![]()
|
|
||||||||
J. Biol. Chem., Vol. 278, Issue 29, 27208-27215, July 18, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


From the
Secretory Physiology Section, Gene Therapy and Therapeutics Branch, and
the
Cellular Imaging Core, Department of
Health and Human Services, NIDCR, National Institutes of Health, Bethesda,
Maryland 20892
Received for publication, February 3, 2003 , and in revised form, April 29, 2003.
| ABSTRACT |
|---|
|
|
|---|
271349 induced a dominant suppression
of SOCE and was associated with wild-type TRPC1. Although the role of the
C-terminal Cav1 binding domain is not known, its deletion did not affect
localization of TRPC1 (Singh, B. B., Liu, X., and Ambudkar, I. S. (2000)
J. Biol. Chem. 275, 3648336486). Further, expression of a
truncated Cav1 (Cav1
51-169), but not full-length Cav1, similarly
disrupted plasma membrane localization of endogenously and exogenously
expressed TRPC1 in human submandibular gland and Madin-Darby canine kidney
cells. Cav1
51169 also suppressed thapsigarginand
carbachol-stimulated Ca2+ influx and increased the detergent
solubility of TRPC1, although plasma membrane lipid raft domains were not
disrupted. These data demonstrate that plasma membrane localization of TRPC1
depends on an interaction between its N terminus and Cav1. Thus, our data
suggest that Cav1 has an important role in the assembly of SOCE
channel(s). | INTRODUCTION |
|---|
|
|
|---|
q/11, inositol
trisphosphate receptor, phospholipase C
, PMCA (plasma membrane
Ca2+ pump), SERCA (sarco-endoplasmic reticulum Ca2+
pump), and calmodulin
(1315).
The Drosophila TRP signalplex is assembled via INAD, a multi-PDZ
domain-containing protein. INAD binds to a number of proteins in the complex
and determines its localization in the rhabdomeres
(4,
12). Interestingly, the
components of this signalplex appear to be trafficked independently to the
plasma membrane, and interaction with INAD is required for their retention at
that location. Although several mammalian PDZ domain-containing proteins have
been shown to act as scaffolds for receptor-associated signaling complexes in
the plasma membrane (16),
little is known about the organization of TRPC channels in mammalian cells
(17). Tang et al.
(18) have reported that NHERF,
a two PDZ domain-containing protein that associates with the actin
cytoskeleton via interactions with members of ezrin/radixin/moesin family,
also interacts with TRPC4 and TRPC5 and might be involved in their association
with phospholipase C isozymes. However, the C-terminal PDZ domain binding
motif found in TRPC4 is absent in TRPC1. Thus, the molecular component(s)
involved in the assembly of the TRPC1-associated protein complex is not yet
known.
In recent years, much evidence has emerged which demonstrates that key molecules involved in Ca2+ signaling are associated with caveolar lipid rafts, thus implicating the importance of caveolae in Ca2+ signaling (13, 1922). Lipid rafts are detergent-insoluble membrane domains formed by the dynamic clustering of sphingolipids and cholesterol which have been suggested to function as platforms for protein attachment, trafficking, and signaling (2326). A specialized subset of lipid rafts, called caveolae, contains the cholesterol-binding protein caveolin, which provides a scaffold onto which molecules can concentrate to form signaling complexes at specific microdomains in the plasma membrane. This membrane specification facilitates coordination of incoming and outgoing cellular messages (2629). Our finding that TRPC1 and TRPC3 form complexes with Ca2+ signaling proteins that are associated with caveolar domains strongly suggests that regulation of SOCE occurs within this complex. Consistent with our results, several recent studies show that TRPC1 (30, 31) and TRPC4 (32) are associated with caveolar lipid raft domains. In addition, integrity of the caveolar lipid domain is critical for SOCE and TRPC1 function (13, 31).
