JBC Avanti Polar Lipids

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M300699200 on May 7, 2003

J. Biol. Chem., Vol. 278, Issue 28, 25408-25416, July 11, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/28/25408    most recent
M300699200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fitch, M. J.
Right arrow Articles by Tye, B. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fitch, M. J.
Right arrow Articles by Tye, B. K.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Mcm7, a Subunit of the Presumptive MCM Helicase, Modulates Its Own Expression in Conjunction with Mcm1*

Michael J. Fitch {ddagger} §, Justin J. Donato §  and Bik K. Tye ||

From the Department of Molecular Biology and Genetics, Cornell University, Ithaca, New York 14853-2703

Received for publication, January 21, 2003 , and in revised form, April 30, 2003.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The Saccharomyces cerevisiae Mcm7 protein is a subunit of the presumed heteromeric MCM helicase that melts origin DNA and unwinds replication forks. Previous work showed that Mcm1 binds constitutively to the MCM7 promoter and regulates MCM7 expression. Here, we identify Mcm7 as a novel cofactor of Mcm1 in the regulation of MCM7 expression. Transcription of MCM7 is increased in the mcm7-1 mutant and decreased in the mcm1-1 mutant, suggesting that Mcm7 modulates its own expression in conjunction with Mcm1. Indeed, Mcm7 stimulates Mcm1 binding to the early cell cycle box upstream of the promoters of MCM7 as well as CDC6 and MCM5. Whereas Mcm1 binds these promoters constitutively, Mcm7 is recruited during late M phase, consistent with Mcm7 playing a direct role in modulating the periodic expression of early cell cycle genes. The multiple roles of Mcm7 in replication initiation, replication elongation, and autoregulation parallel those of the oncoprotein, the large T-antigen of the SV40 virus.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The MCM genes, including MCM1 and the family of related genes, MCM2, MCM3, MCM4, MCM5, MCM6, and MCM7, were originally identified as genes essential for minichromosome maintenance (1, 2). However, although all mcm mutants show defects in DNA replication, the molecular basis for their replication defects may be different. Mcm1 (3) belongs to a family of combinatorial transcription factors known as the MADS box proteins found in all eukaryotes (4, 5). These proteins regulate the expression of diverse genes by cooperative interaction with multiple cofactors. In multicellular eukaryotes, MADS box proteins such as Agamous, Deficiens, and SRF (69) are homeotic proteins that play an important role in coordinating gene expression and cell proliferation during development (1012). In the budding yeast, Mcm1 appears to play an important role in coordinating gene expression during cell cycle progression (13) and in cell type determination (14, 15). Mcm1 has been shown to regulate cell cycle-specific genes such as CLB1, CLB2, and SWI5 in association with SFF/Fkh2 (16, 17). It also regulates the M/G1-specific transcription of early cell cycle genes including CLN3, SWI4, and the DNA replication genes, CDC6 and MCM7 (18), in association with Yox1 and Yhp1 (19). A survey of transcription factors involved in cell cycle-regulated gene expression placed Mcm1 at the top of a serial regulatory scheme (20). Mcm1 also plays a direct role in DNA replication by binding to replication origins (21). A recent study showed that Mcm1 binds multiple sites flanking the minimal functional domains of replication origins in vitro. The association of Mcm1 with replication origins was also demonstrated in vivo by chromatin immunoprecipitation experiments. Thus, Mcm1 may regulate the process of DNA replication as well as the expression of DNA replication genes.

Like Mcm1, the MCM2–7 family of proteins is evolutionarily conserved from yeast to human (2). Several studies suggest that these six proteins form the precursor complex of the hexameric helicase (2224), which plays an essential role in the early steps of replication initiation (2527). The Mcm2–Mcm7 proteins are assembled as components of the pre-replication chromatin during early G1 phase. In coordination with this cell cycle-regulated program, all six MCM genes are expressed in a cell cycle-specific manner, with their transcript levels reaching a peak at M/G1 or G1 phase (13, 2830). However, the notion that the periodic synthesis of these proteins might limit DNA replication to once per cell cycle conflicts with their extreme abundance and constitutive presence in proliferating cells (3134). A possible explanation for these contradictory properties is that the MCM2–7 proteins may perform other functions that involve separate pools of these proteins (2). This hypothesis is consistent with the observation that individual members of the MCM2–7 family may undergo various forms of post-translational modifications including phosphorylation (33, 35), polyubiquitination (36), and acetylation (37). Moreover, genome wide location studies indicate that individual members of the MCM2–7 family are localized not only at replication origins but also at nonorigin regions and that these proteins may not act in unity (38).

The possibility that Mcm1 may play an indirect role in DNA replication by regulating the expression of DNA replication genes has been investigated (18, 29, 39). In this study, we confirm that Mcm1 is involved in the transcriptional regulation of MCM7. However, we found that a cofactor of Mcm1 in this regulation is Mcm7, suggesting that Mcm7 may play a dual role in DNA replication by acting as part of the MCM helicase as well as temporally regulating its own expression.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Plasmids and Strains—Plasmids used are: YCp101A (ARS1 CEN5 ADE3), YCp101 (ARS1 CEN5), YCp120 (ARS120 CEN5), and YCp121 (ARS121 CEN5); pSH18–34 (lexAop-lacZ). pYES.Mcm1-His6 was constructed by inserting the MCM1 ORF1 into the pYES2.1 TOPO vector (Invitrogen) to create a galactose-inducible His6 C-terminal tagged Mcm1 fusion. pMCM1-GST was constructed as follows. The vector pGEX-2T (Amersham Biosciences) was first modified by filling in the ends of the BamHI-cut vector and adding a NdeI 8-mer linker to generate pGEX-2TN. The MCM1 gene was constructed with a NdeI site at the ATG start codon using site-directed mutagenesis. The construct was inserted as a NdeI-ClaI fragment into the pGEX-2TN plasmid at NdeI and SmaI. pMCM7-GST was constructed by cloning the MCM7 ORF in frame to GST within pGEX-2T.

Yeast strains used are: YC1-1 ({alpha} mcm1-1 ade2 ade3 leu2 ura3 his4), DBY2029 ({alpha} ade2-1 lys2-801 leu2-3, 112, ura3-52 mcm7-1), DBY2055 (a ura3-52 his4-619), BY4743 (a{alpha} his3/his3 ura3/ura3 leu2/leu2), K7428 (a ura3 {Delta}cdc20::LEU2 his3 GAL-CDC20::TRP1), mutant 23342 (BY4743 MCM7/mcm7::Kan) (Research Genetics), and EGY40 (a ura3 trp1 leu2 his3).

RNA Methods—RNA was purified using the yeast heat-freeze protocol (40). 10 µg of total RNA was used for Northern blots (41). Radioactive probes were produced using the STRIP-EZTM kit (Ambion, Austin, TX). Quantitation of radioactive signals was performed on a Molecular Dynamics Storm 840 PhosphorImager, and quantitative analysis was performed using ImageQuant software.

Protein Purification—Mcm1-His6 was purified from 500 ml of yeast culture induced for 5 h with 2% galactose. After 5 h of induction, cells were pelleted and Mcm1-His6 was purified using the Y-PER His6 purification kit according to the protocol from the manufacturer (Pierce). Peak fractions of Mcm1-His6 were pooled and dialyzed against 2 liters of minimal Mcm1 band shift buffer (20 mM HEPES-KOH, pH 7.5, 1 mM dithiothreitol, 10% glycerol, 60 mM NaCl, 7 mM MgCl2, 1 mM EDTA).

