![]()
|
|
||||||||
J. Biol. Chem., Vol. 278, Issue 28, 26258-26264, July 11, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
B Activation by Toll-like Receptor 4*
¶

||



From the
Cytokine Research Group, Department of
Biochemistry and Biotechnology Institute, Trinity College, Dublin 2, Ireland
and ||University Ulm, Department of Physiological
Chemistry, Albert-Einstein-Allee 11, D-89081 Ulm, Germany
Received for publication, February 11, 2003 , and in revised form, April 23, 2003.
| ABSTRACT |
|---|
|
|
|---|
B
(NF
B)-dependent reporter gene in HEK293 cells as well as LPS-induced
activation of NF
B in the astrocytoma cell line U373 and the monocytic
cell line RAW264.7. Further investigation revealed that the Btk-specific
inhibitor, LFM-A13, inhibited the activation of NF
B by LPS in THP-1
cells. Our findings implicate Btk as a Toll/interleukin-1 receptor
domain-binding protein that is important for NF
B activation by
TLR4. | INTRODUCTION |
|---|
|
|
|---|
RII), and a
number of cytokine receptors such as those for IL-3, IL-5, IL-6, and IL-10,
suggesting a general role for Btk in immune regulation
(14).
Whereas the molecular mechanisms by which the B-cell receptor regulates B-cell
proliferation and survival are not well understood, Btk has recently been
shown to lie downstream of the B-cell receptor on the pathway regulating
activation of the key pro-inflammatory transcription factor NF
B
(58).
The biological importance of the signaling function has been shown by
naturally occurring loss of function mutations in Btk in human X-linked
agammaglobulinemia and its murine counter-part, X-linked immunodeficiency
(Xid). These diseases are characterized by a block in B-cell development and
defects in B-cell signaling, and in X-linked agammaglobulinemia patients,
mutations in Btk are associated associated with an increased frequency of
bacterial infections in all organs
(9). Studies in Xid mice have
also shown reduced responses to LPS stimulation, with nitric oxide (NO)
production decreased, and macrophage effector functions impaired
(1012).
This, coupled with the observation that responses to T-independent antigens
are impaired in Xid mice, suggests a role for Btk in innate immune
responses.
Toll-like receptors (TLRs) have an essential function in both innate and
adaptive immunity and have evolved to recognize, with high specificity,
diverse microbial pathogens
(13). TLR4, as the receptor
for the Gram-negative bacterial product LPS, is the prototypical member of the
family (numbered TLR110 in humans) of type I transmembrane receptors,
which are characterized by an extracellular leucine-rich repeat domain and an
intracellular Toll/IL-1 receptor (TIR) domain, responsible for signaling.
Ligands for other family members (except TLR10) have been identified and
include bacterial flagellin and un-methylated bacterial CpG motifs for TLR5
and TLR9, respectively; double-stranded RNA for TLR3; and the antiviral
compound R-848 recognizing TLR7 and TLR8. Research into how these receptors
signal has identified MyD88 and IL-1-receptor-associated kinases (IRAKs) as
key proximal signaling components regulating activation of the
pro-inflammatory transcription factor NF
B in response to LPS (reviewed
in Ref. 14). Important
differences in the proteins recruited to the different TLR members have also
been described. Both TLR2 (the receptor for bacterial products such as
peptidoglycan) and TLR4 recruit an adapter protein homologous to MyD88, which
has been termed Mal (for MyD88 adapter-like protein) or TIRAP (Toll/IL-1
receptor adapter protein), which has been shown to interact with TLR4 and
MyD88 and mediate signaling to NF
B activation
(1518).
In the present study we have found that the TIR domains of TLRs 4, 6, 8,
and 9 interact with Btk. Co-immunoprecipitation studies revealed that Btk also
interacts with MyD88, Mal, and IRAK-1, but not TRAF-6. We investigated the
involvement of Btk in LPS signaling via TLR4 and found that LPS activated Btk
and that inactive mutants of Btk inhibited LPS signaling to NF
B
activation.
| EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
-galactosidase activity. Subdomains
of TLR8 (TIR domain, individual boxes) were generated by PCR using the
following primers: (a) Box 1, 2, and 3,
GTTTGAATTCTATATAATGTGTGTTTAGCTAAGGTAAAAGG (forward) and
TGGCTCGAGATCATGACTTAACGTCAGTTAGTATTGC (reverse); (b) Box 2 and 3,
CTGAATTCCTGACTGGGTGATAAATGAG (forward) and
TGGCTCGAGATCATGACTTAACGTCAGTTAGTATTGC (reverse); (c) Box 3,
CGAATTCGTAAGAGCTCCATCCTCC (forward) and TGGCTCGAGATCATGACTTAACGTCAGTTAGTATTGC
(reverse); (d) Box 1 and 2, GTTTGAATTCTATATAATGTGTGTTTAGCTAAGGTAAAAGG
(forward) and CTGCTCGAGGTTGTCGATGATGGCC (reverse); and (e) Box 1,
GTTTGAATTCTATATAATGTGTGTTTAGCTAAGGTAAAAGG (forward) and CTCCTCGAGGTGGTAGCGCAGC
(reverse). The different subdomains of the TLR8 TIR domain as well as the other TIR domains were cloned into the library vector pAct2 (Clontech) and co-transformed with the Btk bait vector in HF7c yeast cells.
Cell Culture, Plasmids, and ReagentsHEK293 and U373 cell
lines were obtained from the Centre for Applied Microbiology and Research
(Porton Down, United Kingdom), and the RAW264.7 cell line was obtained from
the European Centre for Animal Cell Culture Collection; these cell lines were
maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal
calf serum, 100 units/ml-1 gentamycin, and 2 mM
L-glutamine at 37 °C in a humidified atmosphere of 5%
CO2. THP-1 cells were obtained from the Centre for Applied
Microbiology and Research and maintained in RPMI 1640 supplemented with 10%
fetal calf serum, 100 units/ml-1 gentamycin, and 2 mM
L-glutamine at 37 °C in a humidified atmosphere of 5%
CO2. Cells were seeded at 105 cells/ml-1 for
experiments and treated as indicated in the figure legends. The chimeric
CD4-TLR4-expressing plasmid was a kind gift from Ruslan Medzhitov (Yale
University School of Medicine) and has been described previously
(15). The
NF
B-luciferase plasmid was a kind gift from Dr. R. Hofmeister
(Universitat Regensburg, Regensburg, Germany) and contains five
B sites
upstream of the luciferase gene. The plasmid encoding MyD88 was a gift from
Marta Muzio (Mario Negri Institute, Milan, Italy), and IRAK-1 was a gift from
Emma-Louise Cooke (Glaxo Wellcome, Stevenage, United Kingdom). TRAF-6 was a
kind gift from Tularik (San Francisco, CA). The wild-type Btk sequence cloned
into the pBluescript cloning vector was obtained from R. Hendriks (Rotterdam,
The Netherlands). Different point mutations, resulting in either the dominant
negative (K430R) or the Xid (R28C) version of the Btk protein, were generated
using the QuikChange® site-directed mutagenesis kit (Stratagene) according
the protocol of the manufacturer. After sequencing, the plasmid DNA of
positive clones was digested with NotI and cloned into a filled
EcoRV site of the pCDNA3 expression vector. The Btk-specific
inhibitor, LFM-A13, was obtained from Calbiochem (Nottingham, United Kingdom).
All other reagents were obtained from Sigma (Poole, United Kingdom) unless
otherwise stated.
Immunoprecipitation and Western Blot AnalysisHEK293 cells were seeded (105 cells/ml-1) onto 100-mm dishes 24 h before transfection with combinations of plasmids (4 µg of each) as indicated, using Genejuice (Novagen) according to the manufacturer's recommendations. The amount of DNA transfected was kept constant (8 µg in total) by the addition of various amounts of the appropriate empty vector plasmid. 24 h after transfection, cells were washed by the addition of 5 ml of ice-cold phosphate-buffered saline. Cells were lysed on ice (30 min) in buffer containing 150 mM NaCl, 2 mM EDTA, 10% glycerol, 1% Nonidet P-40, 0.2 mM phenylmethylsulfonyl fluoride, 0.2 mM Na3VO4, 2 µg/ml aprotonin, and 1 µg/ml-1 leupeptin. Immune complexes were immunoprecipitated by incubation for 2 h at 4 °C with the appropriate antibody, which had been pre-coupled to protein G-Sepharose at 4 °C overnight. Polyclonal antibody (SC-20; Santa Cruz Biotechnology, Santa Cruz, CA) against Btk was used for Btk immunoprecipitation (endogenous and overexpressed) and Western blotting. Monoclonal antibodies against the epitope tags Myc (9E10) and FLAG (12CA5) were obtained from Sigma. The polyclonal antibody against the HA epitope tag was obtained from Santa Cruz Biotechnology. The polyclonal antibody against IRAK-1 was a kind gift from Keith Ray (Glaxo Wellcome). The immune complexes were washed three times in lysis buffer, separated by SDS-PAGE, and then analyzed by Western blotting.
Btk Activation AssaysTHP-1 cells were seeded at a density
of 2.5 x 105 cells/ml-1 18 h before stimulation. A
total of 2 x 107 cells were used per point and stimulated
with LPS (1 µg/ml) for the time points indicated, washed twice in ice-cold
phosphate-buffered saline, and lysed in 1 ml of lysis buffer (150
mM NaCl, 2 mM EDTA, 10% glycerol, 1% Nonidet P-40, 0.2
mM phenylmethylsulfonyl fluoride, 0.2 mM
Na3VO4, 2 µg/ml aprotonin, and 1
µg/ml-1 leupeptin) as described above. Endogenous Btk-containing
immunocomplexes were obtained and either blotted for tyrosine phosphorylation
using monoclonal antibody 4G10 (Upstate Biotechnology, Lake Placid, NY) or
incubated with [
-32P]ATP (2 µCi/sample) in kinase buffer
(20 mM HEPES, 2 mM dithiothreitol, 10 mM
MgCl2, 100 µM Na3VO4, 20
mM
-glycerol phosphate, and 20 µM ATP) for 30
min at 37 °C, washed with 1 ml of lysis buffer, and analyzed by SDS-PAGE.
Gels were transferred onto polyvinylidene difluoride membrane and visualized
by autoradiography. The blots were subsequently probed for immunoprecipitated
Btk by Western blotting.
Reporter Gene AssaysHEK293 or U373 cells were seeded
(105 cells/ml-1) onto 96-well plates 24 h before
transfection with 80 ng of
B-luciferase, 40 ng of Renilla
luciferase, and the indicated amount of Btk-expressing plasmid (220 ng total),
and RAW264.7 cells were seeded (105 cells/ml-1) onto
24-well plates 24 h before transfection with 250 ng of
B-luciferase,
250 ng of Renilla luciferase, and the indicated amount of
Btk-expressing plasmid (1000 ng total) using Genejuice (Novagen, Madison, WI)
according to the manufacturer's recommendations. The amount of DNA transfected
was kept constant by the addition of various amounts of the appropriate empty
vector plasmid. For reporter gene assays, cells were lysed for 15 min at room
temperature with 50 µl of Passive Lysis Buffer (Promega, Southampton,
United Kingdom). After this, 50% of the supernatant was used to determine
firefly luciferase activity, and an equivalent amount was used for
Renilla luciferase activity. Firefly luciferase and Renilla
luciferase activity was assayed using standard protocols. Levels of firefly
luciferase expression were normalized against Renilla activity as a
control for transfection efficiency and expressed as fold stimulation over
unstimulated empty vector control.
Electrophoretic Mobility Shift AssayNuclear extracts were
prepared as described by Osborn et al.
(21) from THP-1 cells (5
x 106) treated as described in the figure legends. Nuclear
extracts (48 µg of protein) were incubated (30 min at room
temperature) with 10,000 cpm of double-stranded [
-32P]ATP
NF
B oligonucleotide
(5'-AGTTGAGGGGACTTTCCCAGGC-3'). Incubations were
performed in the presence of 2 µg of poly(dI·dC) as nonspecific
competitor and 10 mM Tris-HCl, pH 7.5, containing 100 mM
NaCl, 1 mM EDTA, 5 mM dithiothreitol, 4% glycerol, and
100 µg/ml nuclease-free bovine serum albumin. DNA-protein complexes were
resolved on native (5%) polyacrylamide gels that were subsequently dried and
autoradiographed.
