![]()
|
|
||||||||
J. Biol. Chem., Vol. 278, Issue 29, 26450-26457, July 18, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


From the Department of Biochemistry, Molecular Biology and Biophysics, University of Minnesota, Minneapolis, Minnesota 55455
Received for publication, November 20, 2002 , and in revised form, April 3, 2003.
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Glycogen metabolism is highly conserved from yeast to mammals. The regulation of glycogen metabolism in S. cerevisiae closely parallels the more extensively studied counterparts in mammals (1, 2). Regulation is mediated primarily by effects on the activities of glycogen synthase and glycogen phosphorylase. These enzymes are regulated, in part, by protein phosphorylation. Cyclic AMP appears to play a central role in the regulation of these enzymes in S. cerevisiae, as it does in mammals, although the precise mechanisms remain to be identified. The parallels between glycogen metabolism in S. cerevisiae and mammals extends to the level of protein sequence. Glycogen synthase and glycogen phosphorylase from this yeast and mammals are 50 and 49% identical, respectively (36).
Glycogen metabolism is also regulated at the level of gene expression in S. cerevisiae. The protein levels of the enzymes involved in glycogen metabolism increase in parallel with glycogen accumulation as cells approach stationary phase or when nutrients are depleted (7, 8). This increase in the level of glycogen metabolic enzyme activity appears to result, in part, from the regulation at the level of transcription. Northern blot analysis has shown that the levels of mRNA expressed from GPH1 (encoding glycogen phosphorylase), GLC3 (glycogen branching enzyme), GAC1 (glycogen-binding subunit of protein phosphatase 1), and GSY2 (glycogen synthase) increase as cells progress from log phase to stationary phase (912). The simultaneous increases in mRNA levels of the proteins involved in glycogen metabolism suggest that the expression of these genes may be coordinately regulated.
Our long term goal is to understand how glycogen metabolism is regulated at the level of gene expression and how these regulatory processes are coordinated with post-translational control of the glycogen metabolic enzymes. The first step toward this goal is to characterize the promoters for these genes. In this paper, we report a characterization of the promoter of GSY1 (glycogen synthase). This is a surprisingly complex promoter that allows transcription to respond to a wide variety of cellular stressors.
| EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
Isolation of the GSY1 CloneGSY1, the gene encoding yeast
glycogen synthase, was isolated as described by Meinke in 1993
(13). Briefly, glycogen
synthase was purified from strain S288C cells grown on YPD medium. The
purified protein was reduced, carboxymethylated, and digested with trypsin.
Two peptides were purified by reverse phase high performance liquid
chromatography, their sequences were determined, and oligonucleotide probes
were prepared. GSY1 was isolated following screening of a yeast
genomic library in
dash (Stratagene Cloning Systems) by plaque
hybridization. The identities of the clones were confirmed by nucleotide
sequence analysis and they were recloned as SalI fragments into
plasmid vector pSEY18
(14).
Yeast MethodsYeast strains were manipulated by standard methods unless indicated otherwise (15). Transformation of linear DNA fragments was done by either the lithium acetate transformation method (16) or using the E-Z yeast transformation kit supplied by Zymo Research, Inc. Northern analysis was performed by standard procedures (17).
Constructs were transferred to the CAN1 locus of the chromosome, unless otherwise noted. Transfer was accomplished using the integrating plasmid pRL95 (12, 18). This vector includes two fragments of the CAN1 gene. Digestion with a restriction enzyme that cuts between these segments produces a linear fragment that will integrate into the CAN1 locus, replacing the resident sequences and producing a stable, single-copy integrant. Integrants were selected as uracil prototrophs (because of the URA3 gene carried by the vector) and then confirmed by resistance to canavanine plates and sensitivity to 5-fluoroorotic acid.
