JBC Anatrace, Inc.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M302873200 on May 1, 2003

J. Biol. Chem., Vol. 278, Issue 28, 25664-25670, July 11, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/28/25664    most recent
M302873200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Leonov, A. A.
Right arrow Articles by Dontsova, O. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Leonov, A. A.
Right arrow Articles by Dontsova, O. A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Affinity Purification of Ribosomes with a Lethal G2655C Mutation in 23 S rRNA That Affects the Translocation*

Andrei A. Leonov {ddagger}, Petr V. Sergiev {ddagger} §, Alexey A. Bogdanov, Richard Brimacombe ¶ and Olga A. Dontsova

From the Department of Chemistry, Moscow State University, 119899 Moscow, Russia and the Max Planck Institut fur Molekulare Genetik, 14195 Berlin, Germany

Received for publication, March 20, 2003 , and in revised form, April 28, 2003.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
A method for preparation of Escherichia coli ribosomes carrying lethal mutations in 23 S rRNA was developed. The method is based on the site-directed incorporation of a streptavidin binding tag into functionally neutral sites of the 23 S rRNA and subsequent affinity chromatography. It was tested with ribosomes mutated at the 23 S rRNA position 2655 (the elongation factor (EF)-G binding site). Ribosomes carrying the lethal G2655C mutation were purified and studied in vitro. It was found in particular that this mutation confers strong inhibition of the translocation process but only moderately affects GTPase activity and binding of EF-G.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Now that atomic structures of ribosomal subunits have become available (13), the major emphasis of ribosome research has shifted toward gaining an understanding of structure-function relationships. Analysis of the role that specific rRNA nucleotides play in the translation process is of primary interest. In this respect, the application of site-directed mutagenesis of rDNA has so far had one general limitation, namely that for the biochemical characterization of mutant ribosomes, the mutants need to be prepared in a pure form. An Escherichia coli strain was created in the laboratory of C. Squires, in which all the chromosomal rDNA operons were deleted (4). With the help of such a strain, it is possible to produce mutant ribosomes if these ribosomes are able to support cell growth (5, 6). Obviously, most functionally interesting mutations are likely to be lethal and could only be expressed if wild type ribosomes are co-expressed to support translation.

Two methods have been published describing attempts to create a pure population of ribosomes carrying lethal mutations (710). Both of them involve in vitro transcription of an rDNA or rDNA fragment and subsequent reconstitution of the ribosomal subunit. However, the first method (9) uses ribosomes that are not from E. coli, and the second (7) utilizes fragmented rRNA, leading to very low activity (for discussion, see Ref. 10). The major problem here lies in the absence of natural modifications as well as possible (at least partial) misfolding of the rRNA in vitro, as compared with the in vivo assembly.

We aimed to create a system for affinity purification of ribosomes, assembled in vivo, via an aptamer tag attached to the mutated rRNA. Whereas the purification of proteins carrying genetically introduced affinity tags has become a routine, only a few such tags are known for RNA (1113), and none of them has so far been applied to a ribonucleoprotein particle with the size of the ribosome.

One of the most challenging steps of the protein synthetic cycle is translocation, and the coupling of GTP hydrolysis and translocation, stimulated by elongation factor G, has been widely discussed in the literature. There are two known sites of interaction of EF-G1 with the 23 S rRNA, namely the sarcinricin loop (SRL) and the GTPase-associated center (14). The mutation G2655C of the SRL of 23 S rRNA is known from the literature to be lethal (15), an effect that is related to the interaction of the elongation factor with the ribosome. In this report, we decided to study this mutation in more detail, namely to find an exact stage in the elongation factor G cycle affected by the G2655C mutation. For this purpose, we applied a method for the affinity purification of ribosomes harboring the G2655C lethal mutation in an amount and purity sufficient for biochemical characterization.


    EXPERIMENTAL PROCEDURES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Plasmids—Introduction of the MS2 coat protein binding site into helices 9, 25, 45, and 98 of 23 S rRNA has been described by Matadeen et al. (16). The plasmid, coding for the MS2 coat protein dimer TEV cleavage site ZZ domain fusion protein, was constructed from the pET-TEV-ZZ vector (17) and the pCP12d1–12 plasmid (11), encoding the MS2 coat protein dimer. The streptomycin binding aptamer (12) was introduced by sequential site-directed mutagenesis of M13 mp18 phage carrying an SphI-BamHI fragment of the E. coli rrnB operon with the MS2 coat protein-binding site already inserted into helix 98. The resulting sequence of helix 98 of the 23 S rRNA is GACCCUGGAUCGCAUUUGGACUUCUGCCCAGGGUGGCACCACGGUCGGAUCCAGGGUC (starting from the nucleotide 2791 of the wild-type 23 S rRNA, ending with nucleotide 2805 of the wild-type 23 S rRNA). To introduce the streptavidin binding aptamer (13), an XbaI-SphI fragment of the rrnB operon with the MS2 coat protein binding site already inserted at helix 9, 25, or 45 was subcloned into an additional plasmid where the KpnI and XmaIII sites of the MS2 insert were unique. The plasmid, cut with KpnI and XmaIII, was ligated with annealed oligonucleotides, coding for the aptamer, followed by subcloning of the XbaI-SphI fragment back into the expression vector pLK1192U (18). The resulting sequence of helix 25 of the 23 S rRNA is CACGCUUGGGUACCGGCUGGGCCGACCAGAAUCAUGCAAGUGCGUAAG AUAGUCGCGGGCCGGCCCGGCCGGGUACUCAGGC (starting from the nucleotide 540 of the wild-type 23 S rRNA, ending with nucleotide 550 of the wild-type 23 S rRNA).

