article via Infotrieve]
  42. Klesse, L. J., Meyers, K. A., Marshall, C. J., and Parada, L. F. (1999) Oncogene 18, 2055–2068[CrossRef][Medline] [Order article via Infotrieve]
  43. Sihag, R. K., Jaffe, H., Nixon, R. A., and Rong, X. (1999) J. Neurochem. 72, 491–499[CrossRef][Medline] [Order article via Infotrieve]
  44. Cleverley, K. E., Betts, J. C., Blackstock, W. P., Gallo, J. M., and Anderton, B. H. (1998) Biochemistry 37, 3917–3930[CrossRef][Medline] [Order article via Infotrieve]
  45. Sidovar, M. F., Kozlowski, P., Lee, J. W., Collins, M. A., He, Y., and Graves, L. M. (2000) J. Biol. Chem. 275, 28688–28694[Abstract/Free Full Text]
  46. Wu, J., Dent, P., Jelinek, T., Wolfman, A., Weber, M. J., and Sturgill, T. W. (1993) Science 262, 1065–1069[Abstract/Free Full Text]
  47. Takahashi, M., Amin, N., Grant, P., and Pant, H. C. (1995) J. Neurosci. 15, 6222–6229[Abstract]
  48. Grant, P., Diggins, M., and Pant, H. C. (1999) J. Neurobiol. 40, 89–102[CrossRef][Medline] [Order article via Infotrieve]
  49. Veeranna, Shetty, K. T., Takahashi, M., Grant, P., and Pant, H. C. (2000) Brain Res. Mol. Brain Res. 76, 229–236[Medline] [Order article via Infotrieve]
  50. Yabe, J. T., Chylinski, T., Wang, F. S., Pimenta, A., Kattar, S. D., Linsley, M. D., Chan, W. K., and Shea, T. B. (2001) J. Neurosci. 21, 2195–2205[Abstract/Free Full Text]
  51. Yabe, J. T., Chan, W. K., Chylinski, T. M., Lee, S., Pimenta, A. F., and Shea, T. B. (2001) Cell Motil. Cytoskeleton 48, 61–83[CrossRef][Medline] [Order article via Infotrieve]
  52. Jung, C., Yabe, J. T., Lee, S., and Shea, T. B. (2000) Cell Motil. Cytoskeleton 47, 120–129[CrossRef][Medline] [Order article via Infotrieve]
  53. Jung, C., Yabe, J. T., and Shea, T. B. (2000) Brain Res. 856, 12–19[CrossRef][Medline] [Order article via Infotrieve]
  54. Heins, S., and Aebi, U. (1994) Curr. Opin. Cell Biol. 6, 25–33[CrossRef][Medline] [Order article via Infotrieve]
  55. Liem, R. K., and Hutchison, S. B. (1982) Biochemistry 21, 3221–3226[CrossRef][Medline] [Order article via Infotrieve]
  56. Julien, J. P., and Mushynski, W. E. (1998) Prog. Nucleic Acids Res. Mol. Biol. 61, 1–23[Medline] [Order article via Infotrieve]
  57. Shea, T. B. (2000) J. Neurocytol. 29, 873–887[CrossRef][Medline] [Order article via Infotrieve]
  58. Gibb, B. J., Brion, J. P., Brownlees, J., Anderton, B. H., and Miller, C. C. (1998) J. Neurochem. 70, 492–500[Medline] [Order article via Infotrieve]
  59. Schmitt, J. M., and Stork, P. J. S. (2002) Mol. Cell 9, 85–94[CrossRef][Medline] [Order article via Infotrieve]
  60. Heins, S., and Aebi, U. (1994) Curr. Opin. Cell Biol. 6, 25–a33[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Mol. Biol. CellHome page
S. Kesavapany, V. Patel, Y.-L. Zheng, T. K. Pareek, M. Bjelogrlic, W. Albers, N. Amin, H. Jaffe, J. S. Gutkind, M. J. Strong, et al.
Inhibition of Pin1 Reduces Glutamate-induced Perikaryal Accumulation of Phosphorylated Neurofilament-H in Neurons
Mol. Biol. Cell, September 1, 2007; 18(9): 3645 - 3655.
[Abstract] [Full Text] [PDF]

Home page
 JCBHome page
S. Woll, R. Windoffer, and R. E. Leube
p38 MAPK-dependent shaping of the keratin cytoskeleton in cultured cells
J. Cell Biol., June 21, 2007; 177(5): 795 - 807.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Biol. CellHome page
Y.-L. Zheng, B.-S. Li, J. Kanungo, S. Kesavapany, N. Amin, P. Grant, and H. C. Pant
Cdk5 Modulation of Mitogen-activated Protein Kinase Signaling Regulates Neuronal Survival
Mol. Biol. Cell, February 1, 2007; 18(2): 404 - 413.
[Abstract] [Full Text] [PDF]

Home page
 Biol. Bull.Home page
P. Grant, Y. Zheng, and H. C. Pant
Squid (Loligo pealei) Giant Fiber System: A Model for Studying Neurodegeneration and Dementia?
Biol. Bull., June 1, 2006; 210(3): 318 - 333.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
P.-P. Zhu, C. Soderblom, J.-H. Tao-Cheng, J. Stadler, and C. Blackstone
SPG3A protein atlastin-1 is enriched in growth cones and promotes axon elongation during neuronal development
Hum. Mol. Genet., April 15, 2006; 15(8): 1343 - 1353.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
F. Gros-Louis, R. Lariviere, G. Gowing, S. Laurent, W. Camu, J.-P. Bouchard, V. Meininger, G. A. Rouleau, and J.-P. Julien
A Frameshift Deletion in Peripherin Gene Associated with Amyotrophic Lateral Sclerosis
J. Biol. Chem., October 29, 2004; 279(44): 45951 - 45956.
[Abstract] [Full Text] [PDF]

Home page
 J. Cell Sci.Home page
W. K.-H. Chan, A. Dickerson, D. Ortiz, A. F. Pimenta, C. M. Moran, J. Motil, S. J. Snyder, K. Malik, H. C. Pant, and T. B. Shea
Mitogen-activated protein kinase regulates neurofilament axonal transport
J. Cell Sci., September 15, 2004; 117(20): 4629 - 4642.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
P.-P. Zhu, A. Patterson, B. Lavoie, J. Stadler, M. Shoeb, R. Patel, and C. Blackstone
Cellular Localization, Oligomerization, and Membrane Association of the Hereditary Spastic Paraplegia 3A (SPG3A) Protein Atlastin
J. Biol. Chem., December 5, 2003; 278(49): 49063 - 49071.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/26/24026    most recent
M303079200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zheng, Y.-l.
Right arrow Articles by Pant, H. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zheng, Y.-l.
Right arrow Articles by Pant, H. C.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement