JBC Origene Your Gene Company

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M301744200 on May 8, 2003

J. Biol. Chem., Vol. 278, Issue 28, 25872-25878, July 11, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/28/25872    most recent
M301744200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yang, C.-C.
Right arrow Articles by Chen, C.-S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yang, C.-C.
Right arrow Articles by Chen, C.-S.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Bcl-xL Mediates a Survival Mechanism Independent of the Phosphoinositide 3-Kinase/Akt Pathway in Prostate Cancer Cells*

Chih-Cheng Yang {ddagger} §, Ho-Pi Lin {ddagger} §, Chang-Shi Chen {ddagger}, Ya-Ting Yang {ddagger}, Ping-Hui Tseng {ddagger}, Vivek M. Rangnekar ¶ and Ching-Shih Chen {ddagger} ||

From the {ddagger}Division of Medicinal Chemistry and Pharmacognosy, College of Pharmacy, The Ohio State University, Columbus, Ohio 43210 and the Department of Radiation Medicine, University of Kentucky, Lexington, Kentucky 40536

Received for publication, February 19, 2003 , and in revised form, May 6, 2003.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Among various molecular strategies by which prostate cancer cells evade apoptosis, phosphoinositide 3-kinase (PI3K)/Akt signaling represents a dominant survival pathway. However, different prostate cancer cell lines such as LNCaP and PC-3 display differential sensitivity to the apoptotic effect of PI3K inhibition in serum-free media, reflecting the heterogeneous nature of prostate cancer in apoptosis regulation. Whereas both cell lines are equally susceptible to LY294002-mediated Akt dephosphorylation, only LNCaP cells default to apoptosis, as evidenced by DNA fragmentation and cytochrome c release. In PC-3 cells, Akt deactivation does not lead to cytochrome c release, suggesting that the intermediary signaling pathway is short-circuited by an antiapoptotic factor. This study presents evidence that Bcl-xL overexpression provides a distinct survival mechanism that protects PC-3 cells from apoptotic signals emanating from PI3K inhibition. First, the Bcl-xL/BAD ratio in PC-3 cells is at least an order of magnitude greater than that of LNCaP cells. Second, ectopic expression of Bcl-xL protects LNCaP cells against LY294002-induced apoptosis. Third, antisense down-regulation of Bcl-xL sensitizes PC-3 cells to the apoptotic effect of LY294002. The physiological relevance of this Bcl-xL-mediated survival mechanism is further underscored by the protective effect of serum on LY294002-induced cell death in LNCaP cells, which is correlated with a multifold increase in Bcl-xL expression. In contrast to Bcl-xL, Bcl-2 expression levels are similar in both cells lines, and do not respond to serum stimulation, suggesting that Bcl-2 may not play a physiological role in antagonizing apoptosis signals pertinent to BAD activation in prostate cancer cells.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The key role of the phosphoinositide 3-kinase (PI3K)1/Akt signaling cascade in promoting cell survival downstream of a plethora of trophic signals has been well characterized (15). Activation of PI3K leads to an increase in its lipid products, phosphatidylinositol 3,4,5-trisphosphate and phosphatidylinositol 3,4-bisphosphate, in plasma membranes. These lipid second messengers facilitate the membrane co-localization of Akt with phosphoinositide-dependent kinases, leading to Akt phosphorylation and activation (6). Activated Akt, in turn, mediates antiapoptotic signaling through the phosphorylating inactivation of a multitude of downstream targets involved in apoptosis regulation, including the two key regulators of the cell death machinery BAD and procaspase 9 (4). The paradigm of this PI3K/Akt signaling cascade provides a framework to account for the ability of extracellular growth factors to promote cell survival (15). However, in nearly 50% of prostate tumors, this PI3K/Akt survival pathway is constitutively up-regulated because of mutations of the tumor suppressor PTEN (710) that functions as a negative regulator of PI3K through its lipid phosphatase activity (1113). Evidence suggests that dysregulation of the PI3K/Akt signaling cascade furnishes a mechanism whereby prostate tumor cells withstand the withdrawal of exogenous survival factors (14, 15) or androgen (16). Such a resistant phenotype is manifest in two widely used prostate cancer cell lines, androgen-dependent LNCaP and androgen-independent PC-3, both of which display enhanced Akt activation because of loss of PTEN function (11, 12). Whereas most eukaryotic cells will undergo apoptosis when deprived of exogenous trophic factors (17, 18), LNCaP and PC-3 cells survive serum deprivation for an extended period of time (19).

However, despite its up-regulated status, the degree of dependence on the PI3K/Akt pathway for evading apoptosis signals varies between these two cell lines. In serum-free media, LNCaP cells default to apoptosis when exposed to LY294002, a PI3K-specific inhibitor (14, 15). In contrast, PC-3 cells are resistant to LY294002-induced apoptosis. This dichotomy underscores the existence of a PI3K-independent survival mechanism in PC-3 cells that could counteract apoptosis signals generated by PI3K inhibition. Because LY294002 mediates apoptosis via a cytochrome c-dependent pathway in LNCaP cells (15), we hypothesized that PC-3 cells withstood PI3K/Akt inactivation by short-circuiting the downstream pathway leading to cytochrome c release. Accordingly, we turned our attention to the proapoptotic Bcl-2 family member BAD, a key downstream effector of Akt (5), and related Bcl-2 family members. It has been demonstrated that in the absence of activated Akt, BAD forms heterodimers with Bcl-xL, an antiapoptotic protein that prevents the release of cytochrome c from mitochondria (2022). This complex formation abrogates the antiapoptotic function of Bcl-xL (23, 24), thereby facilitating apoptotic death via a cytochrome c-dependent pathway. Conversely, when Akt is activated, BAD becomes phosphorylated and translocated into the cytoplasm through binding with the phosphoserine-binding protein 14-3-3 (25, 26). The sequestration of BAD from mitochondria frees Bcl-xL to facilitate antiapoptotic signaling. As a consequence, the dynamic interaction between Bcl-xL and BAD represents a critical determinant of cell fate downstream of the PI3K/Akt cascade, and may represent an alternative mechanism for cancer cells to evade apoptosis. In this paper, we demonstrate that Bcl-xL overexpression underlies the molecular basis for resistance to the induction of apoptosis by LY294002 in prostate cancer cells. Moreover, our data indicate that serum protects LNCaP cells from LY294002-induced apoptosis, in part, by up-regulating the expression of Bcl-xL.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell Culture—To assess the effect of Bcl-xL expression levels on the sensitivity to the apoptotic effect of LY294002, androgen-responsive LNCaP (p53+/+) and androgen-nonresponsive PC-3 (p53/) human prostate cancer cells were tested. Prostate cancer cells were cultured in RPMI 1640 medium supplemented with 10% heat-inactivated fetal bovine serum (FBS). For individual experiments, 2.5 x 106 PC-3 cells and 5 x 106 LNCaP cells were grown in 10% FBS-supplemented RPMI 1640 medium in T-75 flasks for 1 and 2 days, respectively, followed by LY294002 treatment in serum-free RPMI medium.

Cell Viability Assay—The effect of LY294002 on cell viability was assessed by the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide)) assay in 96-well, flat-bottomed plates, in which 8,000 PC-3 or 10,000 LNCaP cells/well were added to triplicate wells. Cells were exposed to 25 µM LY294002 or Me2SO vehicle in serum-free RPMI 1640 medium at 37 °C in 5% CO2 for the indicated time. The medium was removed and replaced by 200 µl of 0.5 mg/ml MTT in RPMI 1640 medium, and cells were incubated in the CO2 incubator at 37 °C for 2 h. Supernatants were removed from the wells, and the reduced MTT dye was solubilized with 200 µl/well of Me2SO. Absorbance was determined on a plate reader at 570 nm.

Preparation of Bcl-xL-overexpressing LNCaP Transfectants—The pSFFV-Neo/Bcl-xL-FLAG expression plasmid containing the human Bcl-xL cDNA subcloned upstream of the constitutive splenic focus forming virus (SFFV) promoter was kindly provided by Gabriel Nunez (University of Michigan, Ann Arbor, MI). LNCaP cells were cultured in 10% FBS-supplemented RPMI 1640 medium in T-25 flasks. At 50% confluence, each flask was washed twice with 4 ml of serum-free Opti-MEM (Invitrogen), and then added 1.6 ml of Opti-MEM. Meanwhile, the Bcl-xL expression construct (0.1 µg) in 350 µl of Opti-MEM was preincubated with 3 µl of the Plus reagent from the LipofectAMINE Plus reagent kit (Invitrogen) at room temperature for 15 min, and 6 µl of the LipofectAMINE reagent in 150 µl of Opti-MEM was added to the mixture. The resulting mixture was incubated at room temperature for 15 min, and added to each flask with gentle mixing. After 5 h at 37 °C, the transfection medium was replaced with 5 ml of 10% FBS-supplemented RPMI 1640 medium. After 48 h, the transfected cells were transferred into 96-well plates with a density of ~10,000 cells per well, and cultured in the same medium containing 300 µg/ml G418 (Calbiochem, La Jolla, CA). The G418-containing medium was changed every 4 days. At 80% confluence, they were subcloned into 24-well plates, and grown in the presence of G418. The subcloning procedure was repeated at 80% confluence with 12-well plates, followed by T-25 flasks, from which three independent clones (B1, B3, and B11) expressing differential basal levels of Bcl-xL-FLAG were selected.

Antisense Experiments—To attenuate Bcl-xL expression in PC-3 cells, we obtained an antisense 2'-O-methyl phosphorothioate "gapmer" (27) from Integrated DNA Technologies (Coralville, IA), CT*G*CGAt*c*cgac*t*cAC*C*A*A*T, where bases with 2'-O-methyl-modified sugar moieties are given in capital letters, C5-methyl-modified cytosine is represented by small c, and * stands for a phosphorothioate internucleotide bond. PC-3 cells were transfected with this antisense oligonucleotide with the OligofectAMINE reagent (Invitrogen). A 250 µM stock solution of the antisense oligonucleotide was prepared in distilled water. Varying amounts of the antisense stock solution, diluted in a final volume of 350 µl with Opti-MEM, was mixed with a solution containing 6 µl of the OligofectAMINE and 34 µl of Opti-MEM, and incubated at room temperature for 20 min. The combined mixture was added to a T-25 flask, in which 8 x 105 PC-3 cells were cultured in 1.6 ml of Opti-MEM. After incubating the cells at 37 °C for 5 h, an equal volume of Opti-MEM medium supplemented with 20% FBS was added to the flask without removing the transfection medium. The transfected cells were incubated with the medium for another 2 days before LY294002 treatment.

Apoptosis Detection by an Enzyme-linked Immunosorbent Assay (ELISA)—Induction of apoptosis was assessed by using a Cell Death ELISA (Roche Diagnostics) by following the manufacturer's instruction. This test is based on the quantitative determination of cytoplasmic histone-associated DNA fragments in the form of mononucleosomes and oligonucleosomes after induced apoptotic death. In brief, 8 x 105 PC-3 cells or 1.6 x 106 LNCaP cells were cultured in a T-25 flask 24 h prior to the experiment. Cells were washed twice in 5 ml of serum-free RPMI 1640 medium, and treated with LY294002 or the Me2SO vehicle, as indicated. Both floating and adherent cells were collected, cell lysates equivalent to 5 x 105 cells were used in the ELISA.

Western Blot Analysis of Cytochrome c Release into the Cytoplasm— Cytosolic-specific, mitochondria-free lysates were prepared according to a reported procedure (28). After individual treatments, both the incubation medium and adherent cells in T-75 flasks were collected, and centrifuged at 600 x g for 5 min. The pellet fraction was recovered, placed on ice, and triturated with 300 µl of a chilled hypotonic lysis solution (220 mM mannitol, 68 mM sucrose, 50 mM PIPES-KOH (pH 7.4), 50 mM KCl, 5 mM EDTA, 2 mM MgCl2, 1 mM dithiothreitol, and a mixture of protease inhibitors consisting of 100 µM 4-(2-aminoethyl)-benzenesulfonyl fluoride, 80 nM aprotinin, 5 µM bestatin, 1.5 µM E-64 protease inhibitor, 2 µM leupeptin, and 1 µM pepstatin A). After a 45-min incubation on ice, the mixture was centrifuge at 600 x g for 10 min. The supernatant was collected in a microcentrifuge tube and centrifuged at 14,000 rpm for 30 min. An equivalent amount of protein (50 µg) from each supernatant was resolved in a 10% SDS-polyacrylamide gel. Bands were transferred to nitrocellulose membranes, and analyzed by immunoblotting with anti-cytochrome c antibodies, as described below.

Immunoblotting—The sample preparation procedure for Akt analysis differed from that of other cellular proteins, which are elaborated as follows. For Akt sample preparation, cells in T-75 flasks were collected by scrapping, and suspended in 60 µl of phosphate-buffered saline. Two µl of the suspension was taken for protein analysis using the Bradford assay kit (Bio-Rad). To the remaining solution was added the same volume of 2x SDS-PAGE sample loading buffer (100 mM Tris-HCl, pH 6.8, 4% SDS, 5% {beta}-mercaptoethanol, 20% glycerol, and 0.1% bromphenol blue). The mixture was sonicated briefly, and boiled for 5 min. Equal amounts of proteins were loaded onto 10% SDS-PAGE gels. For other cellular proteins except cytochrome c, cells were lysed in RIPA buffer consisting of 50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS, and a mixture of protease inhibitor (100 µM 4-(2-aminoethyl)benzenesulfonyl fluoride, 80 nM aprotinin, 5 µM bestatin, 1.5 µM E-64 protease inhibitor, 2 µM leupeptin, 1 µM pepstatin A). After a brief centrifugation, equal amounts of proteins were loaded on 10–12% SDS-PAGE gels.

After electrophoresis, protein bands were transferred to nitrocellulose membranes in a semidry transfer cell. The transblotted membrane was washed twice with Tris-buffered saline (TBS) containing 0.1% Tween 20 (TBST). After blocking with TBST containing 5% nonfat milk for 40 min, the membrane was incubated with the appropriate primary antibody in TBST, 1% nonfat milk at 4 °C overnight. All primary antibodies were diluted 1:1000 in 1% nonfat milk-containing TBST. Rabbit anti-Bcl-xL, anti-phospho-Akt, anti-Akt, and anti-phospho-Ser136-BAD polyclonal antibodies were purchased from Cell Signaling Technology Inc. (Beverly, MA). Rabbit anti-BAD, and mouse anti-Bcl-2 were obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Mouse monoclonal anti-cytochrome c was from BD Pharmingen. Mouse monoclonal anti-actin was from ICN Biomedicals Inc. (Costa Mesa, CA). Goat anti-rabbit and goat anti-mouse IgG-horseradish peroxidase conjugates were from Jackson ImmunoResearch Laboratories (West Grove, PA). After treatment with the primary antibody, the membrane was washed three times with TBST for a total of 15 min, followed by goat anti-rabbit or anti-mouse IgG-horseradish peroxidase conjugates (diluted 1:5000) for 1 h at room temperature and washed three times with TBST for a total of 1 h. The immunoblots were visualized by enhanced chemiluminescence.

Effect of Serum on LY294002-induced Apoptosis in LNCaP Cells— LNCaP cells (2.5 x 106) were cultured in 10% FBS-supplemented RPMI 1640 medium in T-75 flasks for 2 days, washed with PBS twice, and cultured in serum-free RPMI 1640 medium for 1 day. These cells were exposed to 10% FBS-supplemented RPMI 1640 medium with or without LY294002 (25 µM). The treated cells were collected at different time intervals for apoptosis and Western blot analyzes.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
LNCaP and PC-3 Cells Display Differential Susceptibility to PI3K Inhibition-induced Apoptosis—The role of PI3K as a dominant mediator of survival in LNCaP cells has been well documented (14, 15). Exposure of LNCaP cells to its specific inhibitor LY294002 (25 µM) in serum-free medium resulted in rapid and complete loss of phospho-Akt. Western blot analysis indicates that Akt was completely dephosphorylated within 1 h of drug treatment, whereas the level of phospho-Akt remained unchanged in Me2SO vehicle-treated cells throughout the course of study (Fig. 1A). These data confirm the obligatory role of PI3K lipid products in maintaining the active status of Akt. This Akt deactivation was accompanied by apoptotic cell death, as characterized by morphological changes, cell viability, DNA fragmentation, and cytochrome c release from mitochondria (Fig. 1, B–E).



View larger version (48K):
[in this window]
[in a new window]
 
FIG. 1.
LY294002-induced Akt dephosphorylation leads to apoptosis in LNCaP cells by facilitating cytochrome c release from mitochondria. A, a time-dependent effect of LY294002 (25 µM) on the phosphorylation state of Akt. LNCaP cells were treated with Me2SO vehicle (left panel)or25 µM LY294002 (right panel) in serum-free RPMI 1640 medium for the indicated times and lysed, and the supernatants were electrophoresed and probed by Western blot with rabbit anti-Akt and anti-P-Ser473 Akt antibodies. A precipitous decrease in phospho-Akt was noted in drug-treated cells. No appreciable change was noted in the control in either Akt or phospho-Akt levels throughout the 24-h period. B, morphology of LNCaP cells treated with Me2SO vehicle (left panel) or 25 µM LY294002 (right panel) in serum-free RPMI 1640 medium for 24 h. Light microscopic examination indicated that LY294002-treated cells underwent pronounced morphological changes. The cells became shrunken, round, and detached from the flask. C, growth inhibitory effect of LY-294002 (25 µM) on LNCaP cells. LNCaP cells (10,000 cells/well) were exposed to 25 µM LY294002 (close circle)or Me2SO vehicle (open circle) for the indicated times. Viable cells were examined by the MTT assay. Data are the mean ± S.D. (n = 6). D, time course of the formation of nucleosomal DNA in LNCaP cells treated with Me2SO (open bars) or 25 µM LY294002 (gray bars). The formation of nucleosomes was quantitatively measured by Cell Death Detection ELISA with lysates equivalent to 5 x 105 cells for each assay. Data are the mean ± S.D. (n = 3). E, a time-dependent effect of LY294002 on cytochrome c release in LNCaP cells. LNCaP cells were treated with Me2SO vehicle (–) or 25 µM LY294002 (+) at the indicated time points. Cytosolic-specific, mitochondria-free lysates were prepared. An equivalent amount of protein (50 µg) from individual lysates was electrophoresed, and probed by Western blot with anti-cytochrome c antibodies.

 

In PC-3 cells, the effect of LY294002 on phospho-Akt was similar to that observed in LNCaP cells (Fig. 2A), i.e. Akt underwent rapid dephosphorylation in response to the treatment with LY294002 (25 µM). However, these cells did not default to apoptosis as no apparent changes in cell morphology, cell viability, or nucleosomal integrity were noted (Fig. 2, B–D). In line with our hypothesis, this apoptosis resistance was correlated with the lack of cytochrome c release from mitochondria (Fig. 2E).



View larger version (46K):
[in this window]
[in a new window]
 
FIG. 2.
PC-3 cells are susceptible to LY294002-induced Akt dephosphorylation, but resist the induction of apoptosis by preventing cytochrome c release. The experimental conditions were identical to that described in the legend to Fig. 1, except that PC-3 cells were used. A, a time-dependent effect of LY294002 (25 µM) on the phosphorylation state of Akt. Exposure of PC-3 cells to LY294002 led to a rapid disappearance of phospho-Akt in a manner similar to that in LNCaP cells. B, morphology of PC-3 cells treated with Me2SO vehicle (left panel) or 25 µM LY294002 (right panel) in serum-free RPMI 1640 medium for 24 h. C, time-dependent effect of LY294002 (25 µM) on the viability of PC-3 cells. PC-3 cells (8,000 cells/well) were exposed to 25 µM LY294002 (closed circle) or Me2SO vehicle (open circle) for the indicated times. Viable cells were examined by the MTT assay. Data are the mean ± S.D. (n = 3). D, time course of the formation of nucleosomal DNA in PC-3 cells treated with Me2SO (open bars) or 25 µM LY294002 (gray bars). Data are the mean ± S.D. (n = 6). E, a time-dependent effect of LY294002 on cytochrome c release in PC-3 cells.

 

This discrepancy in cellular response to LY294002 underscores differences in the regulation of apoptosis between LNCaP and PC-3 cells, and suggests the existence of a survival mechanism that is independent of PI3K/Akt signaling in PC-3 cells. As Akt deactivation in PC-3 cells did not lead to cytochrome c release, we turned our attention to BAD, a central regulator connecting Akt with the Bcl-2 family for the maintenance of mitochondrial integrity (24). Evidence indicates that BAD becomes dephosphorylated consequent to Akt inactivation, and that this change in the phosphorylation status facilitates the targeting of BAD to mitochondria membranes where dephosphorylated BAD binds to and inactivate Bcl-xL. This causal relationship between Akt inactivation and the dephosphorylation and mitochondrial translocation of BAD in LY294002-treated LNCaP and PC-3 cells is demonstrated in Fig. 3. As shown, Western blot analysis indicates that exposure to the PI3K inhibitor led to a decrease in phospho-Ser136-BAD in cell lysates while there was no effect on the expression level of BAD (top panels). Mitochondrial targeting is demonstrated by a decrease in total levels of BAD protein in the cytoplasm accompanied by a concurrent increase in mitochondria in both cell lines (middle and bottom panels). Together, these findings suggest that PC-3 cells were able to evade PI3K/Akt inhibition-mediated apoptosis by short circuiting the intermediary signaling between the BAD activation and cytochrome c release via a yet unresolved mechanism.



View larger version (47K):
[in this window]
[in a new window]
 
FIG. 3.
LY294002 treatment facilitates the dephosphorylation and targeting of BAD to mitochondria in LNCaP and PC-3 cells. Cells were treated with Me2SO vehicle (–) or 25 µM LY294002 (+) in serum-free RPMI 1640 medium for 12 h, and lysed. The top panels show the decrease in phosph-Ser136-BAD in cell lysates in response to LY294002 treatment, whereas there was no effect on the expression level of BAD. The middle and bottom panels illustrate the mitochondrial targeting of BAD. The cytoplasmic and mitochondrial fractions were isolated, electrophoresed, and probed by Western blot with rabbit anti-BAD antibodies. Actin and cytochrome c oxidase were used as internal reference proteins for the cytoplasm and mitochondria, respectively.

 

Bcl-xL Overexpression and Apoptosis Resistance in PC-3 Cells—To shed light onto the mechanistic basis underlying this differential response to BAD activation, we examined the expression of BAD, Bcl-xL, and a related Bcl-2 family member, Bcl-2, in LNCaP and PC-3 cells. Western blot analysis indicates that these two cell lines displayed a distinct difference in Bcl-xL expression levels, whereas those of BAD were virtually identical between them (Fig. 4A). As a consequence, the ratio of Bcl-xL to BAD in PC-3 cells was at least an order of magnitude higher than that in LNCaP cells, which is consistent with the finding reported in the literature (29). In contrast, the expression level of Bcl-2 was moderately lower in PC-3 cells than in LNCaP cells, excluding the involvement of Bcl-2 in the resistance to LY294002-induced cell death in PC-3 cells. In view of the antiapoptotic effect of Bcl-xL, we hypothesized that Bcl-xL overexpression in PC-3 cells conferred protection against apoptotic signals generated from PI3K inhibition. Accordingly, we assessed the effect of enforced Bcl-xL expression in LNCaP cells on LY294002-induced apoptosis.