GST fusion proteins were expressed in Escherichia coli strain BL21(DE3) pLysS (F' ampT hsdSB (r8, M8) dcm gal (DE3) plysS CmR) using pMCM1-GST or pMCM7-GST. Isopropyl-1-thio-{beta}-D-galactopyranoside-induced cells were pelleted and re-suspended in ice-cold phosphate-buffered saline containing 1 mM phenylmethylsulfonyl fluoride. Cells were lysed by sonication using the Branson 250 sonicator. Clarified extracts were incubated with glutathione-S-Sepharose for 2–3 h at 4 °C, and the mixture was poured in disposable columns. Columns were washed three times with 10 bed volumes of phosphate-buffered saline before elution with reduced glutathione at a concentration of 2 mM. Eluted samples were pooled and dialyzed overnight against buffer 1 (20 mM HEPES, pH 7.5, 1 mM CaCl2, 1 mM dithiothreitol, 50 µM zinc acetate, 10% glycerol, 60 mM NaCl, 7 mM MgCl2, 1 mM EDTA). Concentrations of purified proteins are calibrated against known amounts of BSA in Coomassie-stained polyacrylamide gels.

Band Shift Reactions—Purified proteins were mixed with radioactively labeled DNA in buffer 1 (20 mM HEPES, pH 7.5, 1 mM CaCl2, 1 mM dithiothreitol, 50 µM zinc acetate, 10% glycerol, 60 mM NaCl, 0.1 mg/ml BSA, 7 mM MgCl2, 1 mM EDTA) in 15–30-µl volumes. 500 ng of poly(dI-dC) was added to each reaction. The binding reactions were incubated at room temperature for 20 min before electrophoresis in 5–6% 1x TBE, 5% glycerol polyacrylamide gels. Gels were dried onto 3-mm paper and either exposed to film or exposed to a PhosphorImager screen.

DNase I Footprinting—DNase 1 footprinting was performed as described for the band shift reactions. Purified proteins and DNA were mixed in buffer 1 in a 0.2-ml volume for 20 min. A pre-calibrated amount of DNase I (Sigma) was added in a volume of 0.01 ml for 1 min at room temperature. The reaction was stopped by precipitation in a mixture of ethanol, 0.3 M sodium acetate, and 1 µg of linear acrylamide. Precipitate was washed with 70% ethanol, dried, and re-suspended in formamide buffer before loading onto a 6 M urea, 6% polyacrylamide sequencing gel.

Formaldehyde Cross-linking Immunoprecipitation—Formaldehyde cross-linking was performed as described by Hecht et al. (42) with minor modifications. Strains were grown in complete medium in 10 mM phosphate buffer at pH 7.5, to A600 of 0.6–1.0. Between 15 and 50 ml of cells were cross-linked and then immunoprecipitated with 1.0–2.5 µl of specific antibodies overnight at 4 °C on a shaker. All washing steps were performed in Bio-Rad microspin columns. The collected immune complexes were washed two times in lysis buffer (50 mM HEPES/KOH, pH 7.5, 140 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% sodium deoxycholate), two times in lysis buffer with 0.5 M NaCl, two times in the final wash buffer (10 mM Tris-HCl, pH 8.0, 0.25 M LiCl, 0.75% Nonidet P-40, 0.5% sodium deoxycholate, 1 mM EDTA), and two times in TE (10 mM Tris-HCl, pH 8.0, 1 mM EDTA). Protein-DNA cross-links were reversed overnight at 65 °C. DNA samples were purified by the addition of five volumes of PB buffer and then passed through Qiagen PCR purification columns (Qiagen, Valencia, CA). Purified DNA was eluted with 40 µl of TE.

PCR Amplification—PCR was carried out using the following conditions: 2 times (94 °C for 2.0 min, 96 °C for 1.0 min, 54 °C for 4.0 min), 24 times (94 °C for 1.0 min, 54 °C for 1.5 min), and 1 time (70 °C for 5.0 min). 5 µCi of [{alpha}-32P]dATP was added to each PCR set up as a multiplex reaction. Each PCR contains the ATP11 primers (negative control) in addition to primer pairs for the MCM7, MCM5, CDC6 promoters or ARS305, respectively. The primer pair for ATP11 is directed at the coding region of the gene. The sizes of the PCR products for MCM7, MCM5, CDC6, ARS305, and ATP11 are 387, 226, 261, 280, and 412 bp, respectively. Quantitation of radioactive signals was performed on a Molecular Dynamics Storm 840 PhosphorImager, and quantitative analysis was performed using ImageQuant software. Unlike real-time PCR, time points with high signals may be underrepresented in magnitude because these values may have been generated beyond the exponential phase of the PCR reaction.

Other Methods—Plasmid stability assay is described by Lei et al. (32). Flow cytometric analysis was performed as described elsewhere (43). {beta}-Galactosidase assays were performed as described elsewhere (44).


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Dosage Suppression of mcm1-1 by MCM7 and mcm7-1 by MCM1—To investigate the molecular basis of the minichromosome maintenance defect of the transcriptional activator Mcm1, we searched for dosage suppressors that alleviate the Mcm defect of mcm1-1. MCM7 was identified as a dosage suppressor that stabilized minichromosomes in the mcm1-1 strain.2 A tester plasmid YCp101A containing ARS1 is unstable in the mcm1-1 mutant (Fig. 1A). This minichromosome loss defect is complemented by MCM1 and partially suppressed by MCM7 carried on a high copy plasmid. Moreover, MCM1 on a high copy plasmid also partially suppresses the temperature-sensitive growth defect of mcm7-1 (Fig. 1B), which arrests growth at 37 °C in late S phase with almost two genome equivalents of DNA (data not shown). This partial suppression of mcm1-1 by MCM7 and mcm7-1 by MCM1 is not gene-specific. Previous work has shown that overexpression of CDC6 suppresses a mcm1 mutation (29). A high copy plasmid containing MCM1 also partially suppresses the temperature-sensitive defects of other mcm mutants such as mcm2-1 and mcm3-10, indicating that MCM1 dosage suppression is not specific to mcm7-1. There are two likely explanations for the partial dosage suppression of mutant phenotypes of mcm1-1 by MCM7 and mcm7-1 by MCM1 that may also explain the relationships between Mcm1 and other replication genes. First, Mcm1 regulates the expression of MCM7. Increasing the dosage of the regulator or the regulated product would increase the level of Mcm7. Second, dosage suppression may result from the stabilization of a complex formed between Mcm1 and Mcm7 by increased concentration of one of the interacting partners. An example is the suppression of the mating defects of mat{alpha}1 and mat{alpha}2 mutants by overexpression of Mcm1 (15).