Mutations of nucleotide 2655 of the 23 S rRNA were made by site-directed mutagenesis of an SphI-BamHI fragment of the E. coli rrnB operon, subcloned into M13 mp18 phage. Subsequently, the mutated fragment was subcloned back into the pLK1192U plasmid either with or without the affinity tag.

The XL1 strain of E. coli was used for all genetic manipulations and phage growth. For preparation of uracil-containing single-stranded DNA for mutagenesis, strain CJ236 was used as a host for M13 phage. For translation fidelity measurements, strain MC140 was used. Strain AVS69009 (4) carrying no chromosome-encoded rRNA was transformed by pLK1192U plasmids carrying mutations. For displacement of originally present pHK-rrnC plasmid, the transformants were streaked on LB plates containing spectinomycin (pLK1192U encodes a mutation in 16 S rRNA, causing resistance to spectinomycin). The loss of the pHK-rrnC plasmid was monitored by loss of kanamycin resistance. The absence of wild type rRNA in the cell was confirmed by the primer extension method, as in Sergiev et al. (5). The primer was complementary to nucleotides 548–564 of the 23 S rRNA. The extension was carried out in the presence of dATP, dCTP, dTTP, and ddGTP, thus proceeding up to nucleotide C544 in the case of the wild type and until the last cytosine of the insert, 2 nucleotides from the primer binding site in the case of ribosomes carrying the affinity tag.

Translational Fidelity Measurements and Growth Rate Determination—Cells from strain MC140, transformed both by pLK1192U, carrying a mutation at nucleotide 2655 of the 23 S rRNA, and by the pSG or CSH series of plasmids (19), were grown at 37 °C until an optical density at 600 nm of 0.3 was reached. {beta}-Galactosidase activity was assayed essentially according to O'Connor et al. (20).

Growth rates were measured at 37 °C in LB media containing 50 µg/ml ampicillin. Three independent colonies were grown overnight after transformation of the XL1 strain or plasmid substitution in the AVS69009 strain and were used to inoculate a volume of medium 50 times larger. Cell densities were monitored by absorbance at 600 nm.

Ribosome Preparation and Affinity Purification—Ribosomes were prepared by the reassociation method (21). Affinity purification was carried out in subunit dissociation buffer (20 mM Hepes-K, pH 7.5, 1 mM Mg(OAc)2, 200 mM NH4C1, 4 mM 2-mercaptothanol) at 4 °C. Binding of 1000 pmol of ribosomes to 100 µl of streptavidin-Sepharose (Amersham Biosciences) was performed overnight (16 h) in a 2-ml tube followed by three washes with binding buffer. Elution was also carried out overnight, using binding buffer saturated with biotin. After elution, the 50 S ribosomal subunits were reassociated with 30 S subunits from an additional subunit preparation, and the 70 S ribosomes were separated by sucrose density gradient centrifugation. The ratio of wild type to mutant in the ribosome preparations was estimated by primer extension, according to Sigmund et al. (22).

GTPase Reaction—For the GTPase reaction, 4 pmol of ribosomes were mixed with a preincubated (10 min, 37 °C) mixture of 4 pmol of EF-G, 4 pmol of GTP, and 0.1 µCi of [{gamma}-32P]GTP for one round of hydrolysis and 400 pmol of GTP for multiple rounds of hydrolysis. Buffer conditions for the reaction were 20 mM Hepes-K, pH 7.5, 10 mM MgCl2, 100 mM NH4Cl, 4 mM 2-mercaptoethanol. Fusidic acid was added if required to a final concentration of 1 mM. 40% formic acid was used to stop the reaction. The extent of GTP hydrolysis was assayed by thin-layer chromatography (23). Recombinant EF-G was purified from the superproducing strain (24), provided by Dr. T. Ueda.

Footprinting—For footprinting experiments, the complexes of ribosomes and EF-G with or without fusidic acid were prepared as for the GTPase reaction (above) but without radioactive GTP. Dimethylsulfate (DMS) modification was carried out by addition of 0.2 µl of 20% DMS solution in ethanol to 10 µl of the complex. Modification was allowed to proceed for 10 min at 37 °C. The reaction was stopped, rRNA was extracted, and primer extension was carried out as described in Sergiev et al. (5). For the analysis of the region around the SRL and GTPase-associated center, primers complementary to 23 S rRNA nucleotides 1121–1140 and 2730–2749, respectively, were used.