View larger version (36K):
[in this window]
[in a new window]
 
FIG. 4.
A, comparison between the basal expression levels of Bcl-xL, Bcl-2, and BAD with PC-3 and LNCaP cells by Western blot analysis. B, ascending expression levels of ectopic Bcl-xL in B11, B1, and B3 clones. The band for ectopic Bcl-xL contained a FLAG tag (8 amino acids long) from the construct, thus migrating slower than endogenous Bcl-xL.

 

Ectopic Bcl-xL Expression Protects LNCaP Cells from LY-294002-induced Apoptosis—LNCaP cells were transfected with the G418-selectable Bcl-xL expression construct pSFFV-Neo/Bcl-xL-FLAG. Three transfected clones (B11, B1, and B3), which displayed ascending expression levels of ectopic Bcl-xL protein (Fig. 4B), were isolated for testing. The expression levels of ectopic Bcl-xL in B11, B1, and B3 were ~20, 150, and 500%, respectively, of that of the endogenous counterpart in PC-3 cells. Among these three clones, B3 cells displayed decreased endogenous Bcl-2 expression, whereas that in the other two clones remained relatively unaltered in comparison to untransfected LNCaP cells. These three transfected Bcl-xL clones were used to examine the impact of the Bcl-xL expression level on susceptibility to LY294002-induced apoptosis vis à vis parental LNCaP cells.

Fig. 5A depicts a dose-dependent protective effect of ectopic Bcl-xL on LY294002-mediated cell death at 12 (left panel) and 24 h (right panel). The extent of cytoprotection correlated with the Bcl-xL expression level among the three Bcl-xL clones. In line with the data obtained with PC-3 cells, this differential resistance was attributable to the ability of Bcl-xL to suppress cytochrome c release into the cytoplasm (Fig. 5B). As demonstrated in B3 cells, the high level of ectopic Bcl-xL expression completely blocked the release of cytochrome c following LY294002 treatment, thereby rendering the antiapoptotic phenotype.



View larger version (29K):
[in this window]
[in a new window]
 
FIG. 5.
Ectopic Bcl-xL protects LNCaP cells from LY294002-induced apoptosis by attenuating cytochrome c release in an expression level-dependent manner. A, formation of nucleosomal DNA in LNCaP (LN) cells and B11, B1, and B3 clones treated with Me2SO (open bars) or 25 µM LY294002 (gray bars) at 12 (left panel) and 24 h (right panel). The formation of nucleosomes was quantitatively measured by Cell Death Detection ELISA with lysates equivalent to 5 x 105 cells for each assay. Data are the mean ± S.D. (n = 3). B, effect of LY294002 on cytochrome c release in LNCaP cells and the three Bcl-xL overexpressing clones at 24 h. Cells were treated with Me2SO vehicle (–) or 25 µM LY294002 (+) for 24 h. Cytosolic-specific, mitochondria-free lysates were prepared. An equivalent amount of protein (50 µg) from individual lysates was electrophoresed, and probed by Western blot with anti-cytochrome c antibodies.

 

As part of the control, because PC-3 cells differ from LNCaP cells in functional p53 functional status, (p53/ versus p53+/+, respectively), we also examined the effect of p53 overexpression in PC-3 cells on LY294002-induced apoptosis. However, p53-overexpressing PC-3 cells were equally resistant to LY294002 as the parent cells (data not shown), excluding the possible involvement of p53 in sensitizing prostate cancer cells to PI3K inhibition-induced apoptosis.

Antisense Down-regulation of Bcl-xL Reduces the Threshold of LY294002-mediated Apoptosis in PC-3 Cells—We further investigated the effect of Bcl-xL on cellular sensitivity to LY294003 by using an antisense oligonucleotide strategy to down-regulate Bcl-xL in PC-3 cells. A phosphothioate oligonucleotide (27) was used to attenuate the expression of Bcl-xL protein in PC-3 cells with an oligonucleotide with a mismatched sequence (CGACACGTACCTCTCGCATT) (29) as control. As shown in Fig. 6A, this antisense oligonucleotide decreased the level of Bcl-xL expression in a dose-dependent manner, whereas no significant change was noted with the mismatched oligonucleotide at 1 µM. At high doses (≥2 µM), this antisense oligonucleotide was cytotoxic, possibly as a result of Bcl-xL ablation. Nevertheless, at 1 µM, it could reduce the Bcl-xL expression to a level comparable with that of LNCaP cells without causing significant cell death.



View larger version (34K):
[in this window]
[in a new window]
 
FIG. 6.
Antisense down-regulation of Bcl-xL sensitizes PC-3 cells to LY-294002-induced apoptosis by facilitating cytochrome c release. A, treatment of PC-3 cells with different concentrations of the antisense oligonucleotide caused dose-dependent down-regulation of Bcl-xL protein. No change in Bcl-xL expression was noted with the mismatch oligonucleotide at 1 µM. B, reduced Bcl-xL expression by the antisense oligonucleotide enhanced the susceptibility of PC-3 cells to the induction of apoptosis, whereas the mismatch oligonucleotide has no effect on the cell death. C, effect of the mismatch and antisense oligonucleotides on LY294002-induced cytochrome c release in PC-3 cells at 2 and/or 4 h. Oligonucleotide-treated PC-3 cells were treated with Me2SO vehicle (–) or 25 µM LY294002 (+) for 24 h. Cytosolic-specific, mitochondria-free lysates were prepared. An equivalent amount of protein (50 µg) from individual lysates was electrophoresed, and probed by Western blot with anti-cytochrome c antibodies.

 

Treatment with this noncytotoxic level of antisense oligonucleotide increased the chemosensitivity of PC-3 cells to LY294002, which induced DNA fragmentation within 2 h of treatment, whereas PC-3 cells treated with the mismatch oligonucleotide (1 µM) remained unaffected by PI3K inhibition (Fig. 6B). This discrepancy in response to LY294002 was correlated with the respective abilities to maintain the mitochondrial integrity (Fig. 6C). As shown, exposure of PC-3 cells transfected with the antisense oligonucleotide to LY294002 led to increased cytochrome c release, whereas no increase in cytosolic cytochrome c was observed with the mismatch oligonucleotide-treated cells.