| RESULTS |
|---|
|
|
|---|
|
Next we asked whether Btk selectively interacts with TLR8 or whether other TLR-intracellular domains might also show Btk interaction. We therefore tested the TIR domains of TLRs 4, 6, and 9 for their capacity to interact with Btk. The selection was made on the basis of sequence homology and expression pattern. TLR8 shows high sequence homology to TLR4, an important receptor on mast cells and macrophages, and TLR6 and TLR9, which, in addition to macrophages, were also found on B cells (23). As shown in Fig. 1c, Btk can interact with all analyzed TIR domains; nevertheless, the strongest interaction was found with the TIR domain of TLR8. Together, these data indicate that Btk is able to bind to the TIR domains of TLRs. Furthermore, Boxes 2 and 3 of the TIR domains are critical for this interaction.
Btk associates with MyD88, Mal, and IRAK-1If Btk were to be important for signaling by TLRs, we hypothesized that it might interact with downstream signaling components. We therefore next investigated possible interactions between Btk and MyD88, Mal, and IRAK-1. Fig. 2, a and b, shows HEK293 cells transfected with a plasmid encoding AU1-tagged MyD88 (AU1-MyD88) in combination with a Btk-expressing plasmid. In Fig. 2a, immunoprecipitation of AU1-MyD88 from lysates of cells overexpressing both Btk and AU1-MyD88 resulted in increased detection of Btk in the immunocomplex (lane 4) when compared with lysates from cells expressing either Btk or AU1-MyD88 alone (lanes 1 and 2). Interestingly, Btk was detected after AU1-MyD88 immunoprecipitation from cells expressing AU1-MyD88 alone (Fig. 2a, lane 2), indicating an association between AU1-MyD88 and endogenous Btk. This interaction would appear to be specific due to the fact that Btk was not detected after immunoprecipitation with anti-AU1 in lysates from cells transfected with Btk alone (Fig. 2a, lane 1). To confirm the interaction, the immunoprecipitation was performed in the opposite direction (Fig. 2b). Immunoprecipitation of Btk from lysates of cells overexpressing both Btk and AU1-MyD88 resulted in increased detection of AU1-MyD88 in the immunocomplex (Fig. 2b, lane 3) when compared with lysates from cells expressing AU1-MyD88 alone (lane 1). Again, a band at the correct molecular weight for AU1-MyD88 was detected after immunoprecipitation of complexes using anti-Btk in cells transfected with AU1-MyD88 alone (Fig. 2b, lane 1). Whether this band was due to an interaction between endogenous Btk and overexpressed AU1-MyD88 was difficult to determine due to a contaminating nonspecific band present in the IgG control lane (Fig. 2b, lane 4 compared with lane 5).
|
Fig. 2, c and d, investigated possible interactions between overexpressed Btk and HA-tagged Mal (HA-Mal). Btk and HA-Mal were found to associate when either HA-Mal-containing complexes (Fig. 2c, lane 4) or Btk-containing complexes (Fig. 2d, lane 3) were isolated from cells transfected with both HA-Mal and wild-type Btk. Similar to the interaction with AU1-MyD88, immunocomplexes containing HA-Mal were found to contain endogenous Btk (Fig. 2c, lane 2), and immunocomplexes containing endogenous Btk were found to associate with HA-Mal (Fig. 2d, lane 1), suggesting that endogenous Btk associates with overexpressed HA-Mal. The specificity of this finding was tested in lysates expressing HA-Mal alone, comparing the ability of anti-Btk (Fig. 2d, lane 5) and control IgG (lane 4) to immunoprecipitate HA-Mal. Increased levels of HA-Mal were detected in Btk-containing immunocomplexes when compared with the IgG control complex (Fig. 2d, lanes 5 and 4, respectively), indicating that an interaction between endogenous Btk and overexpressed Mal can be detected.