Translocation Experiments—For translocation experiments, 2.5 pmol of ribosomes were mixed with 1 µg of polyU (Sigma) and a 2-fold excess of tRNAPhe in a 10-µl volume of polyamine buffer (20 mM Hepes-K, pH 7.5, 6 mM Mg(OAc)2, 150 mM NH4OAc, 2 mM spermidine, 0.05 mM spermine, 4 mM 2-mercaptothanol) (21) and incubated at 37 °C 15 min. After incubation, a 1.2-fold excess of AcPhe-tRNAPhe in the same buffer was added followed by incubation for an additional 15 min. The same buffer with or without equimolar amounts of EF-G and GTP (2 mM final concentration) was added, and incubation was continued for a further 10 min at 37 °C. In parallel, the binding of AcPhe-tRNAPhe directly to the P-site was done the same way but without prior incubation of the ribosomes with the deacylated tRNA. Binding of AcPhe-tRNAPhe to the ribosomal P or A sites was measured by filtration through nitrocellulose. The puromycin reaction was performed at 37 °C for 10 min with a 5 mM final concentration of puromycin adjusted to pH 7.5. The radioactive amino acid released was extracted with ethyl acetate. The background of the puromycin reaction was measured in a parallel experiment without puromycin.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Choice of Affinity Tag—For the introduction of an affinity tag into E. coli 23 S rRNA, we chose the internal 23 S rRNA helices 9, 25, 45, and 98, which are evolutionarily variable and whose extension is known not to affect protein biosynthesis (16). Several affinity tags were tested, and the best results were obtained for the streptavidin binding aptamer. Other tags that we tested in preliminary experiments were the MS2 coat protein binding site and the aptamer to streptomycin.

Introduction of the MS2 coat protein binding site into rRNA has been described previously. A recombinant fusion protein consisting of the MS2 coat protein dimer (11), a TEV-protease cleavage site, and a dimer of the Z domains of Staphylococcus aureus protein A was created for the affinity purification. Using this system, we were able to observe a quantitative binding of the fusion protein to the affinity-tagged ribosomes and, independently, to the IgG-Sepharose (data not shown). However, the binding of ribosomes carrying the MS2 coat protein binding site to the resin, mediated by the recombinant protein, was extremely low and relatively non-specific (data not shown). The reason was most probably in the steric clash between ribosomes, protein, and the resin when all three are to bind each other simultaneously. The successfully applied MS2 coat protein-based systems for affinity separation of RNA and its complexes obviously involved ribonucleoprotein particles of a much smaller size. We also cannot rule out that more flexible and long linkers between the MS2 coat protein part and the IgG-Sepharose binding part of the fusion protein could potentially enable the binding of tagged ribosomes to the resin.

The next affinity tag to be tested was the streptomycin binding aptamer (12), which was introduced into helix 98 of the 23 S rRNA. Purification of the ribosomes carrying this aptamer on immobilized dihidrostreptomycin gave a very high level of co-purification of wild type ribosomes (data not shown). This might be explained by binding of the streptomycin derivative to the 30 S ribosomal subunit or by non-specific electrostatic interactions between the dihydrostreptomycin and rRNA. The latter is more probable since the application of the 50 S subunits instead of the 70 S ribosomes for the binding does not increase the specificity of binding.

Finally, an aptamer to streptavidin (13) was introduced into the helices 9, 25, and 45 of the 23 S rRNA. Strains (4) expressing only the tagged variant of 23 S rRNA had no growth defects in rich medium, indicating that tagged ribosomes could support translation equally to the wild type ribosomes. Pure tagged ribosomes bound streptavidin-Sepharose and could be eluted by biotin in a similar manner as that described for yeast RNase P (13). The best binding was observed when the aptamer was introduced into helix 25 (Fig. 1). In equal conditions, binding of other variants of tagged ribosomes was 70% of the binding of the ribosomes carrying the aptamer inserted into the helix 25. Under equal conditions, the ribosomes without the introduced aptamer were not able to bind the resin to any detectable extent.



View larger version (61K):
[in this window]
[in a new window]
 
FIG. 1.
Affinity purification of ribosomes. A, the secondary structure of the 23 S rRNA region carrying the streptavidin binding aptamer inserted at the helix 25. B, the place of the streptavidin binding tag in the structure of the large ribosomal subunit. Shown is the structure of the large ribosomal subunit of Deinococcus radiodurans (40) as viewed from the solvent side. A secondary structure element, correspondent to the E. coli 23 S rRNA helix 25, is marked in black. C, the principle of the primer extension analysis of the ratio between the affinity-tagged and wild type ribosomes. D, an autoradiograph of primer extension products, separated by 16% PAGE. Primer extension proceeded up to the first cytosine after the primer binding site on the 23 S rRNA. The Mutant stop corresponds to the tagged ribosomes carrying the streptavidin binding aptamer at 23 S rRNA helix 25, whereas the WT stop corresponds to the wild type ribosomes. The Initial lane contains the primer extension products of the mixture of chromosomally encoded ribosomes with affinity-tagged ribosomes. This mixture was purified from the cells and applied to streptavidin-Sepharose. The Flow through lane contains primer extension products of those ribosomes that did not bind to the resin. The Wash lane contains primer extension products of the ribosomes that were washed from the resin by excess loading buffer. The Elution lane contains primer extension products of the ribosomes that were eluted from the affinity resin by biotin.

 

Affinity Separation of Ribosomes Carrying the Lethal G2655C Mutation—Plasmid pLK1192U, encoding 23 S rRNA carrying both the streptavidin aptamer and the G2655C mutation, was expressed in strain XL1 of E. coli. The plasmid used carries the ampicillin resistance gene and C1192U mutation in 16 S rRNA, making ribosomes resistant to spectinomycin. 70 S ribosomes from this strain were prepared by the reassociation technique (21). Affinity purification of tagged ribosomes by streptavidin-Sepharose at 10 mM magnesium concentration lead to only 5-fold enrichment of the initial mixture. Since binding of pure wild type ribosomes (not as a mixture with tagged ones) to the resin was not observed, we concluded that non-specific binding of non-tagged species arises from ribosome-ribosome rather then ribosome-resin interactions. To avoid this effect, we purified 50 S subunits at a magnesium concentration of 1 mM, which led to a satisfactory separation; the initial mixture contained only 6% tagged ribosomes, which was enriched to a level of 90 ± 3% in the final eluate from the resin (Fig. 1). The affinity chromatography step was followed by reassociation of the subunits and further purification of the 70 S ribosomes by ultracentrifugation in a sucrose density gradient as described by Blaha et al. (21).