View larger version (29K):
[in this window]
[in a new window]
 
FIG. 1.
A, suppression of the minichromosome maintenance defect of mcm1-1 by MCM7. Loss rate of YCp101A was measured in the mcm1-1 mutant YC1-1 carrying the vector (YEp24), vector containing MCM1 (YEpMCM1), or MCM7 (YEpMCM7). Standard deviation is less than 10%. B, MCM1 in multiple copies suppresses the heat-sensitive growth defect of the mcm7-1 mutant (DBY2029). C, Northern blot analysis. a, the ratios of the transcript levels of MCM7:PDA1 are compared in the congenic wild type and mutant mcm1-1 strain. b, the ratios of the transcript levels of MCM7:ATS1 in the wild type and mcm7-1 strain at 30 °C and 37 °C (2 h) are compared. PDA1 and ATS1 transcripts are used as loading controls because expression of these transcripts is not affected by mcm1-1 or mcm7-1 in genome-wide expression analyses (M. J. Fitch and B. K. Tye, unpublished results). D, viability of single and double mutants of mcm1-1 and mcm7-1. Early log phase cells from spores of a tetrad sporulated from a diploid (MCM1/mcm1-1 MCM7/mcm7-1) were serially diluted at 1:4 in a 96-well plate and then frogged onto prewarmed plates and incubated at the temperatures indicated. E, stability of minichromosomes expressed as rate loss per cell division in diploids containing two or one copy of MCM7 in wild type BY4743 and mutant strain (BY4743 MCM7/mcm7::Kan). F, Western blot of Mcm7 and actin in wild type and mcm1-1 cell extracts. G, Western blot of Mcm7 and actin in homozygous and heterozygous MCM7 diploids.

 

To explore these possibilities, we compared the transcript levels of MCM7 in the mcm1-1 mutant and wild type strains (Fig. 1C, a). In parallel, we also compared the transcript level of MCM7 in the mcm7-1 strain (Fig. 1C, b). We found that the MCM7 transcripts are reproducibly reduced by approximately half in the mcm1-1 strain but increased by ~2–4-fold in the mcm7-1 mutant (see also Fig. 4, B and C). The effect of mcm7-1 on MCM7 expression is unexpected, suggesting that Mcm7 may also be involved in the regulation of its own transcription. We also investigated the functional relationship between Mcm1 and Mcm7 in the mcm1-1 mcm7-1 double mutant. We found that mcm1-1 partially suppresses the growth defect of mcm7-1 at 34.5 °C, supporting the notion that these two mutations may exert compensatory effects (Fig. 1D).



View larger version (41K):
[in this window]
[in a new window]
 
FIG. 4.
Mcm1 and Mcm7 are localized at the MCM7, MCM5, and CDC6 promoters to modulate transcription. A, yeast cells (Mcm1-Myc) were grown to log phase. Cells were cross-linked with 1% formaldehyde and divided into three aliquots for immunoprecipitation with either Mcm7-specific (lane 3) or Myc-specific antibodies (lane 2). Anti-HA antibodies were used as a negative control (lane 1). Cross-linked DNA was PCR-amplified for MCM7, MCM5, CDC6, and ATP11 promoter sequences and analyzed in agarose gel. 0.01% and 0.003% of input DNA from log phase cell extract, PCR-amplified for the respective promoter DNA sequences, were loaded in lanes 4 and 5, respectively. B, a, Northern blots of MCM7, MCM5, and CDC6 transcripts in the wild type and mcm7-1 strain at 30 and 37 °C. Cells were shifted to 37 °C for 5 h for MCM7 and MCM5 and 2 h for CDC6. b, Northern blots of MCM7, MCM5 and CDC6 transcripts in the isogenic wild type and mcm1-1 strain at 30 °C. ACT1 and PDA1 transcripts are used as loading controls. C, a, ratios of the transcript levels of MCM7, MCM5, and CDC6 at 37 and 30 °C in the mcm7-1 mutant and wild type strains described in B. Transcript levels were normalized against that of ACT1. b, ratios of the transcript levels of MCM5, CDC6, and MCM7 in the mcm1-1 and wild type strain normalized against PDA1 transcripts.

 

To investigate whether small changes in the transcript level of MCM7 would have a measurable effect on DNA replication, the stability of minichromosomes in diploids containing either one or two copies of MCM7 was examined. Northern blot analysis confirmed that there is a 2-fold difference in the transcript level corresponding to the number of copies of MCM7 in these two strains (data not shown). The stability of three different minichromosomes, each containing a different replication origin, was analyzed. Minichromosomes containing ARS1 and ARS120, but not ARS121, showed an increased loss rate in the diploid containing a single copy of MCM7, compared with the diploid containing two copies of MCM7 (Fig. 1E). This haploinsufficiency of MCM7 in the maintenance of minichromosomes containing selective ARSs is similar to that observed in a heterozygous MCM2/{Delta} diploid (32).

Although the MCM2–MCM7 genes are transcribed periodically, reaching a peak during M/G1 phase (13, 28), their protein products are present constitutively at a constant level throughout the cell cycle (33). To investigate whether reduced MCM7 transcript level or gene dose has an effect on the Mcm7p level in the mcm1-1 mutant and the MCM7/mcm7{Delta} diploid, Mcm7 protein levels in mutant and wild-type extracts were compared by Western blotting. There was no measurable difference in the Mcm7p level between the mcm1-1 mutant and parent strain (Fig. 1F). Similarly, no measurable difference in the Mcm7p level was observed in the MCM7/mcm7{Delta} and the MCM7/MCM7 diploid (Fig. 1G). These results suggest that small changes in the MCM7 transcript level and therefore the nascent Mcm7p pool may produce significant effects on the stability of plasmids carrying specific ARSs. However, the bulk of the cellular Mcm7 protein whose accumulation is independent of gene dose or periodic expression has little effect on plasmid stability.

Mcm7 Stimulates Mcm1 Binding to the MCM7 Promoter— Although Mcm7 is not known to be a transcription factor or to bind DNA, Mcm1 has been shown to bind sequences upstream of the MCM7 promoter (18). To investigate whether Mcm7 binds either alone or together with Mcm1, a 60-bp DNA fragment upstream of the MCM7 promoter was used as the binding substrate in an electrophoretic mobility shift assay. Mcm1 tagged either with His6 (Fig. 2A, a) or with GST (b, lane 2), and Mcm7-GST proteins (Fig. 2A, b, lane 1) were purified to greater than 90% homogeneity. Full-length Mcm1 migrates anomalously with an apparent molecular mass of ~42 kDa (3). The concentrations of purified proteins were calibrated against BSA in Coomassie-stained polyacrylamide gels. We found that Mcm1-GST and Mcm1-His6 can be used interchangeably to produce similar results.



View larger version (39K):
[in this window]
[in a new window]
 