Culture ConditionsYeast cells were grown either in YPD (2% glucose, 2% peptone, and 1% yeast extract) or in SD media (2% glucose, 0.5% ammonium sulfate, and 0.17% yeast nitrogen base minus the amino acids) supplemented with the appropriate nutritional requirements (15). 5-Fluoroorotic acid plates were prepared as described (19). SD + CAN plates contained SD supplemented with canavanine at a concentration of 60 µg/ml (20).
GSY1 expression was routinely induced by growth into early stationary phase. Growth was monitored by light scattering at 600 nm. Cultures were grown at 30 °C and samples were taken at early log phase (A600 between 0.05 and 0.15) or in early stationary phase (1418 h later).
For heat shock experiments, 250-ml cultures were grown at 21 °C to an
A600 of 0.1 to 0.2. Then 100 ml was transferred into each
of the two flasks. One flask was shaken at 21 °C and the other at 37
°C. The remainder was harvested. The control and the heat-shocked samples
were collected 1 h later. Induction was assayed by measuring
-galactosidase activity (see below).
Construction of the GSY1:lacZ FusionThe coding sequence of GSY1 was digested with BstBI (which cleaves at base +31 relative to translational start); the ends were filled with Klenow fragment of DNA polymerase I and BamHI linkers were attached. The EcoRI-BamHI fragment, which includes the 5' end of GSY1, was inserted into plasmid YCp50 (21). A lacZ gene fusion cassette, derived from pMC1871 (22) was then inserted into the BamHI site. The resulting plasmid carries a GSY1:lacZ fusion gene that includes the first 31 bp of the GSY1 structural gene fused in-frame with the lacZ gene and has 1700 bp of GSY1 upstream sequences. This fusion was subcloned into the integration vector, pRL95, to give pUL5.
Construction of Deletions and Point MutationsPlasmid pUL5
was used for constructing deletions or mutations in GSY1. Deletions
were made using available restriction sites. Site-directed mutagenesis of the
potential cis-elements was performed with the Clontech Transformer Mutagenesis
Kit. Escherichia coli strain BMH1781 was used for the
initial amplification after mutagenesis. A 1.7-kb GSY1 upstream
sequence from pUL5 was subcloned into a pT3/T7
-18 vector. The strategy
employed for mutagenesis resulted in the conversion of the putative
cis-element to a unique restriction site (absent in the original
vector) and this allowed rapid screening for the mutants, which were then
verified by sequencing with Sequenase kit (U. S. Biochemical Corp.). The
mutated upstream sequence was then used to replace the corresponding wild-type
sequences in pUL5. The resulting plasmid was integrated into the yeast
chromosome, as described above. The list of oligonucleotides used in this
study can be found in Table
I.
|
Construction of Promoters to Test N1 FunctionFor generating the double stranded N1 element, 0.5 µg of phosphorylated complementary oligonucleotides, 5'-CTAGCGGCTACTCAGGGACCATTTG-3' and 3'-GCCGATGAGTCCCTGGTAAACGATC-5', were heated at 70 °C for 10 min in buffer containing 20 mM Tris-Cl, pH 7.5, 10 mM MgCl2, and 50 mM NaCl. The tubes were then allowed to cool slowly to room temperature over a period of 34 h. The stress response element (STRE)1-1 of GSY1 and the surrounding sequences (422 bp to 354 bp) were subcloned upstream of a basal CYC1:lacZ promoter. Double stranded N1 oligonucleotide was ligated into restriction sites either 34 bp downstream (NheI) or 54 bp upstream (XbaI) of the STRE-1 sequence. The constructs were identified by sequencing. Following integration of these constructs into the CAN1 locus, these strains were grown in SDc-ura and activity was measured in early log phase cultures and in stationary phase cultures.
The CYC1-UAS is composed of sites for HAP1 and HAP 2/3/4. The CYC1-UAS from plasmid pLG-312 (23) was subcloned upstream of a basal CYC1:lacZ fusion. N1 was then ligated into restriction sites either 38 bp downstream of the HAP 2/3/4 site (XbaI) or 53 bp upstream of the HAP1 (SmaI) site of the CYC1-UAS. Following integration of these constructs into the CAN1 locus, these strains were grown in YPLactate to an early log phase and cells were collected for activity measurements at an A600 of 0.20.3.