The G2655C Mutation Affects Cell Growth and Accuracy of Translation—In agreement with previous reports (15), we found that G2655C mutation is recessive lethal. It was not able to support cell growth if no wild type ribosomes were present in the cell; however, it could be tolerated if the translation is carried out by wild type ribosomes. In a strict sense, the mutation did not allow AVS69009 strain (4) to lose the plasmid encoding the wild type 23 S rRNA and remain viable. The study was extended to other substitutions of the 2655 nucleotide, namely G2655A and G2655U. In contrast to G2655C, these mutations were found to be viable and were able to support growth, even when they represented 100% of the 23 S rRNA in AVS69009 cells in which all the chromosomal rDNA operons are deleted. The doubling times of the corresponding strains are listed in Table I. In agreement with previous reports (25), the G2655A mutation showed little difference from the wild type, G2655C was the most defective, and G2655U was intermediate.


View this table:
[in this window]
[in a new window]
 
TABLE I
Doubling times of strains AVS69009 and XL1, harboring pLK1192U plasmids expressing 23 S rDNA with (or without) mutations of nucleotide 2655

 

The effect of the mutations at 23 S rRNA position 2655 on the in vivo accuracy of translation was tested with the help of a set of plasmids expressing the {beta}-galactosidase gene (19). Each plasmid of this set (except pSG25, used as a control) contain a mutation in the lacZ gene that would lead to a non-functional protein if the translation of correspondent mRNA proceeded without mistakes. The active enzyme could only be synthesized as a result of a translation error, such as frameshifting, stop codon readthrough, and misreading, compensating the mutation encoded in the DNA. Stop codon readthrough and frameshifting was increased in the strains expressing mutant rDNA (Table II). The extent of the increase correlated well with the growth rates, being minimal for G2655A and maximal for the lethal G2655C mutation. Curiously, the mutations also increased the expression of the normal {beta}-galactosidase gene, an effect that has been described in the literature for several other mutations and explained by an increase of overall wild type ribosome production in response to the expression of mutant rDNA genes (26).


View this table:
[in this window]
[in a new window]
 
TABLE II
Effects of mutations at position 2655 of 23 S rRNA on the readthrough of stop-codons, frameshifting, and missense amino acid incorporation

 

The interesting observation is the decrease in Glu/Gln misreading in strains expressing the G2655C and G2655U mutants (Table II). Altogether these effects could be explained if we suppose that the G2655C mutant ribosomes move very slowly along the mRNAs. In this case, the downstream ribosomes in the polysomes would be forced to move as slowly as the mutant ones, thus gaining additional time for correct tRNA selection as well as for shifting the reading frame.

Ribosomes Carrying the G2655C Mutation Stimulate GTPase of EF-G—The experiments were carried out with ribosomes, purified by affinity chromatography, carrying the G2655C mutation. Ribosomes, purified by the same technique, with a wild type 2655G nucleotide were used as a control.

The multiple EF-G turnover reaction was measured at a ribosome:EF-G:GTP ratio of 1:1:100. It was shown that ribosomes carrying the G2655C mutation have a slightly slower GTPase turnover rate (Fig. 2). However, in contrast to our expectations, it was found that the mutant ribosomes do in fact stimulate the GTPase activity of elongation factor G. According to the experiments of Munishkin and Wool (25), a sarcin-ricin loop oligonucleotide carrying the G2655C mutation does not bind EF-G. We decided to check whether the same is true in the context of the ribosome. It is known that fusidic acid stabilizes the complex of EF-G with the ribosome, where EF-G forms a contact with the SRL (14, 27). We checked the inhibition by fusidic acid of GTPase turnover on the mutant ribosomes and found it to be the same as for the wild type ribosomes. Since fusidic acid prevents dissociation of EF-G and the ribosome, this inhibition proves that EF-G binds to the ribosome. This might indicate that an interaction of EF-G with other parts of the ribosome, most probably with the GTPase-associated center, could overcome the effect of the mutation and be sufficient for EF-G binding.



View larger version (27K):
[in this window]
[in a new window]
 
FIG. 2.
EF-G catalyzed GTPase reaction, stimulated by affinity-purified ribosomes. In A, the figure shows an autoradiograph of thin-layer chromatography of the GTP hydrolysis products. Positions of inorganic phosphate and unhydrolyzed GTP are indicated. The hydrolysis time was 30 s. –Rs, GTPase reaction, catalyzed by EF-G without ribosomes. WT, GTPase reaction, catalyzed by EF-G and stimulated by affinity-purified ribosomes, without any additional mutations; GTP:EF-G:ribosome ratio of 100:1:1. M, GTPase reaction, catalyzed by EF-G and stimulated by affinity-purified ribosomes carrying the G2655C mutation; GTP:EF-G:ribosome ratio of 100:1:1. WT + Fus, same as WT, but in the presence of 100 µM fusidic acid. M + Fus, same as M, but in the presence of 100 µM fusidic acid. In B, a diagram shows inorganic phosphate accumulation upon GTP hydrolysis by EF-G, stimulated by wild type and mutant ribosomes. The conditions are equal to those of A. Counts per minute are depicted along the y axis. The X axis values correspond to the time of the reaction in minutes. Black squares correspond to the wild type ribosomes, and black triangles correspond to the G2655C mutant ribosomes. Gray squares and triangles indicate the extent of hydrolysis by wild type and mutant ribosomes in the presence of fusidic acid. Circles correspond to the hydrolysis without the ribosomes.