FIG. 2.
Mcm1 and Mcm7 bind the ECB of the MCM7 promoter. A, a, purification of Mcm1-His6 by nickel affinity chromatography. GelCode Blue-stained SDS-PAGE gel of crude extract (C), flow-through (FT), wash (lanes 1 and 2), eluted fractions of Mcm1-His6 (lanes 3–6), molecular size markers (M). b, GelCode Blue-stained SDS-PAGE gel of purified, E. coli expressed Mcm7-GST (5 µg), lane 1, Mcm1-GST (4 µg); lane 2, molecular weight markers, M. B, PAGE mobility shift assay for the binding of Mcm1-His6 and Mcm7 to the MCM7 promoter sequence. Mcm1 or Mcm7 proteins were mixed with 0.04 pmol of the 60-bp fragment of the MCM7 promoter: actaatttacccagaaaggaaatttccttataaggaaaataaatgcaattcattaagtcg. Lane 1, Mcm1 (6 pmol); lane 2, Mcm7 (40 pmol); lane 3, free DNA. Bracket indicates positions of protein-DNA complex. C, titration of Mcm7 in a DNA binding assay containing Mcm1-His6 and MCM7 promoter DNA. PAGE mobility assay was performed in 0.04 pmol of the MCM7 promoter DNA, 6 pmol of Mcm1 (lanes 1–6), and decreasing amounts of Mcm7. Lane 1, 30 pmol; lane 2, 10 pmol; lane 3, 3.3 pmol; lane 4, 1.1 pmol, lane 5, 0.4 pmol; lane 6, 0 pmol; lane 7, DNA only. 1, Mcm1-DNA complex; <, Mcm1-Mcm7-DNA complex. D, Mcm1-His6 and Mcm7 bind specifically to the MCM7 promoter DNA. The binding mixture contains 0.04 pmol of 32P-labeled MCM7 promoter DNA, 3.3 pmol of Mcm7, and 6 pmol of Mcm1 (lanes 1–3). Competitor DNA is present in 50-fold molar excess. S, specific competitor, the 60-bp MCM7 DNA; NS, nonspecific competitor, the 22-bp OCT1 sequence 5'-tgtcgaatgcaaatcactagaa. E, Mcm7 does not interact with AP2-DNA complex. Binding mix contains 0.04 pmol of labeled AP2 DNA fragment. Lane 1, DNA only; lane 2, 1 µl of AP2 extract (Promega); lane 3, 1 µl of AP2 extract and 8 pmol of Mcm7; lane 4, 8 pmol of Mcm7. F, Mcm7 but not BSA stimulates the binding of Mcm1 to the MCM7 promoter. 4 pmol of Mcm1, 25 pmol of Mcm7, and 25 pmol of BSA were added as indicated. G, footprinting by DNase 1 protection analysis. Mcm1 and/or Mcm7 were incubated with the {gamma}-32P-labeled 160-bp DNA probe corresponding to –285 to –125 of the MCM7 promoter. a, DNase 1-treated samples were analyzed by PAGE. Mcm1-GST (30 pmol) and Mcm7 (170 pmol) were added at saturating concentrations: lane 1, Mcm1; lanes 2 and 3, Mcm7; lanes 4 and 5, Mcm1 + Mcm7; lane 6, DNA alone. Location of protected region was determined by running sequencing reactions in parallel with the footprint reactions. Bars indicate regions protected by Mcm1, Mcm7, or Mcm1-Mcm7 complex. b, sequence protected by Mcm1 or the Mcm1-Mcm7 complex at the MCM7 promoter. Bar below sequence represents region protected by Mcm1 alone or Mcm1 and Mcm7 together; bar above sequence represents protection by Mcm7 alone.

 

Mcm7 did not bind MCM7 promoter DNA (Fig. 2B, lane 2). However, Mcm1-His6 binds the DNA fragment to form multiple Mcm1-DNA complexes (Fig. 2, B (lane 1) and C (lane 6)) with the predominant species being the highest molecular mass complex and presumably the most stable complex. These multiple species of Mcm1-DNA complexes may result from the oligomerization of Mcm1 or the binding of Mcm1 to multiple sites at the MCM7 promoter or both. To investigate the effect of Mcm7 on the binding of Mcm1 to the MCM7 promoter, Mcm7 was titrated against 6 pmol of Mcm1 (Fig. 2C, lanes 1–5). At 0.4 pmol of Mcm7, a molar ratio of 1:15 for Mcm7:Mcm1, a higher molecular mass protein DNA complex is detected (lane 5, arrowhead). Increasing amounts of Mcm7 yielded increasing amounts of all of the Mcm1-DNA complexes but the highest molecular mass species in particular (lanes 1–4).

To investigate whether this protein-DNA complex results from a specific interaction among Mcm1, Mcm7, and MCM7 promoter DNA, we carried out the binding reaction in the presence of a 50-fold excess of cold competitor DNA (Fig. 2D). Binding of Mcm1 to the MCM7 promoter DNA (lane 1) is unaffected by nonspecific competitors (lane 2) but completely competed out by specific competitor DNA (lane 3). Similarly, enhanced Mcm1 binding to the MCM7 promoter DNA in the presence of Mcm7 (lane 4) is unaffected by nonspecific competitors (lane 5) but completely competed out by specific competitor DNA (lane 6). These results suggest that the interaction between Mcm1 and Mcm7 is dependent on a specific sequence on the MCM7 promoter DNA. However, the mobility of the protein-DNA complex is indifferent to the presence of Mcm7, suggesting that Mcm7 may not associate with the Mcm1-DNA complex. We are unable to detect Mcm7 in the protein-DNA complex by mobility shift using Mcm7-specific antibodies (data not shown).

To investigate whether the stimulatory effect of Mcm7 is specific for Mcm1, we examined the effect of Mcm7 on the binding of another transcription factor AP2 to its recognition sequence. AP2 binds specifically to the AP2 binding sequence (Fig. 2E, lane 2). Addition of 8 pmol of Mcm7 to the AP2-DNA complex had no stimulatory effect on the binding of AP2 to AP2 DNA. We also examined the effect of BSA on Mcm1 DNA binding. Under the condition in which neither Mcm1 (Fig. 2F, lane 3) nor Mcm7 (lane 2) alone shows significant binding to the MCM7 promoter, addition of 25 pmol of Mcm7 to Mcm1 stimulates Mcm1 binding (lane 4) but addition of 25 pmol of BSA to Mcm1 does not (lane 5). On prolonged exposure, BSA appears to promote some Mcm1 binding to produce a smear (lane 5) rather than specific bands (lane 4). These results together indicate that the stimulatory effect of Mcm7 for Mcm1 is specific.

To investigate the nature of the interactions between Mcm1 and Mcm7 and the MCM7 promoter, DNase 1 footprinting analysis was carried out to identify the region protected by Mcm1 alone, Mcm7 alone, or Mcm1 and Mcm7 together at saturating concentrations. Mcm1 alone shows a footprint restricted to the two 16-bp palindromic ECBs of the MCM7 promoter that had been previously identified (Fig. 2G, a, lane 1, bar to the left) (18). Although Mcm7 alone does not bind MCM7 DNA in a mobility shift assay (Fig. 2F), at a saturating concentration, Mcm7 protects the AT-rich region between the two MCEs (Fig. 2G, a, lanes 2 and 3, bar to the right). When both Mcm1 and Mcm7 were added, the footprint corresponds to the combined footprints of Mcm1 and Mcm7 (a, lanes 4 and 5, bar to the right). Mcm7 appears to augment the Mcm1 footprint without extending the size of the footprint. The corresponding nucleotide sequences of these footprints are shown in Fig. 2G, b.

Electrophoretic mobility shift assay and DNase 1 footprints of Mcm1 and Mcm7 suggest that, although Mcm7 facilitates the binding of Mcm1 to DNA, Mcm7 may not be part of the stable complex. Mcm7 may facilitate Mcm1 binding by transient interactions with the DNA. Alternatively, Mcm7 may bind to the Mcm1-DNA complex but cannot survive electrophoresis. To identify the Mcm7 interacting site, mutations were introduced in the intervening sequence of the two MCEs. These mutations had no effect on either Mcm1 binding or Mcm7-stimulated Mcm1 binding (data not shown). In contrast, mutations within the MCEs either reduced or abolished Mcm1 binding (data not shown). In all, we did not identify mutations that affected Mcm7 stimulation but not Mcm1 binding. We have also investigated possible physical interactions between Mcm1 and Mcm7 in the absence of DNA. Two-hybrid analysis and co-immunoprecipitation experiments failed to detect interaction between these two proteins (data not shown).

The MCM7 Promoter Region Is Not Associated with a Replication Origin—Mcm7 is a subunit of the hexameric complex that is associated with replication origins. To investigate whether the association of Mcm7 with its own promoter may be the result of a fortuitous positioning of a replication origin in the promoter region of MCM7, we tested the promoter region of MCM7 for replication origin activity. The 1.6-kb intergenic region between MCM7 and its 5' upstream neighbor DER1 was inserted into YIp56, a non-replicating vector, and the resulting plasmid was tested for autonomous replication in a high frequency transformation assay (Fig. 3A). YIp56-MCM7-P DNA yielded only abortive transformants that do not survive restreaking, whereas YIp56-ARS1 yielded true transformants at a high frequency (>1000 transformants/µg DNA). This result suggests that the intergenic region between MCM7 and DER1 does not contain a replication origin.



View larger version (53K):
[in this window]
[in a new window]
 
FIG. 3.
Early cell cycle gene promoters. A, the intergenic region between DER1 and MCM7 ORF does not contain ARS activity. The 1.6-kb intergenic region was PCR-amplified from genomic DNA and inserted into YIp56 to form YIp56-Mcm7-P. YIp56-ARS1 was used as a control. HFT, high frequency transformation. B, alignment of the ECBs (boxed) at promoters of the early cell cycle genes MCM5, SWI4, CDC6, and MCM7. C, gel mobility shift assay of Mcm1-GST (3 pmol) using 60-bp DNA probes of ECB-containing promoter sequences of MCM7, CDC6, MCM5, and SWI4.

 

Mcm1 and Mcm7 Bind a Conserved Sequence in the Promoters of Early Cell Cycle Genes—If Mcm7 stimulates the binding of Mcm1 to the ECBs of the MCM7 promoter, it may also stimulate the binding of Mcm1 to promoters of other ECB genes such as SWI4, CDC6, and MCM5 (Fig. 3B) (18). The effect of Mcm7 on the binding of Mcm1 to these promoter sequences was investigated. Oligonucleotides 60 bp in length that include ECBs upstream of the promoters of MCM7, CDC6, MCM5, and SWI4 were synthesized and tested for binding with Mcm1 alone or with Mcm1 and Mcm7 together (Fig. 3C). The conditions used for the gel mobility shift assays in Fig. 3C differ from those shown in Fig. 2 (B–D) in two ways. First, Mcm1-GST instead of Mcm1-His6 was used. Because GST is known to dimerize (45), it may stabilize Mcm1-GST and Mcm7-GST complexes that are otherwise unstable. Second, saturating amounts of Mcm7-GST were used to show that Mcm7-GST alone does not form a stable complex with ECB promoters (lanes 4). We found that Mcm1-GST binds MCM7 promoter DNA to yield distinct and well separated bands on PAGE (Fig. 3C, lanes 1). Mcm1-GST binding is enhanced by Mcm7-GST (lanes 3) producing well defined supershifted species with all four ECB promoters. Adding GST to Mcm1-GST did not enhance Mcm1-GST binding (lanes 2). Mcm7-GST alone does not bind ECB promoter DNA, although some binding of Mcm7 to the CDC6 promoter is detectable (lanes 4). These results suggest that, under these special conditions, Mcm1 and Mcm7 bind promoters of early cell cycle genes containing one or more ECBs.

Mcm1 and Mcm7 Regulate the Expression of Early Cell Cycle Genes in Vivo—Mcm1 has been shown to bind constitutively to ECB promoters throughout the cell cycle (data not shown) (18). To establish that Mcm7 also binds promoters of early cell cycle genes not only in vitro but also in vivo, DNA cross-linked to Mcm1 and Mcm7 by formaldehyde was sheared and then immunoprecipitated (chIP) using antibodies specific to Mcm1-Myc (Fig. 4A, lane 2) or to Mcm7 (lane 3). HA antibodies were used as a negative control for mock chIP (lane 1). The coding region of ATP11 was used as a negative control for crosslinked DNA. Both Mcm1 and Mcm7 were cross-linked to the promoter sequences of MCM7, MCM5, and CDC6 but not ATP11.

To show a direct correlation between the presence of Mcm1 and Mcm7 at the promoters and their effect on the expression of the early cell cycle genes, we examined the transcript levels of MCM7, MCM5, and CDC6 in the mcm7-1 (Fig. 4B, a) and mcm1-1 strains (Fig. 4B, b). The transcript levels of these genes are increased by 2–4-fold in the mcm7-1 strain (Fig. 4C, a). In contrast, transcript levels of these genes are reduced by about half in the mcm1-1 strain (Fig. 4C, b). These results suggest that the mutant forms of these proteins exert opposing effects; mcm1-1 depresses and mcm7-1 stimulates ECB gene expression. This interpretation is consistent with the partial suppression of mcm7-1 by mcm1-1 in the mcm1-1 mcm7-1 double mutant (Fig. 1D).

Recruitment of Mcm7 to the ECB Promoters Occurs after the Onset of Anaphase—The early cell cycle genes MCM7, MCM5, and CDC6 are expressed periodically during the M/G1 phase or early G1 phase. To correlate recruitment of Mcm7 to the MCM7 promoter with MCM7 expression, we followed these activities in a time course traversing the M/G1 phase. In addition, recruitment of Mcm7 to the promoters of MCM5 and CDC6 was also analyzed. Because Mcm7 is a subunit of the Mcm2-Mcm7 complex that is recruited to replication origins from late M to early S phase (25, 26), the association of Mcm7 with ARS305 DNA was used as a control.

An effective method for synchronizing yeast cells during the M/G1 phase is to deplete cells of Cdc20, an activator of the anaphase-promoting complex using the {Delta}cdc20 (GAL-CDC20) strain (46). Fluorescence-activated cell sorting analysis shows that cells that have been arrested and then released from the cdc20 block resume traversing the M and G1 phase in synchrony up to about 105 min after release (Fig. 5A). Based on DNA content, >90% of the cells are in M phase 60 min after release from block. At 75 min, ~50% of the cells contain one genome-equivalent of DNA, indicating the beginning of the G1 phase. At 90 and 105 min, >90% cells are in G1 phase. Cell morphology indicates that synchronous growth breaks down at about 105 min after release (data not shown).



View larger version (50K):
[in this window]
[in a new window]
 
FIG. 5.
Mcm7 binds to ECB-containing promoters in a cell-cycle dependent manner. K7428 (GAL-CDC20::TRP1) was grown until early log phase, and then arrested in M-phase following transfer to glucose medium. After a uniform arrest was achieved, cells were resuspended in galactose medium. Samples were taken every 15 min for fluorescence-activated cell sorting analysis (A) or for Northern blot analysis (B, panel 1) or chromatin IP (panels 2–5). N, no antibodies added. C, plots of MCM7 expression (panel 1) or Mcm7 localization at promoter (panels 2–4) or origin DNA (panel 5) during the time course. Panel 1, MCM7 transcripts, expressed as a ratio of the transcripts of MCM7 to ACT1, normalizing the highest value to 1. Panels 2–5, chromatin IP signals are expressed as ratios of the signals of the respective promoters or replication origin to that of ATP11 normalized against the ratio of the corresponding input DNA.