We also tested for interactions of Btk with IRAK-1 and TRAF-6. IRAK-1 was detected in a complex with Btk in lysates from HEK293 cells transfected with both wild-type Btk and IRAK-1 (Fig. 3a, lane 3). The specificity of this interaction was tested in lysates expressing IRAK-1 alone, comparing the ability of anti-Btk (lane 5) and control IgG (lane 4) to immunoprecipitate IRAK-1. IRAK-1 was detected in Btk-containing immunocomplexes only and not in the IgG control. An interaction between endogenous Btk and endogenous IRAK-1 was also detected after immunoprecipation of endogenous Btk from nontransfected HEK293 cells, with a weak but detectable band being detected after Western blotting of separated immunocomplexes with an antibody against endogenous IRAK-1 (Fig. 3b, lane 3). No IRAK-1 was detectable in the IgG control lane (Fig. 3b, lane 1). In contrast, no interaction between Btk and the downstream adapter protein TRAF-6 was detected (Fig. 3c, lane 3), whereas an interaction between TRAF-6 and TAB-1, serving as a positive control, was detected (Fig. 3d, lane 2).
|
LPS Activates Btk in THP-1 CellsOur data suggested that Btk might be important for signaling by TLRs. We therefore decided to focus on TLR4 signaling because Btk was found to associate with Mal, an important LPS regulator (15, 17, 18). We first examined the ability of the TLR4 ligand LPS to activate Btk in the human pro-monocytic cell line THP-1. Endogenous Btk was immunoprecipitated from lysates prepared from THP-1 cells stimulated with LPS for various time points. Because activated Btk is phosphorylated on Tyr551 within the activation loop of the protein (24), immunopurified Btk from each time point was immunoblotted with a phosphotyrosine-specific antibody. Maximal tyrosine phosphorylation of Btk was detected after 5 min of stimulation with LPS (Fig. 4a, top panel). Samples were also blotted for total Btk to ensure equal loading (Fig. 4a, bottom panel).
|
Phosphorylation of Tyr551 increases the catalytic activity of Btk, and an early substrate for Btk activity is Btk itself, which becomes phosphorylated on Tyr223 (2427). We therefore tested the ability of immunopurified Btk to become phosphorylated in an in vitro kinase assay, which most likely reflects its autokinase activity. Treatment of THP-1 cells with LPS induced a rapid and transient increase in phosphorylation of Btk, with maximal kinase activity detected 30 min after stimulation (Fig. 4b). After transfer to polyvinylidene difluoride membrane, the same samples were probed for Btk (Fig. 4b, bottom panel), indicating that the amount of Btk immunoprecipitated in each sample was equal.
Dominant Negative Btk Inhibits TLR4- and LPS-induced
NF
B ActivationThe ability of LPS to phosphorylate
and activate Btk implies that Btk may play an important role in LPS signaling.
To test this, we examined the effect of a kinase inactive form of Btk
(Btk(K430R)), which has previously been shown to interfere with Btk signaling
(28), on the induction of an
NF
B-dependent reporter gene (NF
B-luciferase) by LPS. To do this,
we used the transfectable LPS-responsive astrocytoma cell line U373
(Fig. 5a) and the
murine monocytic cell line RAW264.7 (Fig.
5b). The ability of LPS to drive
B-luciferase was
abolished in both cells by transfecting cells with a plasmid encoding
Btk(K430R), as shown in Fig. 5, a
and b. To confirm that the effect of Btk on LPS-induced
B-luciferase activity was dependent on the LPS receptor TLR4, we
transfected HEK293 cells with constitutively active CD4-TLR4 and assessed the
effect of both Btk(K430R) and an additional mutant form of Btk expressed in
xid mice, Btk(R28C), on CD4-TLR4-driven NF
B-luciferase.
Co-transfection of cells with either Btk(K430R) or Btk(R28C) with CD4-TLR4
inhibited the effect of CD4-TLR4 on NF
B-luciferase
(Fig. 5c). In
addition, the specificity of the inhibitory effect of both mutant forms of Btk
was tested. Both mutants showed a lack of inhibition on NF
B-luciferase
after treatment of cells with tumor necrosis factor
(Fig. 5d). We also
tested the effect of the Btk-selective kinase inhibitor LFM-A13 on LPS-induced
NF
B activation in the human pro-monocytic cell line THP-1
(29). Pretreatment of THP-1
cells with 100 µM LFM-A13 reduced LPS-induced DNA binding
activity of NF
B as determined by electrophoretic mobility shift assay
(Fig. 5e).
|
| DISCUSSION |
|---|
|
|
|---|
Given the high degree of homology between TIR domain-containing family members, we also tested the ability of other TLRs to interact with Btk. Btk was found to interact with the TIR domain of TLRs 4, 6, and 9 in addition to TLR8, albeit with weaker affinity, suggesting that Btk may play a role in TLR-mediated signaling. We tested for downstream interactions with key proteins involved in TLR signaling, namely, MyD88, Mal, IRAK-1, and TRAF-6. Immunoprecipitation experiments revealed that Btk interacts with MyD88, Mal, and IRAK-1, but not with TRAF-6. It is likely that Btk is recruited to a multi-protein complex containing these proteins.