Together, these data suggest that basal Bcl-xL expression underlies the discrepancy between LNCaP and PC-3 cells in the sensitivity to the apoptotic effect of PI3K inhibition. Conceivably, PI3K/Akt signaling and Bcl-xL represent two distinct mechanisms at different cellular levels that cancer cells use to enhance apoptosis threshold in the face of growth factor stimulation. The relative roles of these two mechanisms in cytoprotection, however, remained unclear when both pathways were stimulated. To address this issue, we examined the protective effect of serum on LY294002-induced apoptosis in LNCaP cells, of which the mechanism has yet been resolved (15).

The Protective Effect of Serum on LY294002-mediated Apoptosis Is Correlated with Increased Bcl-xL Expression—To assess the effect of serum, LNCaP cells were exposed to serum-deprived RPMI 1640 medium for 24 h before supplementing the medium with 10% FBS. The extent of apoptotic cell death induced by LY294002 in the presence of 10% FBS was significantly less than that without serum at 12 and 24 h (p < 0.05) (Fig. 7A), which is in line with the data previously reported (15). Western blot analysis indicates that exposure to serum induces a multifold increase in both Akt phosphorylation and Bcl-xL expression in comparison to basal levels (Fig. 7B). Bcl-2 expression levels, however, did not respond to serum stimulation, and remained relatively unaltered throughout the course of this investigation. Exposure of LNCaP cells to LY294002 in 10% FBS-supplemented medium led to rapid dephosphorylation of Akt in a manner similar to that in the absence of serum. Meanwhile, Bcl-xL expression levels remained up-regulated under the same conditions, suggesting its role in the effect of serum on apoptosis resistance.



View larger version (44K):
[in this window]
[in a new window]
 
FIG. 7.
Protective effect of serum on LY294002-induced apoptosis in LNCaP cells. A, formation of nucleosomal DNA in LNCaP cells treated with 25 µM LY294002 in RPMI 1640 medium containing no serum or with 10% FBS at 12 (left panel) and 24 h (right panel). The formation of nucleosomes was quantitatively measured by Cell Death Detection ELISA with lysates equivalent to 5 x 105 cells for each assay. Data are the mean ± S.D. (n = 3). B, time-dependent effect of serum on the levels of phospho-Akt, Akt, Bcl-xL, and Bcl-2 in LNCaP cells without (left panel) or with (right panel) LY294002 (25 µM) treatment.

 


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Prostate tumor cells acquire multiple molecular strategies to evade apoptosis in the course of progression to advanced states (19). Among various survival tactics utilized by prostate cancer cells, the up-regulation of PI3K/Akt signaling through PTEN mutation or constitutive activation of growth factor receptors is especially noteworthy (11, 12). By elevating the level of Akt activation, cancer cells are able to raise the apoptosis threshold in response to trophic factor withdrawal or cytokine exposure. Consequently, targeting the survival pathway mediated by PI3K/Akt signaling is widely considered a viable approach for prostate cancer therapy. Nevertheless, different prostate tumor cell lines display differential susceptibility to the apoptotic effect of PI3K inhibition, reflecting the heterogeneous nature of prostate cancer in apoptosis regulation. Our study indicates that PC-3 and LNCaP cells were equally susceptible to LY294002-mediated dephosphorylation of Akt, but differed in the consequent effect on cytochrome c release from mitochondria. These data suggest that the effect of Akt inactivation on cytochrome c release through BAD activation was abrogated by an anti-apoptotic mechanism at the mitochondrial level in PC-3 cells. Because the Bcl-2 family provides a crucial link between the Akt activity and the status of mitochondrial integrity (24), we investigated the involvement of BAD and its closely related Bcl-2 members Bcl-xL and Bcl-2.

The present study presents several lines of evidence that Bcl-xL overexpression provides a distinctive survival mechanism that protects PC-3 cells from apoptosis signals emanating from PI3K inhibition. First, the Bcl-xL to BAD ratio in PC-3 cells was at least an order of magnitude greater than that of LNCaP cells. Second, ectopic expression of Bcl-xL protected LNCaP cells against LY294002-induced apoptotic death in an expression level-dependent manner. Third, antisense down-regulation of Bcl-xL sensitized PC-3 cells to the apoptotic effect of LY294002. Fourth, the physiological relevance of this Bcl-xL-mediated survival mechanism was further underscored by the protective effect of serum on LY294002-induced cell death in LNCaP cells. In the literature, Bcl-xL overexpression has also been identified as a major mediator in the resistance of PC-3 cells against apoptosis induced by the PKC inhibitor staurosporine (29). Conceivably, BAD activation represents the convergence point for apoptotic signals generated by the inhibition of PI3K and PKC. Higher levels of Bcl-xL expression in PC-3 cells are able to antagonize the proapoptotic effect of BAD, thereby conferring resistance to these apoptosis-inducing agents. Moreover, it has been reported that increased Bcl-xL expression could desensitize LNCaP and PC-3 cells to various cytotoxic agents such as paclitaxel, vinblastine, etoposide, and carboplastin (27). These data further highlight the important role of Bcl-xL expression in modulating the apoptosis threshold to either molecularly targeted or cytotoxic therapeutic agents.

Another crucial issue that warrants discussion is the physiological role of Bcl-2 vis à vis Bcl-xL in the cytoprotection against BAD activation because these two antiapoptotic proteins mediate a similar function in maintaining mitochondrial integrity. In addition, enforced expression of Bcl-2 has been reported to protect LNCaP cells against apoptosis induction by C2-ceramide or androgen depletion (30, 31). The present study, however, refutes the involvement of basal Bcl-2 expression in the protection of PC-3 or serum-treated LNCaP cells against LY294002-mediated apoptosis. Similar findings have also been reported with regard to the role of Bcl-2 in chemoresistance to various apoptosis-inducing agents in PC-3 cells (27).

