| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 278, Issue 26, 24125-24131, June 27, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
-Like Toxin BmK M1
¶ ||
From the
Center for Molecular Biology, Institute
of Biophysics, Chinese Academy of Sciences, 15 Datun Road, Beijing 100101,
People's Republic of China and the ¶Laboratory of
Toxicology, University of Leuven, E. Van Evenstraat 4, B-3000 Leuven,
Belgium
Received for publication, November 22, 2002 , and in revised form, April 4, 2003.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
-sheet seem to be essential for the structure
and function of the toxin. Trp38 and Tyr42 (located in
the 2-sheet and in the loop between the 2-
and 3-sheets, respectively) are most likely involved in the
pharmacological function of the toxin. |
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
- and
-toxins. Scorpion -toxins, the most extensively studied group,
can prolong the action potential by slowing the inactivation of Na+
currents with no direct effect on activation
(1–3).
According to their different pharmacological properties, the -toxins
can be further divided into three subgroups, classical -, -like,
and insect -toxins (4,
5). The classical
-toxins (e.g. AaH II and Lqh II) are highly toxic to mammals,
whereas the insect -toxins (e.g. Lqh insect toxin) are
highly toxic to insects. The more recently characterized -like toxins
(e.g. Lqh III and BmK M1) act on both mammals and insects, but are
unique in their inability to bind to rat synaptosomes despite a high toxicity
by intravenous injection. Although three-dimensional structures for the
classical -toxins (6,
7), -like toxins
(8,
9), and insect -toxins
(10) have been elucidated,
in-depth structure-function studies of these long chain toxins using
site-directed mutagenesis are still rare, mainly because of folding problems;
and the focus has often been on the charged residues in the toxins
(11,
12). Here, we report the
importance of the conserved aromatic residues in -toxins identified by
mutagenesis analysis using the -like toxin BmK M1 as template.
BmK M1 is a toxin from the venom of the scorpion Buthus martensii Karsch, which resides in eastern Asia, and is composed of 64 amino acids cross-linked by four disulfide bridges (3, 7). BmK M1 has been the subject of different studies: its three-dimensional structure was determined by x-ray crystallography at 1.7-Å resolution (8); the pharmacological properties of Na+ channels have recently been investigated (13); and gene cloning and expression of wild-type BmK M1 have also been carried out (14, 15).
Alignment of the amino acid sequences of several -toxins shows that
seven aromatic residues, including Tyr5, Tyr14,
Tyr21, Tyr35, Tyr42,
Trp38/Tyr38, and Trp47/Tyr47, are
notably conserved (Fig.
1A) (5).
In a previously performed structural analysis, a conserved hydrophobic surface
(CHS)1 was identified
(7). The CHS is assumed to be
part of the functional site of scorpion toxins targeting sodium channels
(16,
17). Tyr5,
Tyr35, and Trp47 are located on the so-called Face A
surface of the toxin (CHS). Tyr14 and Tyr21 are situated
on the surface opposite to Face A, called Face B. Trp38 and
Tyr42 are located in the 2-sheet and in the loop
between the 2- and 3-sheets, respectively
(Fig. 1B).
|
Seven of the 15 residues conserved in scorpion toxins (5) are aromatic residues and have been studied in this work. Based on an efficient yeast expression system (15), the importance of the above-mentioned aromatic residues in the scorpion toxin BmK M1 was analyzed by site-directed mutagenesis. The results from mutagenesis and expression, characterization, bioassays, and electrophysiological analysis of the mutants are reported here. Based on these findings, the important role of these conserved aromatic residues is discussed.
|
EXPERIMENTAL PROCEDURES |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
,
Escherichia coli strain TG1, and Saccharomyces cerevisiae
strain S-78 (Leu2, Ura3, Rep4) were used. Restriction endonucleases and T4 DNA
ligase were obtained from Roche Applied Science (Mannheim Germany). Primers
were synthesized by Sangon (Shanghai, China). Taq DNA polymerase and
Klenow fragment were obtained from MBI. CM32-cellulose cation-exchange and
Sephasil® peptide C18 reversed-phase (12-µm ST4.6/250)
columns were from Whatman and Amersham Biosciences AB (Uppsala, Sweden),
respectively. All other chemicals were at least analytical grade and were
purchased from Merck or Sigma. The mice used for the bioassay were ICR mice
from the Beijing Center for Experimental Animals.
Site-directed Mutagenesis of BmK M1—The cDNA of BmK M1 was
previously cloned (14) and
inserted into pVT102U/
(15). According to the
sequence of pVT102U/-BmK M1, two primers were designed: primer 1
(5'-CGTCTAGATAAAAGAAATTCTGTTCGG-3', including a KEX2 protease
linker and an XbaI restriction site) and primer 2
(5'-CGAAGCTTTTAATGGCATTTTCCTGGTAC-3', with a HindIII
site). The substitute residue for all aromatic residues was glycine. In
addition, the more conservative substitutions of phenylalanine for
Tyr5, Tyr14, Tyr35, and Trp47 were
carried out.
The mutagenic primers used to generate the desired mutations were as follows: Y5G, 5'-CGTCTAGATAAAAGAAATTCTGTTCGGGATGCTGGTATTGCCAAGCCCCATAACTGT; Y5F, 5'-CGTCTAGATAAAAGAAATTCTGTTCGGGATGCTTTCATTGCCAAGCCCCATAACTGT; Y14G, 5'-AACTGTGTAGGTGAATGTGCT (positive strand) and 5'-AGCACATTCACCTACACAGTT (negative strand); Y14F, 5'-AACTGTGTATTCGAATGTGCT (positive strand) and 5'-AGCACATTCGAATACACAGTT (negative strand); Y21G, 5'-AGAAATGAAGGTTGCAACGATTTATGT (positive strand) and 5'-ACATAAATCGTTGCAACCTTCATTTCT (negative strand); Y35G, 5'-AAGAGTGGCGGTTGCCAATGG (positive strand) and 5'-CCATTGGCAACCGCCACTCTT (negative strand); Y35F, 5'-AAGAGTGGCTTCTGCCAATGG (positive strand) and 5'-CCATTGGCAGAAGCCACTCTT (negative strand); W38G, 5'-TATTGCCAAGGTGTAGGTAAA (positive strand) and 5'-TTTACCTACACCTTGGCAATA (negative strand); Y42G, 5'-GTAGGTAAAGGTGGAAATGGC (positive strand) and 5'-GCCATTTCCACCTTTACCTAC (negative strand); W47G, 5'-AATGGCTGCGGTTGCATAGAG (positive strand) and 5'-CTCTATGCAACCGCAGCCATT (negative strand); and W47F, 5'-AATGGCTGCTTCTGCATAGAG (positive strand) and 5'-CTCTATGCAGAAGCAGCCATT (negative strand).
Using pVT102U/-BmK M1 (recombinant BmK (rBmK) M1) as template along
with primer 2 and the mutagenic primer, mutants Y5G and Y5F were created by
one-step PCR. Other mutants (Y14G, Y14F, Y21G, Y35G, Y35F, W38G, Y42G, W47G,
and W47F) were obtained by three-step PCR. A pair of mutagenic primers was
applied in the first or second PCR with primer 1 or 2, respectively, to create
two intermediate products, which shared an identical sequence. After treatment
with Klenow fragment, two intermediate products acted as primers for each
other, and extension of this overlap by DNA polymerase created the full-length
mutant, which had the mutation at the desired position. All PCR products were
purified by gel excision.
Expression and Purification of Mutants—After digestion with
XbaI and HindIII, the mutated cDNA gene was inserted into
plasmid pVT102U/ and transformed into E. coli TG1 competent
cells. The recombinant plasmid pVT102U/-mutant was extracted,
sequenced, and transformed into S. cerevisiae S-78 using the LiCl
method (18). The expression of
the mutants was carried out using a described previously procedure
(15). After fermentation, the
supernatant of the culture was adjusted to pH 4.2 with acetic acid. The sample
was directly applied to a CM32-cellulose cation-exchange column (2.8 x
14 cm), which was equilibrated with 0.1 M sodium acetate at a flow
rate of 1 ml/min. Upon reaching a steady base line, the column was washed by
stepwise elution with 0.2, 0.3, and 0.5 N NaCl equilibration
buffer. The 0.5 N NaCl fraction was directly applied to a
Sephasil® peptide C18 reversed-phase column. Buffer A contained
0.1% trifluoroacetic acid in water; buffer B contained 0.1% trifluoroacetic
acid in acetonitrile. The C18 column was eluted with a linear
gradient of 0–80% buffer B for 15 column volumes. Reversed-phase
chromatography was carried out using an ÄKTA purifier chromatography
system (Amersham Biosciences AB).
Molecular Mass Determination—The molecular masses of the purified mutants were obtained using a Finnigan LCQ ion-trap mass spectrometer (ThermoQuest, San Jose, CA) equipped with an electrospray ionization source. The spray voltage was 4.50 kV. Calculations were performed using the program provided by the manufacturer.
Bioassay—Using 0.9% NaCl as a negative control and rBmK M1 as a positive control, the toxicity of the mutants was determined in mice (male, specified pathogen free level, 18–20 g of body weight). Each group consisted of 10 mice. Various doses of toxin mutants were dissolved in 0.9% NaCl and injected into the mice through the tail vein. Survival times (times between injection and death), reaction, and doses were recorded. Evaluation of toxicity was based on the determination of LD50 (the dose capable of statistically killing 50% of the mice) according to the method of Meier and Theakston (19).
Expression in Xenopus Oocytes, Electrophysiological Recordings, and Analysis—The human Nav1.5 gene was subcloned into pSP64T (20). For in vitro transcription, pSP64T/Nav1.5 was first linearized by XbaI. Using the large-scale SP6 mMESSAGE mMACHINE transcription kit (Ambion Inc.), capped cRNAs were synthesized from the linearized plasmids. The in vitro synthesis of cRNA encoding histone H1 and the isolation of Xenopus oocytes were done as described previously (21). Oocytes were injected with 50 nl of Nav1.5 cRNA solution at a concentration of 1 ng/nl using a Drummond microinjector.
Whole cell currents from oocytes were recorded using the
two-micro-electrode voltage clamp technique between 1 and 3 days after
injection. Voltage and current electrodes were filled with 3 M KCl.
Resistances of both electrodes were kept as low as possible
(
0.1–0.2 megaohms). Experiments were performed using a GeneClamp
500 amplifier (Axon Instruments, Inc.) controlled by a pClamp data acquisition
system (Axon Instruments, Inc.). Currents were sampled at 10 kHz and filtered
at 5 kHz using a four-pole low-pass Bessel filter. Digital leak subtraction of
the current records was carried out using a P/2 protocol. The bath solution
composition was 96 mmol/liter NaCl, 2 mmol/liter KCl, 1.8 mmol/liter
CaCl2, 2 mmol/liter MgCl2, and 5 mmol/liter HEPES (pH
7.4). This solution was supplemented with 50 mg/liter gentamycin sulfate for
incubation of the oocytes. All experiments were performed at room temperature
(20–22 °C).
Circular Dichroism Measurements—Samples used for analyses were dissolved in 20 mM phosphate buffer (pH 7) at a concentration of 1.0 mg/ml. Circular dichroism spectra were recorded on a Jasco J-720 spectropolarimeter. Spectra were run at 25 °C from 250 to 200 nm using a quartz cell 0.5 mm in length. Data were collected at 0.5-nm intervals with a scan rate of 50 nm/min. All CD spectra resulted from averaging four scans. The final spectrum was corrected by subtracting the corresponding base-line spectrum obtained under identical conditions. Spectra were smoothed by the instrument's software. The secondary structure content was estimated by standard Jasco CD analysis.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
vector. Tricine/SDS-PAGE analyses
of yeast cultures demonstrated that mutants Y5G, Y5F, Y14G, Y14F, Y21G, Y35G,
Y35F, W38G, Y42G, and W47F were expressed and secreted into the medium. Mutant
Y5G could not be used in the following characterization because its expression
level was in a trace amount. Mutant W47G could not be expressed at all. The
expression levels of the five glycine mutants Y14G, Y21G, Y35G, W38G, and Y42G
were 1–2 mg/liter of culture medium. For three of the mutants with
the conservative phenylalanine substitution (Y5F, Y14F, and Y35F), the
expression levels were 3 mg/liter, comparable to that of unmodified rBmK
M1 (3 mg/liter). Remarkably, the amount of W47F in the culture medium was
9–10 mg/liter, which is about three times the value of rBmK M1
(Table I). Apparently, the
conservative phenylalanine mutations of Tyr5 and Trp47
changed the expression levels of mutants Y5G and W47G from a trace or nothing
at all to the normal level or to even a high level.
|
Expressed mutants were purified by a simple and efficient protocol. One liter of culture (10 g/liter yeast extract, 20 g/liter bacteriological peptone, 20 g/liter glucose, pH after sterilization of 6.5) was harvested and initially purified by chromatography on a CM32 cation-exchange column. The next step of purification was carried out on a C18 column. The elution peaks corresponding to target mutants were pooled and lyophilized. The Tricine/SDS-polyacrylamide gels and the mass spectra showed a high purity of the final products. As an example, the entire purification process of Y42G is shown at the following stages: Tricine/SDS-PAGE before and after purification (Fig. 2A), reversed-phase chromatography (Fig. 2B), mass spectrometry (Fig. 2C).
|
Molecular Mass—The molecular masses of the purified variants were measured with the Finnigan LCQ ion-trap mass spectrometer. The individual peaks showed that the molecular masses of mutants Y5F, Y14G, Y14F, Y21G, Y35G, Y35F, W38G, Y42G, and W47F were 7403, 7312, 7403, 7315, 7312, 7403, 7289, 7312, and 7380 Da, respectively (Y42G is shown as an example in Fig. 2C). This corresponded well with the estimated molecular masses of the mutants: 7404, 7313, 7404, 7313, 7313, 7404, 7290, 7313, and 7380 Da, respectively.
Conformational Analysis—The CD spectra of rBmK M1 and its
mutants in the UV range of 250–200 nm are shown in
Fig. 3. Compared with native
BmK M1, the CD spectra of Y14G and Y35G dramatically changed
(Fig. 3A), indicating
that there are apparent changes in the secondary structures of these two
mutants. The secondary structure estimation (J-700 for Windows Secondary
Structure Estimation, Version 1.10.00) indicates that mutation Y14G interrupts
both the -helix and -sheet, whereas mutation Y35G interrupts only
the -sheet. In both cases, the estimated random coils show a significant
increase.
|
For Y21G, W38G, and Y42G, the CD spectra show that the secondary structures have almost not changed compared with the native toxin (Fig. 3A). It seems that the loss of the aromatic side chains in these mutants does not alter the general structure of the toxin. Regarding mutants with the conservative phenylalanine substitution, the CD spectra show small alterations for Y5F, Y14F, and Y35F, but large changes for W47F compared with wild-type BmK M1 (Fig. 3B).
Bioassay—The mice showed typical symptoms of envenomation
after injection with rBmK M1. The LD50 determined by the method of
Meier and Theakston (19) was
0.53 mg/kg, which is consistent with that of native BmK M1
(16). Excluding W47G and Y5G,
which were not expressed and expressed only in trace amounts, respectively,
the other nine mutants (Y5F, Y14G, Y14F, Y21G, Y35G, Y35F, W38G, Y42G, and
W47F) were used for bioassays. Each purified mutant was injected into the mice
through the tail vein at different doses to determine the LD50
value (Fig. 4 and
Table I).
|
Mutants Y14G, W38G, and Y42G showed no detectable toxicity even at a dose of 25 mg/kg, which is 47 times the LD50 of rBmK M1 (Table I). Mutant Y35G lost most of its toxicity (LD50 = 16.04 mg/kg, which is 30 times the LD50 of rBmK M1). In contrast, the LD50 of Y21G was only twice that of rBmK M1 (Fig. 4 and Table I).
For the phenylalanine mutants, the toxicities of Y14F (71%) and Y35F (55%) were in the same order as that of unmodified rBmK M1. The toxicity of W47F displayed a certain decrease (23%). The toxicity of Y5F was dramatically reduced to 4% in comparison with unmodified rBmK M1 (Fig. 4 and Table I).
Effect of rBmK M1 and Its Aromatic Amino Acid Mutants on Voltage-gated
Na+
Channels—Fig. 5
displays the effects of rBmK M1 and mutants Y14G, Y35G, W38G, Y42G, Y21G,
Y14F, Y35F, Y5F, and W47F on Nav1.5 Na+ channels
expressed in Xenopus laevis oocytes. The currents displayed were
evoked by a depolarization step to –20 mV from a holding potential of
–90 mV. The current traces recorded after the addition of the toxin
reveal that rBmK M1 induced a slowing of the inactivation process of
Na+ currents. This effect appeared a few seconds after the addition
of the toxin and continued until reaching a steady state after 4–5 min.