 

The transcript level of MCM7 was quantified in a Northern blot (Fig. 5B, panel 1) and expressed as a ratio of MCM7 RNA: ACT1 RNA (Fig. 5C, panel 1). The transcript level of MCM7 peaks at two different points, M phase (Fig. 5B, panel 1, 0 min) and late G1 phase (~105 min). The MCM7 transcript level oscillates as much as 8–10-fold at its peak and trough during the course of the cell cycle. The association of Mcm7 with the ECB promoters and ARS305 was measured as well by chromatin IP (Fig. 5B, panels 2–5). Cross-linked DNA was PCR-amplified with [{alpha}-32P]dATP and analyzed by PAGE. The amount of Mcm7 associated with the different promoter DNAs is quantified using a PhosphorImager and plotted as the ratio of the PCR-amplified signal of each of the promoter DNA to that of the ATP11 coding region (Fig. 5C, panels 2–5). The strongest association of Mcm7 with the ECB promoters occurs at the trough of the bimodal expression of MCM7 after the initiation of anaphase. This pattern is reproducibly observed for Mcm7 at the MCM7 (panel 2), MCM5 (panel 3), and CDC6 (panel 4) promoters in independent experiments. In contrast, Mcm7 is recruited to ARS305 in anaphase or telophase (Fig. 5, B and C, panels 5), slightly after its recruitment to the ECB promoters, and remains associated with ARS305 throughout the G1 phase.

Mcm3 Is Also Recruited to ECB Promoters—To investigate whether other subunits of the MCM2–7 complex are also recruited to the ECB promoters, we carried out chIP using antibodies specific to Mcm7 and Mcm3 (Fig. 6A). Extracts were prepared from cells arrested in nocodazole, {alpha} factor, and hydroxyurea, respectively, to produce cell populations that are arrested in different stages of M, G1, or S phase. Our results indicate that Mcm3 and Mcm7 have very similar cell cycle localization patterns at respective ECB promoters. Like Mcm7 (Fig. 6B), Mcm3 (Fig. 6C) is localized at the promoters of MCM7 and MCM5 during M and G1 phase and slightly delayed at the CDC6 promoter. The temporal localization patterns of Mcm7 in cells synchronized by chemicals (Fig. 6) or by Cdc20 depletion (Fig. 5) are consistent within the resolutions of these approaches. These results suggest that Mcm7 may bind ECB promoters in concert with other subunits of the MCM2–7 complex in vivo.



View larger version (39K):
[in this window]
[in a new window]
 
FIG. 6.
Localization of Mcm3 at promoters of MCM7, MCM5, and CDC6. A, chromatin IP using antibodies against Mcm7, Mcm3, and HA (negative control) was carried out as described in Fig. 4A. chIP signals of Mcm7 (B) and Mcm3 (C) at the MCM7, MCM5, and CDC6 promoters were plotted. Values in the y axis are expressed as ratios of the signals of the respective promoters to that of ATP11 normalized against the ratio of the corresponding input DNA.

 


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Mcm7 Is a Cofactor of Mcm1—We have shown that Mcm7, a subunit of the presumed MCM helicase, stimulates the binding of Mcm1 to the promoters of MCM7 and other early cell cycle genes and may regulate their periodic expression during the G1 phase. We showed that, although Mcm7 alone does not bind DNA, Mcm1 binds specifically to two DNA elements known as the ECBs at the MCM7 promoter. Together, Mcm7 enhances the binding of Mcm1 to the ECBs without altering the extent of the Mcm1 footprint. In this regard, Mcm7 may be different from other cofactors of Mcm1, such as {alpha}1p, {alpha}2p, Yox1, or Yhp1, which binds a recognition sequence flanking the MCE (3, 19, 47, 48). Furthermore, although Mcm7 stimulates Mcm1 binding to the MCM7 promoter, we are unable to demonstrate that Mcm7 associates with the Mcm1-DNA complex except under conditions when both Mcm1 and Mcm7 are GST-tagged (Fig. 3C). Whether Mcm7 transiently interacts with the promoter DNA or with Mcm1 to facilitate Mcm1 binding requires further study. The interaction between Mcm1 and Mcm7 may be more analogous to that between a transactivator (such as Gal4) and a coregulator (such as Gal80) that stabilizes the activator-DNA complex without directly binding DNA (49).

Mcm1 and Mcm7 Exert Opposing Effects—The regulation of MCM7 expression by Mcm1 and Mcm7 and the interaction of these two proteins at the MCM7 promoter may explain the partial dosage suppression of mcm1-1 by MCM7 and mcm7-1 by MCM1. Indeed, similar relationships may also apply to Mcm1 and other subunits of the MCM2–7 complex. Mcm1 and Mcm7 appear to have opposite effects on the expression of early cell cycle genes: The mcm1-1 mutation reduces whereas the mcm7-1 mutation increases the expression of these genes. These phenotypes are consistent with Mcm1 acting as a positive regulator and Mcm7 a negative regulator in the expression of early cell cycle genes. The partial suppression of the growth defect of mcm7-1 by mcm1-1 in a double mutant (Fig. 1D) is consistent with this interpretation. The double mutant phenotype cannot be easily explained by the reduced expression of a functionally compromised Mcm7-1 protein.

The effect of Mcm7 as a repressor is apparent during the M/G1 phase when expression of MCM7 is induced and then quickly shut off (Fig. 5, B and C, panels 1). The time-course experiment shows that during M phase, when Mcm1 is bound to the promoter, MCM7 expression is induced (0 min). After the initiation of anaphase, a dampening of this expression coincides with the recruitment of Mcm7 to the promoter (panel 2, 15 and 30 min). A second burst of expression of MCM7 is observed in late G1 phase (panel 1, 90 and 105 min). A bimodal expression of early cell cycle genes involving Mcm1 and its coregulators has been reported for other early cell cycle genes including CDC6 (50) and CLN3 (29). Transcript levels of these genes reach a peak at M phase and again at late G1 phase. The bimodal transcription is believed to result from the coordinated action of multiple regulatory factors to fine tune expression of early cell cycle genes in response to multiple transducing signals (50). An examination of the MCM7 promoter sequence indicates that in addition to the tandem ECBs where Mcm1, Yox1, Yhp1 (19), and Mcm7 bind, a conserved early G1 element known as the SCB (Swi4/6 cell cycle box) is located between the ECBs and the translational start codon. SCBs are regulatory elements for early G1 gene expression (29, 51, 52). The bimodal expression of MCM7 could be the combined effects of ECBs and SCBs in addition to other factors.

Dual Roles of Mcm7 at Promoters and at Replication Origins—Parallels can be drawn between Mcm7, the transcription factor, and Mcm7, a subunit of the replicative MCM helicase. Both are recruited to their designated sites in a cell cycle-regulated manner at approximately the same time frame. Mcm7 is recruited to the ECB promoters after the initiation of anaphase upon release from the cdc20 block (Fig. 7A). Recruitment of Mcm7 to replication origins occurs ~30 min later at anaphase or telophase (Fig. 7B). Neither Mcm7 alone nor the hexameric complex (53, 54) exhibits DNA binding activity, yet both are recruited by pre-assembled factors: Mcm1 at promoters and other components of the pre-RC at replication origins (55). Both Mcm7 and the MCM complex are released from their respective binding sites after execution of their respective functions (25, 26). In both cases, re-assembly at promoters or replication origins is prevented until the next cell cycle.