We next examined in more detail a role for Btk in LPS signal transduction.
LPS has been shown to increase tyrosine phosphorylation in macrophages, and a
role for the Src family of non-receptor tyrosine kinases has been implied from
work using the inhibitor PP1
(30). As a key downstream
target for Src kinases, Btk is an important kinase regulating
receptor-dependent signaling in a variety of hematopoietic cell lineages
(31). The importance of Btk in
receptor signaling pathways has been underlined by the phenotypic analysis of
cells with naturally occurring mutations in Btk such as those from
xid mice, which lack a functional Btk
(32,
33). These studies have
demonstrated the key importance of Btk downstream of the B-cell antigen
receptor, where phosphatidylinositol 3-kinase and Src kinases function
upstream of Btk (34). Btk has
also been shown to regulate NF
B activation via activation of protein
kinase C
and the I
B kinase complex
(7,
35). The possibility that Btk
may be involved in LPS signaling was suggested by a recent study in
xid mice, which implicated Btk in macrophage effector functions in
response to LPS (12).
Macrophages from xid mice showed poor NO induction and reduced
production of the pro-inflammatory cytokines IL-1
and tumor necrosis
factor
. Because NF
B is a key transcription factor regulating
the expression of IL-1
and tumor necrosis factor
, the authors
examined the ability of LPS to induce expression of rel family
proteins. Levels of rel family members were reduced in xid
mice stimulated with LPS (10 µg/ml, 48 h) compared with control mice.
Based on our finding that Btk interacts with TLR4 and with Mal, an adapter
used by TLR4, we investigated the possibility that LPS stimulation of
macrophages directly regulates Btk activity. Our results clearly show that LPS
induces tyrosine phosphorylation of Btk and activates its kinase activity.
Interestingly, the activation of Btk, as determined by autokinase activity,
lagged behind increased tyrosine phosphorylation. The basis for this is not
clear. We also demonstrate that Btk regulates NF
B activation in
response to LPS because inhibitory mutants of Btk and the Btk-specific
inhibitor LFM-A13 block NF
B activation by LPS. Interestingly, the
inhibitor does not totally inhibit NF
B activation as observed by
electrophoretic mobility shift assay, even when used at higher concentrations
(data not shown), whereas both mutant forms of Btk completely inhibit the
NF
B-dependent reporter gene. This suggests that in addition to its role
in regulating DNA binding activity, Btk may also participate in the pathway
regulating the transactivation potential of NF
B via phosphorylation.
This possibility is strengthened by the fact that Btk can interact with the
guanine nucleotide exchange factor, Vav, which regulates the small G protein
Rac1, and also the fact that Rac1 lies downstream of Btk on the pathway to
c-Jun NH2-terminal kinase activation
(36). Rac1 has previously been
shown to regulate the transactivation potential of NF
B downstream of
TIR domain-containing receptors, namely, the IL-1 receptor complex and TLR2
(3739).
Taken together, our results therefore show that Btk is a TIR
domain-interacting protein, specifically interacting with TLRs 4, 6, 8, and 9.
Btk participated in TLR4 signaling to NF
B, and it is possible that it
is also involved in signaling by ligands for TLRs 6, 8, and 9. The precise
nature of the downstream targets for Btk on the NF
B pathway and its
mechanism of recruitment into the TLR-proximal signaling complex are currently
under investigation.
| FOOTNOTES |
|---|
These authors contributed equally to this work. ![]()
¶ To whom correspondence should be addressed: Cytokine Research Group, Dept. of Biochemistry and Biotechnology Institute, Trinity College, Dublin, Ireland. Tel.: 353-1-6082449; Fax: 353-1-6772400; E-mail: jefferca{at}tcd.ie.