In this study we have examined the role of Cav1 in SOCE. Our data demonstrate that Cav1 regulates the plasma membrane localization of TRPC1 by binding to a site on its N terminus. Deletion of the Cav1 binding site in TRPC1 disrupts routing of TRPC1 to the plasma membrane and also suppresses SOCE. Together with our previous studies showing that TRPC1 is a component of SOCE channels (9, 33), the present data reveal a potentially important role for Cav1 in the plasma membrane assembly of SOCE channels.
| EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
Plasmid ConstructionThe YFP-Cav1 plasmid was a generous
gift from Dr. Junji Nishimura (Kyushu University, Fukoka, Japan). The
YFP-Cav1
51169 plasmid was constructed from the full-length
YFP-Cav1 by PCR. Two oligonucleotides, 5'-GTCCACACCGTCTGTGACCCACTCTT and
5'-GTTGACCAGGTCGATCTCCTTGGTGTG, were used to amplify from the YFP-Cav1
to construct an N-terminal YFPfusion, truncated fragment of Cav1 of about 5.1
kb using Takara Ex Taq DNA polymerase (Panvera, Madison, WI). The
3'-AT overhangs of the fragment were blunt ended using T4 DNA polymerase
(New England Biolabs, Beverly, MA), and religated using a Rapid Ligation Kit
(Roche Applied Science). The original YFP-Cav1 and religated
YFP-Cav1
51169 plasmids were subsequently used to transform
Escherichia coli, individual clones were selected, and the insert was
confirmed by sequencing from both directions prior to transfection of cells.
The GFP-Cav1 plasmid was constructed by amplifying the hCav-1 gene using the
following oligonucleotides: 5'-CTCGAGATGTCTGGGGGCAAATACGTAGACTCG and
5'-GGTACCAATATTTCTTTCTGCAAGTTGATGCGGAC. The PCR product was digested
with XhoI and KpnI and cloned in-frame into the pEGFP-C3
vector. The GFP-Cav1 plasmid was used to transform E. coli.
Individual clones were selected and sequenced.
The two internal deletion TRPC1 plasmids, TRPC1
271349 and
TRPC1
C
271349 (for details regarding TRPC1
C, see
Ref. 15; the TRPC1 aa sequence
is numbered to include the 8-aa HA sequence at the N terminus) were
constructed as follows. The constructs were first amplified separately from
two pairs of oligonucleotides: 1) 5'-ATCGATGTTTGGCCAGTCCAGCTCTAATAATG
and 2)
5'-CTTCTTACAGGTGGGCTTGCGTCGCCGGGCTAGTTCCTCATAATCATT-CCTGAATTCC;
as well as 3) 5'-CGACGCAAGCCCACCTGTAAGAAGATAATG and 4)
5'-GTATACATAAAAAAGAGACGAAGATAACTTAGAAC. The two PCR products, each
containing a stretch of overlapping DNA sequence as shown in the above
underlined nucleotides, were used as templates for another round of PCR
reaction with primers 1 and 4. This last reaction produced a TRPC1 DNA
fragment of 0.7 kb with an internal deletion from aa 271 to 349. It was
restriction digested with HpaI and Esp3I. The digested
fragment was gel cleaned and cloned into either pcDNA3-HA-TRPC1 or
pcDNA3-HA-
trp1 (15) to
construct the two plasmids TRPC1
271349 and
TRPC1
C
271349. The insert was confirmed by sequencing from
both directions prior to transfection of cells. The internal deletion TRPC1
plasmid TRPC1
322349 was constructed similarly by amplifying
TRPC1 fragments using oligonucleotides 1 and 5
CTTCTTACAGGTGGGCTTGCGTCGGATAGCAAGTTTTAGACGACTTAAATTCATTCTTTC; and 3
and 4. The two PCR products were manipulated as described above to generate
the desired TRPC1 deletion mutant. Cell Culture and
TransfectionConditions for culturing and transfecting the human
submandibular gland cells (HSG) have been described previously
(9). Madin-Darby canine kidney
(MDCK) cells were grown in Eagle's minimum essential medium, supplemented with
10% fetal calf serum, 2 mM L-glutamine, 100 units/ml penicillin,
and 100 µg/ml streptomycin (all from Biofluids, Rockville, MD). To
transfect cells stably with Cav1 plasmids, 1 µg of plasmid DNA was mixed
with Lipofect-AMINE reagent 2000 (Invitrogen) in serum-free medium. Cells were
incubated with this mixture for 5 h and then selected with 0.5 mg/ml G418
(Biofluids). Where indicated, control or HSG cells stably transfected with
either YFP-Cav1 or YFP-
Cav1 were infected with adenovirus encoding
TRPC1 (Ad-TRPC1, 10), at 5 multiplicity of infection for either 24 or 48
h.