Under control conditions, the inactivation kinetics of Nav1.5
currents were rapid, and almost no remaining currents were visible at the end
of the traces, after 25 ms. The toxin-induced slowing of inactivation was
evaluated by a single exponential fit (pClamp Version 8) of the current decay
after the peak. The time window for each fit was manually set from the peak
current to the end of the trace (25 ms). Under steady-state conditions, the
time constant of inactivation (
) calculated by a single exponential fit
increased from 1.4 ± 0.2 ms (n = 33) under control conditions
to 4.4 ± 1.2 ms (n = 6) after the addition of 1
µM rBmK M1 and to 5.8 ± 0.8 ms (n = 3) after the
addition of 5 µM rBmK M1. This represents an increase of
414% in the time constant in the presence of 5 µM
rBmK M1. As shown in Fig. 5,
all of the glycine mutants except Y21G were less efficient even at high
concentrations (30 and 50 µM) in slowing the inactivation
kinetics of Nav1.5 channels compared with the wild-type toxin.
Mutants Y14G and Y42G of rBmK M1 were the least effective in slowing the
inactivation of the channel. The time constants of inactivation were 2.1
± 0.3 ms (n = 3) and 1.7 ± 0.3 ms (n = 4)
after the addition of 30 µM Y14G and 50 µM Y42G,
respectively, corresponding to 150 and 121% of the time constants under
control conditions, respectively. The addition of 30 µM W38G
increased the time constant of inactivation to 2.6 ± 0.4 ms (n
= 3), corresponding to 186% of the control value. Y35G was the second most
effective mutant, increasing the value to 4.2 ± 1.3 ms
(n = 3) at a concentration of 30 µM, corresponding to
300% of the control value. Y21G was the most effective mutant, increasing the
value to 4.7 ± 0.4 ms (n = 3) at a concentration of 5
µM, corresponding to 335% of the control value.
|
As shown in Fig. 5, all of the phenylalanine mutants except Y5F had about the same efficacy in Nav1.5 as rBmK M1. The time constants of inactivation were 5.4 ± 0.6 ms (n = 4), 7.1 ± 0.4 ms (n = 4), and 5.8 ± 0.6 ms (n = 3) after the addition of 10 µM W47F, 7.5 µM Y35F, and 10 µM Y14F, respectively, corresponding to 385, 507, and 414% of the time constants under control conditions, respectively. Y5F was the least effective in slowing the inactivation of the Na+ channel. The time constant of inactivation was only 2.3 ± 0.6 ms (n = 3) after the addition of 100 µM, corresponding to 165% of the control value. The effects of rBmK M1 and some of its mutants on the peak Na+ current and time to peak were somewhat variable (oocyte-dependent) and not further analyzed.
The slowing of inactivation induced by rBmK M1 and its mutants was
concentration-dependent (Fig.
6). The EC50 values of rBmK M1, Y21G, Y35G, Y35F, Y14F,
and W47F were determined by a sigmoidal fit of the -V
relationship as displayed in Fig.
6. The EC50 values determined for rBmK M1, Y21G, Y35G,
Y35F, Y14F, and W47F were 0.50 ± 0.03, 1.02 ± 0.15, 5.05
± 0.36, 0.71 ± 0.09, 3.36 ± 0.48, and 3.1 ± 0.3
µM, respectively. The EC50 value determined in this
study for rBmK M1 is slightly higher than the EC50 value determined
for the native BmK M1 toxin (0.2 µM) in one of our previous
studies (13). Y21G was
comparable to native rBmK M1. Y35G was 30% less efficient in slowing the
inactivation kinetics of Nav1.5 channels compared with wild-type
rBmK M1. The EC50 value of Y35G was at least 10 times higher than
that of rBmK M1. The EC50 values of the phenylalanine mutants were
comparable to that of rBmK M1, except Y5F. As shown in
Fig. 6, the EC50
values of Y14G, Y42G, W38G, and Y5F could not be determined because the
highest concentrations used did not reach a maximal effect in the
dose-response curve.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
20 years ago, the CHS, mainly including
Tyr5, Tyr35, and Trp47/Tyr47, was
proposed to be responsible for the pharmacological effect of these toxins
(17,
22,
23). Although the CHS is found
in all scorpion toxin structures known today, this assumption required
experimental identification. The individual residues in this cluster
(e.g. Trp45 in AaH II and Tyr49 in Lqh
insect toxin) have been assessed by chemical modification
(24) and mutagenesis analysis
(11,
25) and shown to play an
important role in bioactivity. In this study, seven aromatic residues,
including three amino acids of this cluster, were analyzed by site-directed
mutagenesis. Correlating the high impact substitution of glycine to the more
conservative mutation of phenylalanine, our results clearly indicate that
these conserved aromatic residues are specifically involved in either or both
pharmacological function and structural stability. Aromatic Residues Possibly Involved in Pharmacological Function—The bioassay showed that the toxicity of W38G and Y42G was dramatically reduced (Table I). In concordance, electrophysiological analysis showed that W38G and Y42G were the least effective in slowing the inactivation of the sodium channel. The EC50 could not be determined because the highest concentration available could not induce a maximal effect in the dose-response curves (Figs. 5 and 6). Simultaneously, the CD spectra of these two mutants show the least alteration in comparison with that of unmodified BmK M1 (Fig. 3A). These results can be used to speculate that the conserved aromatic residues Trp38 and Tyr42 are involved in the functional performance of the toxin.