 

EF-G Contacts GTPase-associated Center of Ribosomes Carrying the G2655C Mutation, whereas the Interaction with the Sarcin-Ricin Loop Is Reduced—Stimulation of the GTPase activity already presumes that EF-G binds to the mutant ribosomes. However, to demonstrate EF-G binding directly and to see whether it contacts both the SRL and the GTPase-associated center, we checked the protection by EF-G of 23 S rRNA residues from DMS modification, with and without fusidic acid.

We found that ribosomes carrying the G2655C mutation could bind EF-G (Fig. 3), although the extent of binding is reduced in comparison with the binding to wild type ribosomes. We conclude that EF-G contacts both the SRL and the GTPase-associated center of the mutant ribosomes since both A1067 (in the GTPase-associated center) and A2660 (in the SRL) were protected from DMS modification by EF-G. Notably, protection of A1067 in both the wild type and mutant ribosomes is almost the same, whereas the extent of A2660 protection varied somewhat from one experiment to another, being on average 80% for the wild type and 31% for the mutant in the case of the complex with the fusidic acid. Without the antibiotic, EF-G-related protections on both the wild type and mutant ribosomes were reduced in agreement with the literature data (14). It was not possible to compare the reactivity of nucleotide 2655 in mutant versus wild type ribosomes since only the mutant is reactive to DMS. However, it is noteworthy that, whereas G2655 of wild type ribosomes is protected by EF-G from modification with kethoxal (14), C2655 of the mutant ribosomes is not protected from DMS modification.



View larger version (81K):
[in this window]
[in a new window]
 
FIG. 3.
EF-G footprinting. An autoradiograph of 23 S rRNA sequencing and primer extension products, separated by 10% PAGE, is shown. A, probing of the GTPase-associated center. B, probing of the sarcin-ricin loop. Lanes marked with A, C, G, and U correspond to the 23 S rRNA sequence. The Unmod lane contains primer extension products of unmodified ribosomes. The –EF-G lane corresponds to ribosomes without EF-G, modified with DMS. The EF-G and EF-G + Fus lanes contain primer extension products of 23 S rRNA extracted from ribosomal complexes with EF-G in the absence or presence of fusidic acid, respectively, treated with DMS. The WT group of lanes represents footprinting of affinity-purified ribosomes carrying non-mutated G2655. The G2655C group of lanes corresponds to the affinity-purified mutant ribosomes.

 

Ribosomes Carrying the G2655C Mutation Are Defective in EF-G-driven Translocation—The most intriguing question to ask was whether EF-G could cause the translocation of tRNAs on the mutant ribosomes. To test this, we prepared a pretranslocation complex on mutant polyU-programmed ribosomes with the P-site filled by deacylated tRNAPhe and the A-site filled by AcPhe-tRNAPhe. In parallel, AcPhe-tRNAPhe was directly mixed with polyU-programmed ribosomes so as to observe its maximal level of binding to the P-site without prior incubation with deacylated tRNAPhe. The proportion of P-site-bound AcPhe-tRNAPhe was measured by the puromycin reactivity of the AcPhe moiety related to the puromycin reactivity of AcPhe-tRNAPhe bound directly to the P-site. The experiments were done according to the modified Watanabe system (21, 28) in polyamine-containing buffer. As expected, no detectable difference between G2655C and wild type ribosomes with regard to P- and A-site tRNA binding was observed. Binding of AcPhe-tRNAPhe to the P-site of polyU-programmed ribosomes was on average 98%, whereas the binding to the A-site of ribosomes carrying deacylated tRNAPhe in the P-site was 50%, both values being identical for wild type and G2655C ribosomes. Translocation, both spontaneous and EF-G-related, was measured by the puromycin reaction (Fig. 4) with and without addition of EF-G. No difference in spontaneous translocation was detected, but a clear defect (circa 3-fold difference) in EF-G-driven translocation was observed for the G2655C ribosomes. Under the same incubation conditions, a 100-fold excess of GTP is completely hydrolyzed by EF-G, stimulated by ribosomes carrying the G2655C mutation. Thus, the principal result is that the G2655C mutation moderately affects GTPase stimulation and binding of EF-G to the ribosome but significantly decreases translocation efficiency.



View larger version (33K):
[in this window]
[in a new window]
 
FIG. 4.
Puromycin reactivity of AcPhe-tRNAPhe in functional complexes of affinity-purified ribosomes. The figure shows the ratio between puromycin-reactive and total bound AcPhe-tRNAPhe. Black boxes correspond to affinity-purified ribosomes carrying the G2655C mutation. White boxes correspond to affinity-purified ribosomes carrying the affinity tag only. Complex 1, ribosomes, polyU, AcPhe-tRNAPhe; complex 2, ribosomes, polyU, tRNAPhe in the P-site, AcPhe-tRNAPhe in the A-site; complex 3, same as complex 2, after addition of EF-G and GTP.