Protein Extraction and Western Blot AnalysisCells were harvested from culture dishes, washed, and frozen as described previously (13). Frozen cells were thawed and homogenized with a Dounce homogenizer, diluted in sucrose buffer containing 0.25 M sucrose, 10 mM Tris-HEPES, pH 7.4, 1% (v/v) aprotinin, 1 mM dithiothreitol, 0.5 mM AEBSF, 0.167 mM pepstatin A, 0.167 mM leupeptin, and centrifuged at 1,600 x g for 15 min to remove the cell debris. The resulting supernatant was centrifuged at 30,000 x g for 1 h to obtain the lighter cytoplasmic fraction and the heavy membrane fraction. Both fractions were frozen and stored at -80 °C until further use. Where indicated, the cytoplasmic fraction was centrifuged further at 100,000 x g for 1 h to separate the soluble cytosolic fraction from the light membrane fraction. Protein concentration was determined using the Bio-Rad protein assay solution. Membranes were solubilized as described earlier (13). Proteins were separated on SDS-polyacrylamide gels and analyzed by Western blotting (13, 15). All primary antibodies were used at a dilution of 1:1,000 except for the horseradish peroxidase-conjugated HA and FLAG antibodies, which were used at 1:500.
Detergent Solubilization of HSG Cell Membranes and Immunoprecipitation1 mg of membrane fraction was incubated on ice for 20 min with 1% Triton X-100 and 0.5 M KI in 500 µl of 50 mM Tris-HCl, pH 7, 150 mM NaCl, and 5 mM EDTA buffer. The sample was then centrifuged at 4 °C at 125,000 x g for 1 h, and the pellet was resuspended in 500 µl of the same buffer as above. Equal amounts of detergent-soluble and -insoluble proteins were loaded on SDS-polyacrylamide gels for Western analysis. Immunoprecipitation was carried out with OG + KI solubilized fraction of crude membranes. Antibodies (anti-YFP, anti-HA, and anti-FLAG) were used at 1:200 dilution. Anti-HA- or antiFLAG-conjugated beads were used at a concentration of 50 µl/ml.
GST Fusion Protein Pull-down AssayThe N (aa 1347)
and C terminus (649793) of TRPC1 were cloned into pGEX5.1 (Amersham
Biosciences) vector using PCR-based strategy. Two liters each of E.
coli (BL-21)-expressing GST-N-TRPC1 and GST-C-TRPC1 were induced with
isopropyl-1-thio-
-D-galactopyranoside and purified as
described (11). HSG cells
expressing YFP-Cav1 or YFP-Cav1
51169, either with or without
HA-TRPC1, were harvested as described above. Frozen cells were thawed and
homogenized with a Dounce homogenizer and sonicated (three times, 10 s each).
An equal volume of 2x buffer containing 20 mM Tris-HEPES, pH
7.4, 300 mM NaCl, 2 mM dithiothreitol, 1 M
KI, 3% OG was added to the cell suspension. Samples were incubated on ice for
20 min and centrifuged at 145,000 x g for 1 h at 4 °C. 18
µg of purified GST-N-TRPC1 and 15 µg of GST-C-TRPC1 were incubated for
60 min with 1 mg of OG + KI-solubilized whole cell lysates. Proteins were
pulled down with 80 µl of GST beads and washed three times with wash
buffer. Proteins were released by boiling in SDS sample buffer, separated by
SDS-PAGE, and identified by Western blotting.
Yeast Two-hybrid AssayN-TRPC1 (aa 1347), C-TRPC1 (aa
649793), and five fragments of the TRPC1 N terminus (
N1, aa
186;
N2, aa 74153;
N3, aa 143213;
N4, aa 204280;
N5, aa 271349) were cloned into
pGBKT7 (GAL4 DNA binding domain; Clontech). Cav1
80169 (with
deletion of aa 80169 of Cav1) was cloned into pGADT7 (GAL4 DNA
activation domain; Clontech). Plasmids were used to transform the yeast
reporter strain AH 109 (Clontech), which was first grown on minimal synthetic
dropout (SD) plates without leucine and tryptophan to select for
transformants. Individual clones were further grown on SD plates without
leucine, tryptophan, histidine, and adenine. Clones that grew on SD plates
lacking all four amino acids were selected to be positive for protein-protein
interaction. A
-galactosidase assay was performed to confirm and
quantify the interactions as instructed by the Clontech Matchmaker System.