View larger version (18K):
[in this window]
[in a new window]
 
FIG. 7.
Cell cycle-regulated recruitment of Mcm7 to the promoters of early cell cycle genes and to replication origins. A, Mcm1 binds the ECB elements at the MCM7 promoter throughout the cell cycle and recruits Mcm7 during M phase. The binding of Mcm7 to the MCM7 promoter coincides with the repression of MCM7 expression in M phase. Arrows depict transcription from the MCM7 promoter. Lightning bolt represents activation of transcription or removal of Mcm7 that may involve additional factors. B, the MCM2–7 complex is recruited to replication origins by ORC and other pre-RC factors during M phase and persists until the beginning of S phase. Arrows indicate initiation of bidirectional replication. Lightning bolt represents the initiation of DNA synthesis activated by additional factors.

 

A number of reports support the view that Mcm7 as well as other subunits of the MCM complex may participate in transcription regulation in mammals. Mcm7 directly interacts with the retinoblastoma tumor suppressor protein, for example (56). Mcm7 also interacts with MAT1, the targeting factor for the CAK kinase, substrates of which include the cyclin-dependent kinases as well as components of the transcription machinery such as the C-terminal domain of RNA polymerase II (57). Stat{alpha}1, an interferon-{gamma}-responsive transcription factor, recruits a Mcm3/Mcm5 subcomplex through direct interaction with Mcm5 in interferon-{gamma}-induced gene expression (58). In yet another study, subunits of the MCM complex have been shown to associate with the RNA polymerase II holoenzyme (59). Our results suggest that both Mcm7 and Mcm3 are recruited to the promoters of some ECB genes in a cell cycle-specific manner in the budding yeast. It is possible that members of the Mcm2–Mcm7 family other than Mcm7 may also be involved in the regulation of ECB gene expression.

Subtle Effects in Transcription May Have Significant Effects on Replication Initiation—A 2-fold reduction in the transcript levels of MCM7 has a dramatic effect on minichromosome maintenance. This observation is incongruent with the abundance of Mcm7 (~30,000/cell) (34), which far exceeds the number of replication origins (~400/cell) in a yeast cell (38, 60). Furthermore, this extreme abundance of Mcm7 protein level appears not to be influenced by the fluctuation of the MCM7 transcript levels (31). However, dosage effects are common among some of the MCM2–7 proteins (32). That a small change in the total pool of Mcm7 may produce a large effect on DNA replication is best explained if a distinct pool of Mcm7 is targeted for DNA replication. A recent study showed that a small subset of the Mcm3 population is polyubiquitinated during M phase before the establishment of the pre-replication complex (36). In that scenario, a small nascent pool of the Mcm3 protein that is transcribed and translated in a cell cycle-dependent manner may be targeted for replication initiation. Autoregulation of replication initiation factors effectively limits DNA replication to a narrow window by producing a burst of the initiation factors just prior to replication initiation. This strategy is used in the regulation of the E. coli DnaA protein (61) and the SV40 large T antigen (62, 63).

Coordination of Gene Expression and Cell Proliferation by Common Factors—There are two issues that a eukaryote cell must contend with in cell growth and cell proliferation: the execution of DNA replication and gene expression, and the coordination of these two processes. Here, we show that Mcm7, a subunit of the putative replicative helicase that is involved in the execution of DNA replication, may have a role in the expression of DNA replication genes. Similarly, Mcm1, which regulates expression of a number of replication initiation factors, also binds replication origins (21). By involving the same protein factors in the execution of both of these processes, cell growth and cell proliferation may be coordinated. A paradigm of this complex scheme can be found in the large T antigen of the SV40 virus, a successful parasite that has evolved to infiltrate the infrastructure of its host (64). Of particular relevance, as a smaller unit, the large T antigen is a transcription factor (65); as a hexamer, it is a replicative helicase (66). Understanding the dynamics between the hexameric MCM helicase and its subunits in the regulation of DNA replication and gene expression will provide insights into the coordination of cell growth and cell proliferation in eukaryotes.


    FOOTNOTES
 
* This work was supported in part by National Institutes of Health Grant GM34190. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

{ddagger} Current address: Scripps Research Inst., La Jolla, CA 92037. Back

§ Supported by National Institutes of Health Predoctoral Training Grant GM07273. Back

Graduate Assistance in Areas of National Need fellow. Back

|| To whom correspondence should be addressed. E-mail address: bt16{at}cornell.edu.

1 The abbreviations used are: ORF, open reading frame; GST, glutathione S-transferase; BSA, bovine serum albumin; SCB, Swi4/6 cell cycle box; chIP, Chromatin immunoprecipitation; ECB, early cell cycle box; HA, hemagglutinin; MCE, Mcm1 consensus element. Back

2 S. DiTusa, M. Osman, and B. Tye, unpublished results. Back


    ACKNOWLEDGMENTS
 
We thank Jeff Roberts, John Lis, Sara Sawyer, and Nancy Douglas for critical reading of this manuscript.