 


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The main goal of the affinity purification method described here was to make it possible to obtain pure in vivo assembled ribosomes carrying a lethal mutation. Three aptamer structures were tested as affinity tags, introduced to the unconserved helices of the 23 S rRNA. An MS2 coat protein binding site inserted into the 23 S rRNA helices 9, 25, 45, and 98 was shown to be able to direct specific binding of the MS2 coat protein to the tagged ribosomes. Unfortunately, the attempt to bind such ribosomes to the resin via the fusion protein consisting of MS2 coat protein and IgG binding domain failed. Among the possible explanations are steric clashes among three components of the complex.

Streptomycin binding aptamer was introduced to the helix 98 of the 23 S rRNA. It was shown not to be suitable for the affinity preparation of mutant ribosomes due to the high background binding of wild type ribosomes to the immobilized dihidrostreptomycin. Such a low specificity might be explained by electrostatic binding of large ribosomal RNA to the positively charged streptomycin.

An aptamer to streptavidin inserted to the helix 25 of the 23 S rRNA performed the best as an anchor to the mutant ribosomes. It was demonstrated that the only limitation to the purity of the mutant ribosomes separated by this technique of affinity chromatography resides in ribosome-ribosome interactions. Application of the low magnesium buffer, reducing unspecific interactions between ribonucleoprotein particles, allowed us to separate tagged 50 S ribosomal subunits sufficiently pure for the biochemical analysis in vitro.

The G2655C mutation in 23 S rRNA was selected to test the method. Nucleotide G2655 is protected by both EF-G and EF-Tu from chemical modification (14). This nucleotide is not involved in extensive intraribosomal interactions (1), so its mutation would not be expected to cause any conformational changes outside the elongation factor binding site. The mutation G2655C was first described for the SRL oligonucleotide (25) and was shown to impede EF-G binding to this RNA fragment. Later, Macbeth and Wool (15) showed that expression of 23 S rRNA carrying this mutation, from highly efficient P1P2 rDNA promoters, causes cell lethality. The mutant ribosomes were shown to be no more than 3% active in protein synthesis (15). Mutations of other SRL nucleotides have defects in EF-G binding (29) and EF-Tu/AatRNA/GTP ternary complex binding (30), as well as effects on translation fidelity (31, 32). The mutations described here also affect the fidelity of translation, and they do so in opposite directions; stop codon readthrough and frameshifting are increased, whereas misreading is decreased. Both effects could be explained if one postulates a slower movement of the mutant ribosomes along an mRNA molecule. An overall decrease in translation speed would result in a wider time window for correct tRNA choice, as well as for frameshifting.

Despite the large body of experimental data, the mystery of the function of the elongation factors on the ribosome is still unsolved. One of the most intriguing questions is the coupling of GTP hydrolysis with translocation. In the classical view (33, 34), translocation takes place before GTP hydrolysis, the latter being only necessary to dissociate the factor. A more recent, but often disputed, view supports GTPase activation prior to translocation (35). Additional support for this alternative hypothesis has come from biochemical (36) and cryo-EM (37) studies but has, however, been criticized by Cameron et al. (38).

Here, we present a unique analysis of lethal mutant (G2655C) ribosomes purified by affinity chromatography, showing GTPase activity and EF-G binding accompanied by significantly inhibited translocation. The binding of EF-G to the GTPase-associated center was the same for wild type and the G2655C ribosomes; however, the contact of EF-G with SRL of the mutant ribosomes was weaker. This result could be explained in several ways. In the context of the model of Rodnina et al. (35), our results indicate that EF-G is in contact with nucleotide 2655 after the GTPase reaction but prior to translocation, as shown by the cryo-EM study (37). Thus, translocation is not necessary for GTPase activation, simply because we observe GTPase activity without translocation. However, the results obtained could also be explained in terms of the classical model, which supposed a mechanism whereby GTP hydrolysis is activated only after the translocation has taken place. Thus, it could be hypothesized that the mutation in residue 2655 allows the necessity for translocation to activate the GTPase activity to be "bypassed." In other words, the mutation could make GTPase and translocation uncoupled, in the way that it occurs with EF-G with the deleted domain IV (39). It is also possible that the G2655C mutation could impede an allosteric signal transition from the sarcin-ricin loop to the peptidyltransferase center, thus making it impossible for the CCA ends of the tRNA molecules to shift. Both explanations converge at the point that interaction between EF-G and SRL is not primarily essential for the activation of GTP hydrolysis; however, it is important for translocation. The method described for affinity chromatography of ribosomes will undoubtedly help to explore more lethal mutations, giving insight into other critical steps in the ribosomal function.


    FOOTNOTES
 
* The work was supported by Grant 55000303 from Howard Hughes Medical Institute, Russian Foundation for Basic Research (RFBR) Grant 02-04-48786, and RFBR-Deutsche Forschungsgemeinschaft Grant 02-04-04001. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

{ddagger} Both authors contributed equally to this work. Back

§ To whom correspondence should be addressed. Tel.: 7-095-9395418; Fax: 7-095-9393181; E-mail: petya{at}genebee.msu.su.

1 The abbreviations used are: EF, elongation factor; SRL, sarcin-ricin loop; DMS, dimethylsulfate; TEV, tobacco etch virus; WT, wild type. Back


    ACKNOWLEDGMENTS
 
We are very thankful to Dr. D. S. Peabody, Dr. T. Ueda, and Dr. C. Squires for providing us with strains and plasmids. We also thank especially Albert Dahlberg, Michael O'Connor, and other members of the Dahlberg laboratory not only for their strains and plasmids, but also for the inspiring discussions. We are thankful to Shura Mankin for comments on the manuscript and to Maria Rubtsova for providing help.