ImmunofluorescenceHSG or MDCK cells were plated on coverslips for 1 day. They were then fixed and processed for confocal microscopy as described before (34). For lipid raft labeling, the cholera toxin conjugate was added to cells at a final concentration of 10 µg/ml and incubated for 20 min at 37 °C. Cells were washed three times with phosphate-buffered saline and fixed as described (34). Images were collected by confocal microscopy (9).
[Ca2+]i MeasurementsFura2 fluorescence in single cells was measured by microfluorometry using a TILL Photonics spectrofluorometer (Polychrome 4, Applied Scientific Instrumentation and TILL Photonics Inc., Eugene, OR) attached to an inverted Nikon Diaphot microscope with a Fluor x40 oil immersion objective. Images were acquired using an enhanced CCD camera (CCD-72, DAGE-MTI) and the MetaFluor software (Universal Imaging Corporation). Analog plots of the fluorescence ratio (340/380) are shown.
| RESULTS |
|---|
|
|
|---|
|
Colocalization of Cav1 and TRPC1 proteins was confirmed further by immunoprecipitation of YFP-Cav1 with HA-TRPC1 (Fig. 1D). Both proteins were detected in the OG + KI-solubilized fraction of crude membranes isolated from cells expressing YFP-Cav1 and HA-TRPC1 (Fig. 1D, lane 1). The proteins were also detected in the immunoprecipitate (immunoprecipitates with anti-YFP antibody; Western blots using either anti-HA or anti-YFP antibodies (Fig. 1D, lane 2; note that these bands are not seen in control immunoprecipitates from nontransfected cells, data not shown). Together with our previous reports showing that endogenous TRPC1 or exogenously expressed TRPC1 is immunoprecipitated with endogenous Cav1 in HSG cells (13, 15), these data suggest that TRPC1 and Cav1 interact with each other. To examine this interaction in greater detail, GST fusion proteins of the N or C terminus of TRPC1 were made. Lysates from HSG cells expressing YFP-Cav1 (Fig. 1E, second lane) were passed through columns containing GST-N-TRPC1 or GST-C-TRPC1. YFP-Cav1 interacted with both the N and C terminus of TRPC1, although there was more binding with the C terminus (Fig. 1E, third and fourth lanes). Fig. 1E, first lane, shows that control GST protein does not bind Cav-1.
Identification and Functional Characterization of the Cav1 Binding
Domain in the N Terminus of TRPC1The data in
Fig. 1 are consistent with our
previous suggestion that TRPC1 has putative caveolin binding domains in both
the N and C terminus (13).
Although further studies will be required to determine the functional
consequences of the binding of the C terminus of TRPC1 to Cav1, we have
reported previously that C-terminal deletion of TRPC1 does not affect its
plasma membrane localization or decrease SOCE
(11,
15). Therefore, we
investigated further the Cav1 binding site on the TRPC1 N terminus. A mutant
of Cav1 was constructed, Cav1
80169, which lacked the scaffolding
domain, membrane anchoring domain, and the three palmitoylation sites and thus
could be used in a yeast two-hybrid assay. Interactions between this Cav1
mutant and the N and C terminus of TRPC1 were examined.
Cav1
80169 interacted with the TRPC1 N terminus but not the C
terminus (Fig. 2A)
thus providing us with a useful tool to examine Cav1 interactions with the
TRPC1 N terminus.
|
To map the Cav1 binding domain in the TRPC1 N terminus, sequences of TRPC1,
shown in Fig. 2B, were
cloned into the yeast two-hybrid vectors and screened against
Cav1
80169. Significant interaction was seen between Cav1 and
N5, aa 271349 (Fig.
2C). To determine the role of this Cav1 binding domain in
TRPC1 function, aa 271349 were deleted in HA-TRPC1
(HA-TRPC1
271349, Fig.
3A), and the protein was expressed in MDCK
(Fig. 3B, left
panel) or HSG cells (Fig.
3B, middle panel). In either cell type, plasma
membrane localization of the protein was disrupted, and an intracellular
localization was seen. Similar deletion was made in the N terminus of
TRPC1
664793, which lacks the entire C terminus
(HA-TRPC1
C
271349; Fig.