Primer ExtensionPrimer extension analysis was performed
with slight modifications of a published procedure
(24). Total RNA was obtained
at the indicated time points from strain YRL40 bearing either
GSY1:lacZ on a multicopy plasmid or the control vector
plasmid, YEP24. An oligonucleotide hybridizing to the lacZ sequence
(+54 to +72 bp relative to the translational start site of
GSY1:lacZ fusion) was used as a primer and was 5'
end-labeled using radioactive [
-32P]ATP. Forty µg of RNA
was mixed with 20 mM Tris, pH 8.0, 0.1 M NaCl, 0.1
mM EDTA, 5'-end labeled probe (7 x 106 cpm) and the
final reaction volume was adjusted to 25 µl with water. This sample was
heated to 90 °C, cooled to 50 °C and 25 µl of 2x RT mixture
(0.1 M Tris-HCl, pH 8.2, 12 mM MgCl2, 20
mM dithiothreitol, and 1 mM each dNTP) and 20 units of
avian myeloblastosis virus reverse transcriptase were added to the mixture.
The sample was then allowed to incubate at 42 °C for 90 min. The products
were analyzed on an 8% polyacrylamide-urea gel. The start sites of
GSY1 were determined by comparison with a DNA-sequencing ladder that
was run alongside the products of primer extension. The sequencing reactions
were carried out using the same primer as that for primer extension.
-Galactosidase AssayYeast cell samples were collected
by rapid filtration and quick-frozen on dry ice. To carry out the
-galactosidase assay, the pellet was thawed and resuspended in Z-buffer
(100 mM sodium phosphate, pH 7.5, 10 mM KCl, 1
mM MgSO4, and 50 mM
-mercaptoethanol)
and 1 mM phenylmethylsulfonyl fluoride. Cells were disrupted by
vortexing in the presence of glass beads and the protein extract was obtained
by centrifugation. The extract was then incubated at 30 °C with
o-nitrophenyl-
-galactopyranoside and absorbance was measured at
420 nm (25). Protein
concentration was determined by the method of Lowry et al.
(26), using bovine serum
albumin as the standard.
-Galactosidase activities are normalized for the protein
concentration in the cell extract. Specific activities reported are the
average of three or more independent experiments. At least two independent
isolates were used for each construct. In all cases, S.E. ± mean was
below 15% of the value shown.
Mobility Shift AssayYeast strain YRL40 was grown in 100 ml
of YPD medium to an A600 of 1.0. Cells were harvested by
centrifugation, washed in extraction buffer (0.2 M Tris-Cl, pH 8.0,
400 mM ammonium sulfate, 10 mM MgCl2, 1
mM EDTA, 10% glycerol, 7 mM
-mercaptoethanol, 1
mM phenylmethylsulfonyl fluoride, and 1 µg/ml leupeptin), and
then resuspended in 200 µl of extraction buffer. Samples were transferred
to 1.5-ml Eppendorf tubes containing 0.75 ml of glass beads and frozen in a
dry ice/ethanol bath. After thawing the tubes, they were vortexed in the cold
room for 20 min. 100 µl of extraction buffer was added and the samples were
centrifuged to remove glass beads and larger cell debris. The supernatant was
isolated and clarified by centrifugation at 14,000 rpm for 1 h at 4 °C.
Protein was precipitated by adding ammonium sulfate to 70%. The precipitate
was collected by centrifugation and resuspended in 300 µl of 10
mM Hepes, pH 8, 5 mM EDTA, 7 mM
-mercaptoethanol, 1 mM phenylmethylsulfonyl fluoride, 1
µg/ml leupeptin, and 20% glycerol. Samples were dialyzed twice against 500
ml of the same buffer for 2 h each. The dialyzed extracts were centrifuged,
and supernatants were aliquoted and stored at 70 °C.