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Ban, N., Nissen, P., Hansen, J., Moore, P. B., and Steitz, T. A. (2000) Science 289, 905–920[Abstract/Free Full Text]
  2. Schluenzen, F., Tocilj, A., Zarivach, R., Harms, J., Gluehmann, M., Janell, D., Bashan, A., Bartels, H., Agmon, I., Franceschi, F., and Yonath, A. (2000) Cell 102, 615–623[CrossRef][Medline] [Order article via Infotrieve]
  3. Wimberly, B. T., Brodersen, D. E., Clemons, W. M., Jr., Morgan-Warren, R. J., Carter, A. P., Vonrhein, C., Hartsch, T., and Ramakrishnan, V. (2000) Nature 407, 327–339[CrossRef][Medline] [Order article via Infotrieve]
  4. Asai, T., Zaporojets, D., Squires, C., and Squires, C. L. (1999) Proc. Natl. Acad. Sci. U. S. A., 96, 1971–1976[Abstract/Free Full Text]
  5. Sergiev, P. V., Bogdanov, A. A., Dahlberg, A. E., and Dontsova, O. (2000) J. Mol. Biol. 299, 379–389[CrossRef][Medline] [Order article via Infotrieve]
  6. Vila-Sanjurjo, A., Squires, C. L., and Dahlberg, A. E. (1999) J. Mol. Biol. 293, 1–8[CrossRef][Medline] [Order article via Infotrieve]
  7. Samaha, R. R., Green, R., and Noller, H. F. (1995) Nature 377, 309–314[CrossRef][Medline] [Order article via Infotrieve]
  8. Green, R., and Noller, H. F. (1996) RNA (N. Y.) 2, 1011–1021[Abstract]
  9. Khaitovich, P., Tenson, T., Kloss, P., and Mankin, A. S. (1999) Biochemistry 38, 1780–1788[CrossRef][Medline] [Order article via Infotrieve]
  10. Green, R., and Noller, H. F. (1999) Biochemistry 38, 1772–1779[CrossRef][Medline] [Order article via Infotrieve]
  11. Peabody, D. S., and Lim, F. (1996) Nucleic Acids Res. 24, 2352–2359[Abstract/Free Full Text]
  12. Bachler, M., Schroeder, R., and von Ahsen, U. (1999) RNA (N. Y.) 5, 1509–1516[Abstract]
  13. Srisawat, C., and Engelke, D. R. (2001) RNA (N. Y.) 7, 632–641[Abstract]
  14. Moazed, D., Robertson, J. M., and Noller, H. F. (1988) Nature 334, 362–364[CrossRef][Medline] [Order article via Infotrieve]
  15. Macbeth, M. R., and Wool, I. G. (1999) J. Mol. Biol. 285, 965–975[CrossRef][Medline] [Order article via Infotrieve]
  16. Matadeen, R., Sergiev, P., Leonov, A., Pape, T., van der Sluis, E., Mueller, F., Osswald, M., von Knoblauch, K., Brimacombe, R., Bogdanov, A., van Heel, M., and Dontsova, O. (2001) J. Mol. Biol. 307, 1341–1349[CrossRef][Medline] [Order article via Infotrieve]
  17. Avdeeva, O. N., Myasnikov, A. G., Sergiev, P. V., Bogdanov, A. A., Brimacombe, R., and Dontsova, O. A. (2002) FEBS Lett. 514, 70–73[Medline] [Order article via Infotrieve]
  18. Powers, T., and Noller, H. F. (1990) Proc. Natl. Acad. Sci. U. S. A., 87, 1042–1046[Abstract/Free Full Text]
  19. O'Connor, M., and Dahlberg, A. E. (1993) Proc. Natl. Acad. Sci. U. S. A., 90, 9214–9218[Abstract/Free Full Text]
  20. O'Connor, M., Goringer, H. U., and Dahlberg, A. E. (1992) Nucleic Acids Res. 20, 4221–4227[Abstract/Free Full Text]
  21. Blaha, G., Stelzl, U., Spahn, C. M., Agrawal, R. K., Frank, J., and Nierhaus, K. H. (2000) Methods Enzymol. 317, 292–309[CrossRef][Medline] [Order article via Infotrieve]
  22. Sigmund, C. D., Ettayebi, M., Borden, A., and Morgan, E. A. (1988) Methods Enzymol. 164, 673–690[Medline] [Order article via Infotrieve]
  23. Ehrenberg, M., Bilgin, N., and Kurland, C. G. (1990) in Ribosomes am Protein Synthesis: A Practical Approach (Spedding G., ed), pp. 101–129, Oxford University Press, Oxford, UK
  24. Shimizu, Y., Inoue, A., Tomari, Y., Suzuki, T., Yokogawa, T., Nishikawa, K., and Ueda, T. (2001) Nat. Biotechnol. 19, 751–755[CrossRef][Medline] [Order article via Infotrieve]
  25. Munishkin, A., and Wool, I. G. (1997) Proc. Natl. Acad. Sci. U. S. A., 94, 12280–12284[Abstract/Free Full Text]
  26. Moine, H., and Dahlberg, A. E. (1994) J. Mol. Biol. 243, 402–412[CrossRef][Medline] [Order article via Infotrieve]
  27. Agrawal, R. K., Penczek, P., Grassucci, R. A., and Frank, J. (1998) Proc. Natl. Acad. Sci. U. S. A., 95, 6134–6138[Abstract/Free Full Text]
  28. Watanabe, S. (1972) J. Mol. Biol. 67, 443–457[CrossRef][Medline] [Order article via Infotrieve]
  29. Macbeth, M. R., and Wool, I. G. (1999) J. Mol. Biol. 285, 567–580[CrossRef][Medline] [Order article via Infotrieve]