This novel survival pathway bears biochemical relevance to cancer therapy. Recent advances in the understanding of signal transduction in cancer cells have led to the development of therapeutic agents targeting growth factor receptor tyrosine kinases (32, 33), some of which involve PI3K/Akt signaling as a downstream effector. Levels of Bcl-xL expression may affect the efficacy of these tyrosine kinase inhibitors in prostate cancer cells. Moreover, inhibition of PI3K/Akt signaling has been reported to sensitize cancer cells to apoptosis induced by cytotoxic agents such as doxorubicin and paclitaxel (3436), or cytokines (37). Conceivably, the sensitizing effect of PI3K/Akt inhibition to apoptotic signals may be antagonized by enhanced Bcl-xL expression in advanced prostate cancer cells. Finally, as demonstrated by the mechanism of serum-induced protection against LY294002-induced apoptosis, modulation of the expression level of Bcl-xL may represent an important strategy to optimize the efficacy of chemotherapeutic agents, which is currently under investigation in this laboratory.


    FOOTNOTES
 
* This work was supported by National Institutes of Health Grants CA94829 and GM53448 (to C.-S. C.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

§ Both authors contributed equally to this paper. Back

|| To whom correspondence should be addressed: Parks Hall, Rm. 336, The Ohio State University, 500 West 12th Ave., Columbus, OH 43210-1291. Tel.: 614-688-4008; Fax: 614-688-8556; E-mail: chen.844{at}osu.edu.

1 The abbreviations used are: PI3K, phosphoinositide 3-kinase; FBS, fetal bovine serum; SFFV, splenic focus-forming virus; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; ELISA, enzyme-linked immunosorbent assay; PIPES, 1,4-piperazinediethanesulfonic acid; TBST, Tris-buffered saline with 0.1% Tween 20. Back


    ACKNOWLEDGMENTS
 
We thank Dr. Gabriel Nunez (University of Michigan, Ann Arbor, MI) for providing the pSFFV-Neo/Bcl-XL-FLAG expression construct.