The double stranded N1 oligonucleotide was end-labeled using
T4-polynucleotide kinase and [
-32P]ATP. The sample was then
passed through a G-25 column to remove excess labeled ATP. The binding
reactions were carried out in a final volume of 20 µl containing 2 µl of
10x DNA binding buffer (0.2 M Hepes, pH 7.6, 1% Nonidet P-40,
and 0.5 M KCl), 10 mM
-mercaptoethanol, 5 µl of
80% glycerol, and 0.1 µg of poly(dI-dC). A typical reaction contained
120,000 cpm (30.8 fmol or 0.2 ng) of end-labeled probe and 30 µg of yeast
extract. Following incubation at room temperature for 30 min, the samples were
electrophoresed on a 5% non-denaturing polyacrylamide gel containing
0.25x TBE (Tris borate/EDTA) and 5% glycerol, for 3.5 h at 4 °C.
Competition experiments were performed using unlabeled N1, unlabeled N1m2 (a
version of the N1 double stranded oligonucleotide in which all nucleotides in
the N1 region have been changed), and salmon sperm DNA. The N1 was
CTAGCGGCTACTCAGGGACCATTTG and the N1m2
CTAGCGGCTtagactatcagATTTG.
| RESULTS |
|---|
|
|
|---|
|
Localization of the Transcriptional Start SiteThe transcriptional start site of GSY1 was identified by primer extension analysis (Fig 2A). A single major start site was identified, 90 bp upstream of the start of the open reading frame, along with multiple (10 or more) minor start sites. Multiple start sites have been observed for other genes in yeast (27, 28). All map positions in this paper are given relative to the major start site of GSY1 transcription.
|
The sequence TATAAA, which is an exact match with the consensus for TATA elements, was identified at 81 bp relative to the major transcriptional start site of GSY1. When this putative TATA sequence was mutated to TtcAAA, there was a 7-fold drop in the expression of GSY1 in both log and stationary phase cells (Fig. 2B). However, the fold induction was still comparable with that of the wild-type. It appears that this sequence is a functional TATA element and that this element is not directly involved with regulation in response to growth state.
GSY1 Expression and Induction Requires STREs and Intact MSN2 and MSN4 GenesIn previous studies, we found that GPH1 and GSY2, which encode glycogen phosphorylase and an isozyme of glycogen synthase in S. cerevisiae, employed STRE to induce expression in response to stationary phase and heat shock (12, 29). Sequences that appear to match the consensus for STREs were also found in the promoter of GSY1, centered at 374 and 236. These elements were designated as STRE-1 and STRE-2, respectively (Fig. 3).
|
Mutation of either or both STRE-1 or STRE-2 within the 1700 bp of upstream sequences resulted in a striking decrease in expression of GSY1 in both log and stationary phase (Fig. 3). Thus, these elements appear to be functional and are required for expression of GSY1. These elements may act synergistically, because the sum of the activities observed with either element alone was less than that observed when both were intact.
The major STRE-specific binding factor in yeast is the product of the MSN2 gene. MSN4p, a close structural homologue of MSN2p, was also shown to be capable of binding the STRE sequence (30, 31). Mutation of msn2 and msn4 genes greatly reduced GSY1:lacZ activity (Fig. 3), consistent with the suggestion that they act on GSY1 through the STRE.
STRE mediate induction of a number of genes in response to a variety of stressors in addition to stationary phase (32). As a further test of the roles of STRE-1 and STRE-2, we examined the response of GSY1 to heat shock. Shifting a culture from 21 to 37 °C caused a 6-fold induction of GSY1 promoter activity within an hour following the shift (Fig. 4). Mutation of either element greatly reduced this response and the double mutant failed to respond at all. As with the effect of growth into stationary phase, STRE-1 and STRE-2 appeared to act synergistically.