  30. Tapprich, W. E., and Dahlberg, A. E. (1990) EMBO J., 9, 2649–2655[Medline] [Order article via Infotrieve]
  31. Bilgin, N., and Ehrenberg, M. (1994) J. Mol. Biol. 235, 813–824[CrossRef][Medline] [Order article via Infotrieve]
  32. O'Connor, M., and Dahlberg, A. E. (1996) Nucleic Acids Res. 24, 2701–2705[Abstract/Free Full Text]
  33. Glukhova, M. A., Belitsina, N. V., and Spirin, A. S. (1977) Mol. Biol. (Mosc.). 11, 1190–1200
  34. Kaziro, Y. (1978) Biochim. Biophys. Acta 505, 95–127[Medline] [Order article via Infotrieve]
  35. Rodnina, M. V., Savelsbergh, A., Katunin, V. I., and Wintermeyer, W. (1997) Nature 385, 37–41[CrossRef][Medline] [Order article via Infotrieve]
  36. Rodnina, M. V., Savelsbergh, A., Matassova, N. B., Katunin, V. I., Semenkov, Y. P., and Wintermeyer, W. (1999) Proc. Natl. Acad. Sci. U. S. A., 96, 9586–9590[Abstract/Free Full Text]
  37. Stark, H., Rodnina, M. V., Wieden, H. J., van Heel, M., and Wintermeyer, W. (2000) Cell 100, 301–309[CrossRef][Medline] [Order article via Infotrieve]
  38. Cameron, D. M., Thompson, J., March, P. E., and Dahlberg, A. E. (2002) J. Mol. Biol. 319, 27–35[CrossRef][Medline] [Order article via Infotrieve]
  39. Martemyanov, K. A., and Gudkov, A. T. (1999) FEBS Lett. 452, 155–159[CrossRef][Medline] [Order article via Infotrieve]
  40. Harms, J., Schluenzen, F., Zarivach, R., Bashan, A., Gat, S., Agmon, I., Bartels, H., Franceschi, F., and Yonath, A. (2001) Cell 107, 679–688[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
RNAHome page
M. Beringer
Modulating the activity of the peptidyl transferase center of the ribosome
RNA, May 1, 2008; 14(5): 795 - 801.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
R. Rakauskaite and J. D. Dinman
rRNA mutants in the yeast peptidyltransferase center reveal allosteric information networks and mechanisms of drug resistance
Nucleic Acids Res., March 1, 2008; 36(5): 1497 - 1507.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
P. V. Sergiev, D. V. Lesnyak, S. V. Kiparisov, D. E. Burakovsky, A. A. Leonov, A. A. Bogdanov, R. Brimacombe, and O. A. Dontsova
Function of the ribosomal E-site: a mutagenesis study
Nucleic Acids Res., October 20, 2005; 33(18): 6048 - 6056.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. V. Sergiev, D. V. Lesnyak, D. E. Burakovsky, S. V. Kiparisov, A. A. Leonov, A. A. Bogdanov, R. Brimacombe, and O. A. Dontsova
Alteration in Location of a Conserved GTPase-associated Center of the Ribosome Induced by Mutagenesis Influences the Structure of Peptidyltransferase Center and Activity of Elongation Factor G
J. Biol. Chem., September 9, 2005; 280(36): 31882 - 31889.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
O. V. Shpanchenko, M. I. Zvereva, P. V. Ivanov, E. Y. Bugaeva, A. S. Rozov, A. A. Bogdanov, M. Kalkum, L. A. Isaksson, K. H. Nierhaus, and O. A. Dontsova
Stepping Transfer Messenger RNA through the Ribosome
J. Biol. Chem., May 6, 2005; 280(18): 18368 - 18374.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
M. Dorywalska, S. C. Blanchard, R. L. Gonzalez, H. D. Kim, S. Chu, and J. D. Puglisi
Site-specific labeling of the ribosome for single-molecule spectroscopy
Nucleic Acids Res., January 12, 2005; 33(1): 182 - 189.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
M. A. Bayfield, J. Thompson, and A. E. Dahlberg
The A2453-C2499 wobble base pair in Escherichia coli 23S ribosomal RNA is responsible for pH sensitivity of the peptidyltransferase active site conformation
Nucleic Acids Res., October 12, 2004; 32(18): 5512 - 5518.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
A. E. Hesslein, V. I. Katunin, M. Beringer, A. B. Kosek, M. V. Rodnina, and S. A. Strobel
Exploration of the conserved A+C wobble pair within the ribosomal peptidyl transferase center using affinity purified mutant ribosomes
Nucleic Acids Res., July 15, 2004; 32(12): 3760 - 3770.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/28/25664    most recent
M302873200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Leonov, A. A.
Right arrow Articles by Dontsova, O. A.
Right arrow Search for Related Content
PubMed
Right arrow