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Fruman, D. A., Meyers, R. E., and Cantley, L. C. (1998) Annu. Rev. Biochem. 67, 481–507[CrossRef][Medline] [Order article via Infotrieve]
  2. Chan, T. O., Rittenhouse, S. E., and Tsichlis, P. N. (1999) Annu. Rev. Biochem. 68, 965–1014[CrossRef][Medline] [Order article via Infotrieve]
  3. Vanhaesebroeck, B., Leevers, S. J., Ahmadi, K., Timms, J., Katso, R., Driscoll, P. C., Woscholski, R., Parker, P. J., and Waterfield, M. D. (2001) Annu. Rev. Biochem. 70, 535–602[CrossRef][Medline] [Order article via Infotrieve]
  4. Datta, S. R., Brunet, A., and Greenberg, M. E. (1999) Genes Dev. 13, 2905–2927[Free Full Text]
  5. Cantley, L. C. (2002) Science 296, 1655–1657[Abstract/Free Full Text]
  6. Storz, P., and Toker, A. (2002) Front. Biosci. 7, d886–d902[Medline] [Order article via Infotrieve]
  7. Pesche, S., Latil, A., Muzeau, F., Cussenot, O., Fournier, G., Longy, M., Eng, C., and Lidereau, R. (1998) Oncogene 16, 2879–2883[CrossRef][Medline] [Order article via Infotrieve]
  8. Whang, Y. E., Wu, X., Suzuki, H., Reiter, R. E., Tran, C., Vessella, R. L., Said, J. W., Isaacs, W. B., and Sawyers, C. L. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 5246–5250[Abstract/Free Full Text]
  9. Vlietstra, R. J., van Alewijk, D. C., Hermans, K. G., van Steenbrugge, G. J., and Trapman, J. (1998) Cancer Res. 58, 2720–2723[Abstract/Free Full Text]
  10. Cairns, P., Okami, K., Halachmi, S., Halachmi, N., Esteller, M., Herman, J. G., Jen, J., Isaacs, W. B., Bova, G. S., and Sidransky, D. (1997) Cancer Res. 57, 4997–5000[Abstract/Free Full Text]
  11. Wu, X., Senechal, K., Neshat, M. S., Whang, Y. E., and Sawyers, C. L. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 15587–15591[Abstract/Free Full Text]
  12. Davies, M. A., Koul, D., Dhesi, H., Berman, R., McDonnell, T. J., McConkey, D., Yung, W. K., and Steck, P. A. (1999) Cancer Res. 59, 2551–2556[Abstract/Free Full Text]
  13. Simpson, L., and Parsons, R. (2001) Exp. Cell Res. 264, 29–41[CrossRef][Medline] [Order article via Infotrieve]
  14. Lin, J., Adam, R. M., Santiestevan, E., and Freeman, M. R. (1999) Cancer Res. 59, 2891–2897[Abstract/Free Full Text]
  15. Carson, J. P., Kulik, G., and Weber, M. J. (1999) Cancer Res. 59, 1449–1453[Abstract/Free Full Text]
  16. Murillo, H., Huang, H., Schmidt, L. J., Smith, D. I., and Tindall, D. J. (2001) Endocrinology 142, 4795–4805[Abstract/Free Full Text]
  17. Raff, M. C. (1992) Nature 356, 397–400[CrossRef][Medline] [Order article via Infotrieve]
  18. Raff, M. C., Barres, B. A., Burne, J. F., Coles, H. S., Ishizaki, Y., and Jacobson, M. D. (1993) Science 262, 695–700[Abstract/Free Full Text]
  19. Tang, D. G., Li, L., Chopra, D. P., and Porter, A. T. (1998) Cancer Res. 58, 3466–3479[Abstract/Free Full Text]
  20. Gross, A., McDonnell, J. M., and Korsmeyer, S. J. (1999) Genes Dev. 13, 1899–1911[Free Full Text]
  21. Chipuk, J. E., Bhat, M., Hsing, A. Y., Ma, J., and Danielpour, D. (2001) J. Biol. Chem. 276, 26614–26621[Abstract/Free Full Text]
  22. Erhardt, P., and Cooper, G. M. (1996) J. Biol. Chem. 271, 17601–17604[Abstract/Free Full Text]
  23. Yang, E., and Korsmeyer, S. J. (1996) Blood 88, 386–401[Free Full Text]
  24. Green, D. R., and Reed, J. C. (1998) Science 281, 1309–1312[Abstract/Free Full Text]
  25. Zha, J., Harada, H., Yang, E., Jockel, J., and Korsmeyer, S. J. (1996) Cell 87, 619–628[CrossRef][Medline] [Order article via Infotrieve]
  26. del Peso, L., Gonzalez-Garcia, M., Page, C., Herrera, R., and Nunez, G. (1997) Science 278, 687–689[Abstract/Free Full Text]
  27. Lebedeva, I., Rando, R., Ojwang, J., Cossum, P., and Stein, C. A. (2000) Cancer Res. 60, 6052–6060[Abstract/Free Full Text]
  28. Bossy-Wetzel, E., Newmeyer, D. D., and Green, D. R. (1998) EMBO J. 17, 37–49[CrossRef][Medline] [Order article via Infotrieve]
  29. Li, X., Marani, M., Mannucci, R., Kinsey, B., Andriani, F., Nicoletti, I., Denner, L., and Marcelli, M. (2001) Cancer Res. 61, 1699–1706[Abstract/Free Full Text]
  30. Raffo, A. J., Perlman, H., Chen, M. W., Day, M. L., Streitman, J. S., and Buttyan, R. (1995) Cancer Res. 55, 4438–4445[Abstract/Free Full Text]
  31. Herrmann, J. L., Menter, D. G., Beham, A., von Eschenbach, A., and McDonnell, T. J. (1997) Exp. Cell Res. 234, 442–451[CrossRef][Medline] [Order article via Infotrieve]
  32. Ciardiello, F. (2000) Drugs 60, Suppl. 1, 25–32[Medline] [Order article via Infotrieve]
  33. Barton, J., Blackledge, G., and Wakeling, A. (2001) Urology 58, 114–122[CrossRef][Medline] [Order article via Infotrieve]
  34. Fan, S., Ma, Y. X., Wang, J. A., Yuan, R. Q., Meng, Q., Cao, Y., Laterra, J. J., Goldberg, I. D., and Rosen, E. M. (2000) Oncogene 19, 2212–2223[CrossRef][Medline] [Order article via Infotrieve]
  35. Okuma, E., Saeki, K., Shimura, M., Ishizaka, Y., Yasugi, E., and Yuo, A. (2000) Leukemia 14, 612–619[CrossRef][Medline] [Order article via Infotrieve]
  36. Page, C., Lin, H. J., Jin, Y., Castle, V. P., Nunez, G., Huang, M., and Lin, J. (2000) Anticancer Res. 20, 407–416[Medline] [Order article via Infotrieve]
  37. Beresford, S. A., Davies, M. A., Gallick, G. E., and Donato, N. J. (2001) J. Interferon Cytokine Res. 21, 313–322[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
H. Ammar and J. L. Closset
Clusterin Activates Survival through the Phosphatidylinositol 3-Kinase/Akt Pathway
J. Biol. Chem., May 9, 2008; 283(19): 12851 - 12861.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
R. Aneja, M. Liu, C. Yates, J. Gao, X. Dong, B. Zhou, S. N. Vangapandu, J. Zhou, and H. C. Joshi
Multidrug Resistance-Associated Protein-Overexpressing Teniposide-Resistant Human Lymphomas Undergo Apoptosis by a Tubulin-Binding Agent
Cancer Res., March 1, 2008; 68(5): 1495 - 1503.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
H. Hu, G.-x. Li, L. Wang, J. Watts, G. F. Combs Jr., and J. Lu
Methylseleninic Acid Enhances Taxane Drug Efficacy against Human Prostate Cancer and Down-Regulates Antiapoptotic Proteins Bcl-XL and Survivin
Clin. Cancer Res., February 15, 2008; 14(4): 1150 - 1158.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. S. R. Sastry, A. J. Smith, Y. Karpova, S. R. Datta, and G. Kulik
Diverse Antiapoptotic Signaling Pathways Activated by Vasoactive Intestinal Polypeptide, Epidermal Growth Factor, and Phosphatidylinositol 3-Kinase in Prostate Cancer Cells Converge on BAD
J. Biol. Chem., July 28, 2006; 281(30): 20891 - 20901.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C.-W. Shiau, J.-W. Huang, D.-S. Wang, J.-R. Weng, C.-C. Yang, C.-H. Lin, C. Li, and C.-S. Chen
{alpha}-Tocopheryl Succinate Induces Apoptosis in Prostate Cancer Cells in Part through Inhibition of Bcl-xL/Bcl-2 Function
J. Biol. Chem., April 28, 2006; 281(17): 11819 - 11825.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
Y. Luo, A. R. Shoemaker, X. Liu, K. W. Woods, S. A. Thomas, R. de Jong, E. K. Han, T. Li, V. S. Stoll, J. A. Powlas, et al.
Potent and selective inhibitors of Akt kinases slow the progress of tumors in vivo
Mol. Cancer Ther., June 1, 2005; 4(6): 977 - 986.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
P.-H. Tseng, H.-P. Lin, J. Zhu, K.-F. Chen, E. M. Hade, D. C. Young, J. C. Byrd, M. Grever, K. Johnson, B. J. Druker, et al.
Synergistic interactions between imatinib mesylate and the novel phosphoinositide-dependent kinase-1 inhibitor OSU-03012 in overcoming imatinib mesylate resistance
Blood, May 15, 2005; 105(10): 4021 - 4027.
[Abstract] [Full Text] [PDF]