|
Rox1 Represses GSY1 ExpressionDuring a deletion analysis of the GSY1 promoter, we found a region between 209 and 154 bp that appeared to include a negative element (data not shown). This deletion resulted in a striking increase in promoter activity in both log (19-fold) and stationary phase (7-fold) of growth. Examination of this region identified a sequence that matched the consensus binding site for Rox1 (Fig. 5), a repressor protein that is induced in response to oxygen (33). To test the role of this element in GSY1 promoter function, we mutated this sequence (210 to 199 bp) in the GSY1:lacZ reporter. Mutation of the ROX1 gene increased expression of a GSY1:lacZ fusion in both log phase and stationary cells (Fig. 5A), consistent with the suggestion that the Rox1 repressor controls GSY1. Similarly, mutation of the Rox1 binding site in a ROX1 background increased GSY1:lacZ expression. In contrast, mutation of this site had no effect in a rox1 strain. Mutation of the ROX1 gene had a greater effect on GSY1:lacZ expression than did mutation of the Rox1 binding site (Fig. 5A). This probably did not result from the presence of a second Rox1 site in the GSY1 promoter, because we could find no other sequence that matched the binding site consensus. The greater effect of the ROX1 gene mutation may have been a secondary consequence of a general effect on cellular metabolism, although that remains to be proven.
|
The ROX1 gene is known to be transcriptionally activated by heme (34). If GSY1 is, indeed, repressed by Rox1, then a heme deficiency would be expected to derepress GSY1 expression because of a reduction in Rox1. We tested this prediction by inserting the GSY1:lacZ fusion genes into isogenic strains that carried wild-type or deleted alleles of HEM1, a gene required for heme biosynthesis (35). Deletion of HEM1 did, indeed, derepress GSY1:lacZ, consistent with the prediction (Fig. 5B). The cis-mutation in the Rox1 element had a somewhat greater effect, perhaps because Rox1 was not completely eliminated by the HEM1 deletion. Mutation of both HEM1 and the Rox1 element were not additive. It thus appears that Rox1 represses GSY1 and may mediate an effect of heme.
It might be noted that the wild-type strains in panels A and
B of Fig. 5 exhibit
quite different levels of
-galactosidase activities. This difference is
most likely explained by the fact that these strains have different genetic
backgrounds.
Mig1 Also Represses GSY1 ExpressionExamination of the GSY1 promoter sequence revealed a second possible repressor binding site at 250 bp. This sequence matches the consensus binding site of Mig1 (36, 37), a protein that participates in glucose repression. Mutation of this site yielded a 3-fold increase in GSY1:lacZ expression (Fig. 6). A similar increase was observed when the MIG1 gene was mutated. These effects were not additive: mutation of the MIG1 gene and the Mig1 site had the same effect as either mutation alone. These results indicate that GSY1 is repressed by Mig1 when grown on glucose.
|
The observation that Mig1 appears to repress GSY1 expression
suggested that this gene should respond specifically to glucose as a carbon
source. Consistent with this prediction, the levels of GSY1 fusion
protein were extremely low on glucose (3 ± 0.3
-galactosidase
units) compared with growth on raffinose (122 ± 7), glycerol (117
± 4), or lactate (125 ± 7) media.
Identification of a Novel Repressor Element in the GSY1 PromoterExperiments mapping the GSY1 promoter revealed a third negative element. Mutations between 322 and 316 bp yielded a 2-fold increase in GSY1:lacZ expression (Fig. 7). Deletion analysis indicated that the negative element lay, at least in part, between 328 to 314 bp and effects up to 5-fold were observed when the full element was deleted.
|
We have narrowed the location of this negative element by oligonucleotide-directed mutagenesis (Fig. 7). Mutation or deletions outside of the region from 324 to 314 bp had no effect on expression, suggesting that the negative element lay within this region. A literature search revealed no published sequence in the yeast literature that resembles this region, suggesting that this element may be novel. We refer to this negative element as N1.