Tyr42 is located in the loop between the 2- and
3-sheets (Fig.
7). Considering that this loop is remarkably different in sequence
and structure between - and -toxins
(7,
17), this aromatic residue may
be related to the preference for the distinct target site of
-toxins.
|
Aromatic Residues Possibly Involved in Structural
Stability—The non-expression of W47G and the extremely unstable
expression of Y5G indicate that these two residues are essential for the
general structure of the toxin. The polypeptide chain of the toxin cannot be
folded correctly without these aromatic side chains. Y35G could be expressed
in an amount comparable to the wild type, but its toxicity was reduced
dramatically (Table I). In
agreement with the obtained LD50 value in mice, the corresponding
EC50 value of Y35G in Nav1.5 was 10 times higher than
that of rBmK M1. The CD spectrum also changed dramatically
(Fig. 3A), indicating
an alteration of the secondary structure of Y35G. Interestingly, the
conservative phenylalanine substitution mutants were expressed very well. Y5F
and Y35F were present in the culture medium in an amount of 3 mg/liter,
comparable to rBmK M1. The expression level of W47F was high (9–10
mg/liter) in comparison with rBmK M1 (Table
I). Compared with rBmK M1, alterations in the CD spectra were
milder for Y5F and Y35F, but severe for W47F
(Fig. 3B). In
addition, the bioassay, in concordance with the electrophysiological
characterization, showed that the bioactivities of all of the phenylalanine
mutants (although in different degrees) were significantly higher than those
of the mutants that lost their aromatic side chains by substitution with
glycine (Table I). Hence, by
constructing and thoroughly comparing glycine and phenylalanine mutants of
conserved aromatic residues in BmK M1, we have shown that the aromatic side
chains of W47F and Y35F are indispensable for maintaining the structure and
pharmacological function of the toxin. Interestingly, these residues do not
have to be Trp47 or Tyr35 because the aromatic side
chain is the primordial component. Also indicated by this study is the fact
that residue 5 has to be a tyrosine because the phenylalanine mutant displayed
a very low bioactivity.
The three-dimensional structures of BmK M1 and other -toxins reveal
that Tyr5, Tyr35, and Trp47 are located on
the three-stranded -sheet: 1-, 2-, and
3-strands, respectively. The aromatic rings of these residues
are positioned orthogonally one to the other in a so-called
"herringbone" arrangement (Fig.
7), which was identified as the lowest energy configuration of
relatively solvent-exposed aromatic rings
(26). In this way, this
aromatic cluster plays an important role in the stabilization of the
three-stranded -sheet. It is plausible to infer that, due to the loss of
the interactions between these aromatic rings, the -sheet will be
interrupted and maybe even disintegrated. Trp47 is situated at the
center of the cluster (Fig. 7),
and its aromatic ring resides in the vicinity of the side chains of both
Tyr5 and Tyr35 (distances of 3.5–4 Å). It
can be hypothesized that the disruption of the herringbone arrangement due to
the loss of the aromatic side chains in W47G and Y5G makes the mutants unable
to express. This conclusion is supported by the fact that all of the
phenylalanine mutants were very well expressed. W47F, Y35F, and Y14F also
displayed the essential bioactivity (Table
I). Instead of the non-expression for W47G, mutant W47F was
expressed at a high level with a relative toxicity of 23%. However, the CD
spectrum reveals a severe conformational change
(Fig. 3B). In short,
the glycine and phenylalanine mutants clearly indicate that, with the
exception of Tyr5, the presence of the aromatic side chain is
sufficient and important for the unique structure and the pharmacological
function. Tyr5 seems to be a unique and irreplaceable amino acid.