3A), and the protein was expressed in HSG. Although
TRPC1
664793 was localized in the plasma membrane region (not
shown here, see Ref. 15),
further deletion of aa 271349 in this protein disrupted its plasma
membrane localization (Fig.
3B, right panel).
Fig. 3C shows the
expression of HA-TRPC1
271349 and
HA-TRPC1
C
271349 compared with that of full-length
HA-TRPC1.
|
Further, SOCE was measured in cells transiently expressing
HA-TRPC1
271349 (Fig.
3D). Thapsigargin (Tg)-stimulated internal
Ca2+ release was not altered significantly by the expression of
HA-TRPC1
271349 in HSG cells. When 1 mM calcium was
added externally, control HSG cells showed an immediate increase in internal
[Ca2+] (Fig.
3D, left panel). Importantly, this increase,
representing SOCE, was significantly decreased in HSG cells expressing
TRPC1
271349 compared with that in control HSG cells
(Fig. 3D, right
panel; for average data, see also Fig.
3E). Thus, in contrast to expression of full-length
HA-TRPC1, which induces an increase in SOCE, HA-TRPC1
271349
induced a dominant suppression of SOCE.
We had suggested previously that the TRPC1 sequence aa 322349
includes the caveolin binding motif
(13). Importantly, this motif
appears to be conserved in a number of TRPC proteins
(Fig. 4A). Thus, we
deleted aa 322349 in TRPC1 (HA-TRPC1
322349,
Fig. 4B) and expressed
this protein in HSG cells. Consistent with the results shown in
Fig. 3C, deletion of
this domain from TRPC1 altered the localization of the protein. TRPC1 was seen
to be distributed intracellularly rather than in the plasma membrane
(Fig. 4C, compare
left panel with middle and right panels). Further,
SOCE was also suppressed in these cells (data not shown). TRPC1 monomers have
been suggested to form homomultimers via N-terminal interactions
(33,
35,
36). Based on these previous
studies, we suggest that HA-TRPC1
271349 and
HA-TRPC1
322349 likely interact with endogenous TRPC1 and retain
it intracellularly. This would induce a decrease in functional plasma membrane
SOCE channels and account for the decrease in SOCE. This is demonstrated in
Fig. 4D, which shows
that HA-TRPC1
322349 was immunoprecipitated with FLAG-TRPC1 when
the two proteins were coexpressed, demonstrating that it retains the ability
to interact with wild-type TRPC1. These data can account for the suppression
of SOCE in cells expressing the mutant TRPC1 proteins. In aggregate, the
results presented above strongly suggest that the N-terminal Cav1 binding
domain, aa 322349, of TRPC1 is involved in the plasma membrane
localization of the protein and thus contributes to SOCE.
|
Effect of YFP-Cav1
51169 on SOCETo
understand further the role of Cav1 in TRPC1 localization, we examined the
effect of a Cav1 mutant that lacked the protein scaffolding and membrane
anchoring domains (with YFP fused at the N terminus,
YFP-Cav1
51169). Fig.
5A shows that YFP-Cav1
51169 is pulled down
by GST-N-TRPC1 but not GST-C-TRPC1. Because YFP-Cav1
51169 lacks
its proposed protein scaffolding domain, we presently do not understand how it
binds to GST-N-TRPC1. It is likely that other domains of Cav-1 or
oligomerization with WT-Cav1 are involved in this interaction. When stably
expressed in HSG cells, YFP-Cav1
51169 displayed an intracellular
localization that was diffused over the entire cytoplasm and the nucleus
(Fig. 5, B and
C, left panels, green signal). Importantly, in
cells expressing YFP-Cav1
51169, there was a diffused
intracellular localization of endogenous TRPC1
(Fig. 5B, middle
panel, red signal), or exogenously expressed HA-TRPC1
(Fig. 5C, middle
panel, red signal). Furthermore, there was no colocalization of TRPC1 and
YFP-Cav1
51169 in the plasma membrane region of these cells, but
rather overlay of red and green fluorescence was detected inside the cells
(see arrowheads in Fig. 5,
B and C, right panels, yellow signal;
compare with localization of yellow signal in
Fig. 1).
|
The effect of YFP-Cav1
51169 on Carbachol (CCh)- and
Tg-stimulated Ca2+ increases was also measured
(Fig. 5, DG).