To determine whether N1 was sufficient to repress expression from an
STRE-linked promoter, we synthesized an N1 oligonucleotide that included the
sequence from 324 to 314 bp. This oligonucleotide was inserted
downstream of STRE-1 in the basal promoter (containing only the TATA element
and no regulatory elements) of CYC1:lacZ. This construct
showed high promoter activity in the log phase in the absence of any negative
elements and an induction in
-galactosidase levels as cells enter
stationary phase. A single copy of N1 was sufficient to repress expression
(1224-fold) from STRE-1 in both log and stationary phases
(Fig. 8). Perhaps more
importantly, the residual activity was not induced when the cells entered
stationary phase, indicating that induction had been blocked. These results
were obtained with N1 in either orientation. Two or more copies of N1 made
expression undetectable. In contrast, when the oligonucleotide N1m2, which had
mutations in every base of the 11-bp region of N1, was placed downstream of
STRE, it caused a modest (2.5-fold) reduction in expression and also did not
block the induction observed when these cells enter stationary phase (data not
shown). Thus, the strong repression appears to be specific to the novel N1
sequence.
|
When present upstream of STRE-1, a single copy of N1 in either orientation yielded a modest decrease in CYC1:lacZ expression. In contrast to its effect downstream of STRE-1, a single upstream copy of N1 did not block induction. However, when four copies of N1 were present upstream of STRE-1, a much greater repression of CYC1:lacZ was observed and the induction seen upon entering stationary phase was completely blocked.
We next tested the effects of N1 on a heterologous promoter, the UAS from CYC1. The effect of N1 on this UAS was qualitatively similar to its effect on STRE-1, although the repression was less pronounced (Fig. 9). N1 repressed expression both upstream and downstream of this UAS, although the latter was more effective. Repression occurred with the element in both orientations. Two copies of the element were more effective than one.
|
Gel mobility shift assays were carried out to test for N1 binding activities in cell-free extracts. The double stranded N1 oligonucleotide was end-labeled and incubated with the yeast extract. One major and three minor DNA-protein complexes were observed (Fig. 10, lane 2). Inclusion of unlabeled N1 oligonucleotide yielded a striking decrease in the intensity of the major band (lane 3-5). However, even in the presence of 250-fold excess of the cold competitor, the reduction in binding of the hot oligonucleotide was less than proportional. This result might be observed if the binding activity was present in excess of the labeled oligonucleotide. In contrast, the mutated oligonucleotide (N1m2) and the salmon sperm DNA had no effect on the intensity of this band (lane 7-10). Two of the minor bands were subject to competition by both unlabeled probe and salmon sperm DNA. A third minor band paralleled the behavior of the major band and may be related to it. Thus, it appears that the major band represents a specific N1 binding activity. This binding activity may mediate the repressor activity of N1, although this remains to be demonstrated.
|
| DISCUSSION |
|---|
|
|
|---|
|
STREs have been identified in a number of stress inducible genes in S. cerevisiae. These elements respond to a variety of stressors, such as stationary phase, heat shock, and osmotic shock (39). Msn2 and Msn4 proteins have been shown to be required for transcriptional induction through the STREs in S. cerevisiae (30, 31, 40). GSY1 has two of the STRE that act synergistically with each other. No induction of GSY1 expression through these STREs was observed in msn2 msn4 double mutants supporting a role for these genes in the stress response of GSY1.
Rox1 is a repressor protein that was first identified during studies of CYC1. Expression of Rox1 responds to the levels of oxygen and heme. Under conditions of low oxygen or heme, Rox1 levels are reduced, inducing expression of Rox1-regulated genes. Rox1 also appears to control GSY1 expression. Mutation of either the ROX1 gene or of the Rox1 site within the GSY1 promoter increased the expression of a GSY1:lacZ reporter. The ability of Rox1 to repress GSY1 suggests that expression of this gene should respond to heme and oxygen (33, 34). Consistent with this suggestion, anaerobic growth2 and mutation of HEM1 (a gene required for heme biosynthesis) each increased GSY1:lacZ expression 34-fold. However, these results should be interpreted with caution because anaerobic growth and the inability to synthesize heme would be expected to produce pleiotropic effects.