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Maine, G. T., Sinha, P., and Tye, B. K. (1984) Genetics 106, 365–385[Abstract/Free Full Text]
  2. Tye, B. K. (1999) Annu. Rev. Biochem. 68, 649–686[CrossRef][Medline] [Order article via Infotrieve]
  3. Passmore, S., Elble, R., and Tye, B. K. (1989) Genes Dev. 3, 921–935[Abstract/Free Full Text]
  4. Nurrish, S. J., and Treisman, R. (1995) Mol. Cell. Biol. 15, 4076–4085[Abstract]
  5. Treisman, R. (1995) Nature 376, 468–469[CrossRef][Medline] [Order article via Infotrieve]
  6. Christ, C., and Tye, B. K. (1991) Genes Dev. 5, 751–763[Abstract/Free Full Text]
  7. Mueller, C. G. F., and Nordheim, A. (1991) EMBO J. 10, 4219–4229[Medline] [Order article via Infotrieve]
  8. Primig, M., Winkler, H., and Amerer, G. (1991) EMBO J. 10, 4209–4218[Medline] [Order article via Infotrieve]
  9. Tan, S., and Richmond, T. J. (1998) Nature 39, 660–666
  10. Norman, C., Runswick, M., Pollock, R., and Treisman, R. (1988) Cell 55, 989–1003[CrossRef][Medline] [Order article via Infotrieve]
  11. Lilly, B., Zhao, B., Ranganayakulu, G., Paterson, B., Schulz, R., and Olson, E. (1995) Science 267, 688–693[Abstract/Free Full Text]
  12. Riechmann, J. L., and Meyerowitz, E. M. (1997) Biol. Chem. 378, 1079–1101[Medline] [Order article via Infotrieve]
  13. Spellman, P., Sherlock, G., Zhang, M. Q., Iyer, V. R., Anders, K., Eisen, M. B., Brown, P. O., Botstein, D., and Futcher, B. (1998) Mol. Biol. Cell. 9, 3273–3297[Abstract/Free Full Text]
  14. Keleher, C. A., Goutte, C., and Johnson, A. D. (1988) Cell 53, 927–936[CrossRef][Medline] [Order article via Infotrieve]
  15. Passmore, S., Maine, G. T., Elble, R., Christ, C., and Tye, B. K. (1988) J. Mol. Biol. 204, 593–606[CrossRef][Medline] [Order article via Infotrieve]
  16. Lydall, D., Amerer, G., and Nasmyth, K. (1991) Genes Dev. 5, 2405–2419[Abstract/Free Full Text]
  17. Maher, M., Cong, F., Kindelberger, D., Nasmyth, K., and Dalton, S. (1995) Mol. Cell. Biol. 15, 3129–3137[Abstract]
  18. Mai, B., Miles, S., and Breeden, L. L. (2002) Mol. Cell. Biol. 22, 430–441[Abstract/Free Full Text]
  19. Pramila, T., Miles, S., GuhaThakurta, D., Jemiolo, D., and Breeden, L. L. (2002) Genes Dev. 16, 3034–3045[Abstract/Free Full Text]
  20. Simon, I., Barnett, J., Hannett, N., Harbison, C. T., Rinaldi, N. J., Volkert, T. L., Wyrick, J. J., Zeitlinger, J., Gifford, D. K., Jaakkola, T. S., and Young, R. A. (2001) Cell 106, 697–708[CrossRef][Medline] [Order article via Infotrieve]
  21. Chang, V. K., Fitch, M. J., Donato, J. J., Christensen, T. W., Merchant, A. M., and Tye, B.-K. (2003) J. Biol. Chem. 278, 6093–6100[Abstract/Free Full Text]
  22. Ishimi, Y. (1997) J. Biol. Chem. 272, 24508–24513[Abstract/Free Full Text]
  23. Lee, J. K., and Hurwitz, J. (2000) J. Biol. Chem. 275, 18871–18878[Abstract/Free Full Text]
  24. Tye, B. K., and Sawyer, S. (2000) J. Biol. Chem. 275, 34833–34836[Free Full Text]
  25. Tanaka, T., Knapp, D., and Nasmyth, K. (1997) Cell 90, 649–660[CrossRef][Medline] [Order article via Infotrieve]
  26. Aparicio, O. M., Weinstein, D. M., and Bell, S. P. (1997) Cell 91, 59–69[CrossRef][Medline] [Order article via Infotrieve]
  27. Labib, K., Tercero, J. A., and Diffley, J. F. (2000) Science 288, 1643–1647[Abstract/Free Full Text]
  28. Hennessy, K. M., Clark, C. D., and Botstein, D. (1990) Genes Dev. 4, 2252–2263[Abstract/Free Full Text]
  29. McInerny, C. J., Partridge, J. F., Mikesell, G. E., Creemer, D. P., and Breeden, L. L. (1997) Genes Dev. 11, 1277–1288[Abstract/Free Full Text]
  30. Cho, R. J., Campbell, M. J., Winzeler, E. A., Steinmetz, L., Conway, A., Wodicka, L., Wolfsberg, T. G., Gabrielian, A. E., Landsman, D., Lockhart, D. J., and Davis, R. W. (1998) Mol. Cell 2, 65–73[CrossRef][Medline] [Order article via Infotrieve]
  31. Dalton, S., and Whitbread, L. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 2514–2518[Abstract/Free Full Text]
  32. Lei, M., Kawasaki, Y., and Tye, B. K. (1996) Mol. Cell. Biol. 16, 5081–5090[Abstract]
  33. Young, M., and Tye, B. K. (1997) Mol. Biol. Cell. 8, 1587–1601[Abstract]
  34. Donovan, S., Harwood, J., Drury, L. S., and Diffley, J. F. X. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 5611–5616[Abstract/Free Full Text]
  35. Pereverzeva, I., Whitmire, E., Khan, B., and Coue, M. (2000) J. Biol. Chem. 20, 3667–3676
  36. Cheng, I. H., Roberts, L. A., and Tye, B. K. (2002) J. Biol. Chem. 277, 41706–41714[Abstract/Free Full Text]
  37. Takei, Y., Swietlik, M., Tanoue, A., Tsujimoto, G., Kouzarides, T., and Laskey, R. (2001) EMBO Rep. 21, 119–123[CrossRef]
  38. Wyrick, J. J., Aparicio, J. G., Chen, T., Barnett, J. D., Jennings, E. G., Young, R. A., Bell, S. P., and Aparicio, O. M. (2001) Science 294, 2357–2360[Abstract/Free Full Text]
  39. Althoefer, H., Schleiffer, A., Wassmann, K., Nordheim, A., and Ammerer, G. (1995) Mol. Cell. Biol. 15, 5917–5928[Abstract]
  40. Schmitt, M. E., and Brown, T. A. (1990) Nucleic Acids Res. 18, 3091–3092[Free Full Text]
  41. Ausubel, F. M., Brent, T., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K. (1998) Current Protocols in Molecular Biology, John Wiley & Sons, Inc., Cambridge, MA
  42. Hecht, A., Strahl-Bolsinger, S., and Grunstein, M. (1996) Nature 383, 92–96[CrossRef][Medline] [Order article via Infotrieve]
  43. Haase, S. B., and Lew, D. J. (1997) Methods Enzymol. 283, 322–332[Medline] [Order article via Infotrieve]
  44. Kippert, F. (1995) FEMS Microbiol. Lett. 128, 201–206[Medline] [Order article via Infotrieve]
  45. Maru, Y., Afar, D. E., Witte, O. N., and Shibuya, M. (1996) J. Biol. Chem. 271, 15353–15357[Abstract/Free Full Text]
  46. Cosma, M. P., Tanaka, T., and Nasmyth, K. (1999) Cell 97, 299–311[CrossRef][Medline] [Order article via Infotrieve]
  47. Smith, D. L., and Johnson, A. D. (1992) Cell 68, 133–142[CrossRef][Medline] [Order article via Infotrieve]
  48. Jarvis, E. E., Clark, K. L., and Sprague, G. F. (1989) Genes Dev. 3, 936–945[Abstract/Free Full Text]
  49. Platt, A., and Reece, R. J. (1998) EMBO J. 17, 4086–4091[CrossRef][Medline] [Order article via Infotrieve]
  50. Piatti, S., Lengauer, C., and Nasmyth, K. (1995) EMBO J. 14, 3788–3799[Medline] [Order article via Infotrieve]
  51. Nasmyth, K. (1985) Cell 42, 225–235[CrossRef][Medline] [Order article via Infotrieve]
  52. Andrews, B. J., and Herskowitz, I. (1989) Nature 342, 830–833[CrossRef][Medline] [Order article via Infotrieve]
  53. Adachi, Y., Usukura, J., and Yanagida, M. (1997) Genes Cells 2, 467–479[Abstract]
  54. Brown, G., and Kelly, T. J. (1998) J. Biol. Chem. 34, 22083–22090
  55. Lei, M., and Tye, B. K. (2001) J. Cell Sci. 114, 1447–1454[Abstract]
  56. Sterner, J., Dew-Knight, S., Musahl, C., Kornbluth, S., and Horowitz, J. (1998) Mol. Cell. Biol. 18, 2748–2757[Abstract/Free Full Text]
  57. Wang, Y., Xu, F., and Hall, F. L. (2000) FEBS Lett. 484, 17–21[CrossRef][Medline] [Order article via Infotrieve]
  58. DaFonseca, C. J., Shu, F., and Zhang, J. J. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 3034–3039[Abstract/Free Full Text]
  59. Yankulov, K., Todorov, I., Romanowski, P., Licatalosi, D., Cilli, K., McCracken, S., Laskey, R., and Bentley, D. L. (1999) Mol. Cell. Biol. 19, 6154–6163[Abstract/Free Full Text]
  60. Raghuraman, M. K., Winzeler, E. A., Collingwood, D., Hunt, S., Wodicka, L., Conway, A., Lockhart, D. J., Davis, R. W., Brewer, B. J., and Fangman, W. L. (2001) Science 294, 115–121[Abstract/Free Full Text]