The CD spectrum shows a milder alteration for this mutant. Inspecting the
three-dimensional structure, there is a contact through a hydrogen bond
between the functional -OH group of Tyr5 and the side chain of
Lys58/Arg58, which can be found in all long chain
scorpion toxins (6,
8). By consequence, an aromatic
ring without that -OH group cannot maintain the general structure as shown by
the CD spectrum and can interrupt the subtle tertiary arrangement between the
N-terminal part and the C-terminal segment, which in turn affects the
pharmacological function. Therefore, the importance of Tyr5 is not
only in the aromatic ring, but also in the functional -OH group; and as a
consequence, Tyr5 is highly conserved among -toxins.
Aromatic Residues in Other Sites—Tyr14 and
Tyr21 are located on Face B
(Fig. 1B), which is
roughly opposite to Face A, where the CHS is situated. Y14G was almost
nontoxic compared with rBmK M1 (Table
I). In agreement, its effect on voltage-gated sodium channels was
also the least (Figs. 5 and
6). The CD spectrum was
seriously altered compared with that of unmodified BmK M1
(Fig. 3A), indicating
a conformational change due to the loss of the aromatic side chain in this
position. The results show that Tyr14 is essential for stabilizing
the unique conformation of the toxin and is involved in the interaction with
the voltage-gated sodium channel. To obtain a more thorough insight in this
matter, a more conservative phenylalanine substitution for Tyr14
was constructed. Y14F was expressed in an amount comparable to that of Y14G.
However, in contrast to Y14G (no detectable toxicity and EC50 >
100 µM), Y14F possesses a high bioactivity (71% relative
toxicity and EC50 = 3.36 ± 0.48 µM)
(Table I). These data reveal
that it is the aromatic side chain of Tyr14 that mainly contributes
to the proper conformation and in turn affects the pharmacological function of
the toxin. This residue protrudes from the loop between the
1-sheet and the -helix
(Fig. 7). The structure shows
that its aromatic ring interacts with the side chain of Ile6, which
is also a crucial conserved residue in -toxins. The hydrophobic
interactions between these two residues on the surface may play an important
role in stabilizing the unique conformation of this loop so as to influence
the -sheet and the -helix of the toxin. The effect of mutation
Y21G was milder on bioactivity, on the EC50 in Nav1.5,
and on the CD spectrum (Fig.
3A and Table
I), indicating that the aromatic residue Tyr21 is
putatively not a crucial determinant for the structure and pharmacological
function of the toxin.
|
FOOTNOTES |
|---|
Both authors contributed equally to this work.
|| To whom correspondence should be addressed. Tel.: 86-10-6488-8547; Fax: 86-10-6488-8560; E-mail: dcwang{at}sun5.ibp.ac.cn.
1 The abbreviations used are: CHS, conserved hydrophobic surface; rBmK,
recombinant BmK; Tricine,
N-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycine; AaH,
Androctonus australis Hector; Lqh, Leiurus quinquestriatus
hebraeus.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  P. J. West, G. Bulaj, and D. Yoshikami Effects of {delta}-Conotoxins PVIA and SVIE on Sodium Channels in the Amphibian Sympathetic Nervous System J Neurophysiol, December 1, 2005; 94(6): 3916 - 3924. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Xiao, J. Tang, Y. Yang, M. Wang, W. Hu, J. Xie, X. Zeng, and S. Liang Jingzhaotoxin-III, a Novel Spider Toxin Inhibiting Activation of Voltage-gated Sodium Channel in Rat Cardiac Myocytes J. Biol. Chem., June 18, 2004; 279(25): 26220 - 26226. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. M. Wang, S. H. Roh, S. Kim, C. W. Lee, J. I. Kim, and K. J. Swartz Molecular Surface of Tarantula Toxins Interacting with Voltage Sensors in Kv Channels J. Gen. Physiol., March 29, 2004; 123(4): 455 - 467. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Leipold, S. Lu, D. Gordon, A. Hansel, and S. H. Heinemann Combinatorial Interaction of Scorpion Toxins Lqh-2, Lqh-3, and Lqh{alpha}IT with Sodium Channel Receptor Sites-3 Mol. Pharmacol., March 1, 2004; 65(3): 685 - 691. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