GSY1 expression may respond to glucose levels through the Mig1 repressor. Mig1 has been shown to play a central role in glucose repression of a variety of genes. Mutation of the MIG1 gene or the Mig1 site within the GSY1 promoter increased expression of a GSY1:lacZ fusion, indicating a role for this protein in the control of GSY1. Also, growth on glucose yields a 50-fold reduction in GSY1:lacZ expression compared with growth on raffinose, glycerol, or lactate, which also indicates that GSY1 responds to glucose levels. However, as with anaerobic growth, the response to the carbon source result must be interpreted with caution because of the complexity of the effects produced by these different growth conditions.
Mig1 has been shown to be phosphorylated by Snf1, the yeast homologue of the mammalian AMP-sensitive kinase (4245). Increasing AMP levels signal a lack of glucose in the medium, triggering the activation of Snf1 kinase and derepression of the glucose-repressed genes (46). Snf1 mutants have reduced glycogen levels (47), consistent with a role for SNF1 in controlling the glycogen synthase genes.
The GSY1 promoter also contains a novel negative element, which we refer to as N1. This element represses transcription when present either upstream or downstream of a UAS, although the latter position is more effective. N1 is functional in either orientation and is more repressive when multiple copies are present. It is not specific to STREs, repressing at least the UAS of CYC1 as well. The role of N1 in regulating GSY1 expression has yet to be determined. However, it is intriguing that this element can block induction from a single copy of an STRE even when it does not completely repress expression. We are unaware of any negative element in yeast with a similar sequence, suggesting that N1 is a new element.
Why is the promoter of GSY1 so complex? Glycogen accumulates rapidly in response to a wide variety of stressors, such as entry into stationary phase, starvation, heat shock, and osmotic shock (41, 48, 49). Rapid accumulation is probably advantageous, because it increases the amount of glycogen that is available to the cell during the metabolic crisis. The response of GSY1 to oxygen that appears to be mediated by Rox1 is also likely to be advantageous, because accumulated glycogen can be fermented under anaerobic conditions. The complexity of the GSY1 promoter may ensure that glycogen synthase is induced quickly in response to a wide variety of stressors.
Yeast glycogen synthase is encoded by two genes: GSY1 and GSY2. Both promoters have STRE that contribute to the induction of the gene upon entry into stationary phase. The GSY1 promoter also includes a number of negative elements, whereas no such elements have been found in the GSY2 promoter (12). GSY2 has been found to express glycogen synthase at a higher level than does GSY1 and so is thought to be the major contributor to glycogen synthesis under normal growth conditions. However, the presence of negative elements in GSY1, but not GSY2, suggests that the product of GSY1 may become the dominant form of glycogen synthase under conditions that relieve repression from these elements. These negative elements would afford a much broader range of expression levels and the ability to respond to a wider array of metabolic conditions than would be obtained with STRE alone.
| FOOTNOTES |
|---|
Current address: Dept. of Microbiology and Immunology, Kimmel Cancer
Center, 833 Bluemle Life Sciences Bldg., 233 South 10th St., Philadelphia PA
19107. ![]()
To whom correspondence should be addressed. Tel.: 612-625-4983; Fax:
612-625-2163; E-mail:
David-L{at}Lenti.med.umn.edu.
1 The abbreviation used is: STRE, stress response element. ![]()
2 I. Unnikrishnan and D. C. LaPorte, unpublished observations. ![]()
| ACKNOWLEDGMENTS |
|---|
rox1, Dr. H. Ronne (Uppsala, Sweden) for providing
strains W303-1A and H174, Dr. T. Keng for providing strains SC252a and TKY18,
and Dr. L. Guarente (MIT, Cambridge) for plasmid pLG-312. | REFERENCES |
|---|
|
|
|---|
| |||||||||||||||||||||||||||||||||||||||||||||||||||