1 The abbreviations used are: Btk, Bruton's tyrosine kinase; LPS,
lipopolysaccharide; NF
B, nuclear factor
B; TIR,
Toll/interleukin-1 receptor; TLR, Toll-like receptor; Xid, X-linked
immunodeficiency; IL, interleukin; IRAK, interleukin-1 receptor-associated
kinase; HA, hemagglutinin. ![]()
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
C. A. Beamer and A. Holian Silica suppresses Toll-like receptor ligand-induced dendritic cell activation FASEB J, June 1, 2008; 22(6): 2053 - 2063. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Gong, D. J. Angelini, S. Yang, G. Xia, A. S. Cross, D. Mann, D. D. Bannerman, S. N. Vogel, and S. E. Goldblum TLR4 Signaling Is Coupled to SRC Family Kinase Activation, Tyrosine Phosphorylation of Zonula Adherens Proteins, and Opening of the Paracellular Pathway in Human Lung Microvascular Endothelia J. Biol. Chem., May 9, 2008; 283(19): 13437 - 13449. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-G. Lee, S. Xu, E.-T. Wong, V. Tergaonkar, and K.-P. Lam Bruton's Tyrosine Kinase Separately Regulates NF{kappa}B p65RelA Activation and Cytokine Interleukin (IL)-10/IL-12 Production in TLR9-stimulated B Cells J. Biol. Chem., April 25, 2008; 283(17): 11189 - 11198. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Semaan, G. Alsaleh, J.-E. Gottenberg, D. Wachsmann, and J. Sibilia Etk/BMX, a Btk Family Tyrosine Kinase, and Mal Contribute to the Cross-Talk between MyD88 and FAK Pathways J. Immunol., March 1, 2008; 180(5): 3485 - 3491. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. D. Palmer, B. E. Mutch, S. Workman, J. P. McDaid, N. J. Horwood, and B. M. J. Foxwell Bmx tyrosine kinase regulates TLR4-induced IL-6 production in human macrophages independently of p38 MAPK and NF{kappa}B activity Blood, February 15, 2008; 111(4): 1781 - 1788. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Aki, Y. Minoda, H. Yoshida, S. Watanabe, R. Yoshida, G. Takaesu, T. Chinen, T. Inaba, M. Hikida, T. Kurosaki, et al. Peptidoglycan and lipopolysaccharide activate PLCgamma2, leading to enhanced cytokine production in macrophages and dendritic cells. Genes Cells, February 1, 2008; 13(2): 199 - 208. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Doyle, C. A. Jefferies, C. Feighery, and L. A. J. O'Neill Signaling by Toll-like Receptors 8 and 9 Requires Bruton's Tyrosine Kinase J. Biol. Chem., December 21, 2007; 282(51): 36953 - 36960. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Sato, K. Ogihara, R. Sawahata, K. Sekikawa, and H. Kitani Impaired LPS-induced signaling in microglia overexpressing the Wiskott Aldrich syndrome protein N-terminal domain Int. Immunol., August 14, 2007; (2007) dxm074v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Tokumasa, A. Suto, S.-i. Kagami, S. Furuta, K. Hirose, N. Watanabe, Y. Saito, K. Shimoda, I. Iwamoto, and H. Nakajima Expression of Tyk2 in dendritic cells is required for IL-12, IL-23, and IFN-{gamma} production and the induction of Th1 cell differentiation Blood, July 15, 2007; 110(2): 553 - 560. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. V. Tsytsykova, J. V. Falvo, M. Schmidt-Supprian, G. Courtois, D. Thanos, and A. E. Goldfeld Post-induction, Stimulus-specific Regulation of Tumor Necrosis Factor mRNA Expression J. Biol. Chem., April 20, 2007; 282(16): 11629 - 11638. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Levy Bruton tyrosine kinase (Btk): key for signaling via Toll-like receptor 8 Blood, March 15, 2007; 109(6): 2273 - 2274. [Full Text] [PDF] |
||||
![]() |
K. Sochorova, R. Horvath, D. Rozkova, J. Litzman, J. Bartunkova, A. Sediva, and R. Spisek Impaired Toll-like receptor 8-mediated IL-6 and TNF-{alpha} production in antigen-presenting cells from patients with X-linked agammaglobulinemia Blood, March 15, 2007; 109(6): 2553 - 2556. [Abstract] [Full Text] [PDF] |
||||