In YFP-Cav1
51169-expressing HSG cells, the SOCE was
substantially delayed and significantly lower (compare second peaks in
Fig. 5, D and
F, with those in Fig. E and G).
Fig. 5, H and
I, show average data and statistical evaluations. In
separate experiments, HA-TRPC1 was transiently expressed in
YFP-Cav1
51169-expressing cells or in control HSG cells, and
similar procedures were carried out (traces not shown). Tg- or CCh-stimulated
SOCE was significantly higher in HSG cells infected with Ad-TRPC1 (average
peak fluorescence ratios were 5.7 ± 0.22 and 6.04 ± 0.32 in
TRPC1-expressing cells compared with 3.5 ± 0.42 and 4.2 ± 0.35
in control cells with CCh and Tg, respectively). However, when TRPC1 was
coexpressed in YFP-Cav1
51169-expressing cells, SOCE was
significantly lower compared with the control HSG cells (average data as shown
in Fig. 5, J and
K).
Membrane Interactions and Detergent Solubility of
YFP-Cav1
51169 and
TRPC1Fig.
6A shows subcellular fractions from control HSG cells
(1), and cells expressing the full-length (2) or mutant
(3) YFP-Cav-1. YFP-Cav1 was relatively enriched in the light and
heavy membrane fraction (Lm and Hm, respectively). On the
other hand, most of the YFP-Cav1
51170 proteins remained in the
cytosolic fraction (Cs). We also examined the presence of HA-TRPC1 in
these same cellular fractions using anti-HA antibody
(Fig. 6B). The
expressed HA-TRPC1 was relatively enriched in the heavy membrane fraction in
control HSG cells as well as cells stably expressing the YFP-Cav1 or
YFP-Cav1
51170. However, more TRPC1 associated with the lighter
membrane fraction in Cav1
51170 cells than in Cav1 cells (compare
Lm in 2 and 3).
|
Detergent (Triton X-100) insolubility of proteins has been used as a
criterion for their association with lipid rafts
(23,
29). Previously we showed that
a major proportion of the endogenous TRPC1 in HSG cells is detergent-insoluble
(13). Here we examined the
detergent solubility of the full-length and mutant caveolins as well as that
of HA-TRPC1 in HSG cell expressing these exogenous caveolins. YFP-Cav1 was
relatively enriched in the Triton X-100-resistant pellet
(Fig. 6C,
2-P). In contrast, the small fraction of YFP-Cav1
51170
which was associated with membranes was completely solubilized by Triton X-100
(Fig. 6C,
3-S). In the control HSG cells, HA-TRPC1 was relatively enriched in
the Triton X-100-insoluble pellet, although it was also detected in the
soluble fraction (Fig.
6D, first and second lanes). HA-TRPC1
in cells expressing YFP-Cav1 was much more enriched in the Triton
X-100-resistant pellet than in the soluble fraction
(Fig. 6D,
third and fourth lanes). Importantly, HA-TRPC1 in cells
expressing YFP-Cav1
50170 was relatively more soluble in Triton
X-100 (Fig. 6D,
fifth and sixth lanes). Together with the immunolocalization
pattern of TRPC1, these data suggest that the localization of HA-TRPC1 in
caveolar-lipid raft domains is disrupted by expression of
YFP-Cav1
50170. However, this was not caused by a general
disruption of plasma membrane lipid raft domains, as assessed by examining the
binding of cholera toxin subunit B conjugate to HSG cells
(37). Full-length Cav1 is
localized to the plasma membrane, whereas the truncated Cav1 is detected in
intracellular region in HSG cells (Fig.
6E). Cholera toxin similarly labeled the plasma membrane
in control HSG cells and in cells expressing either the full-length or
truncated Cav1 (Fig.
6F). Some signal was also detected inside the cell,
suggesting internalization of a small amount of toxin during the incubation
period.
| DISCUSSION |
|---|
|
|
|---|
The data presented above demonstrate that Cav1 is a critical protein in the mechanism of SOCE. Consistent with our previous suggestions (13), the present data demonstrate that there are two caveolin binding sites in TRPC1. Significantly, deletion of the N-terminal Cav1 binding domain in full-length or C-terminal truncated TRPC1 prevented plasma membrane localization of the protein. In contrast, we have reported earlier that truncation of the C terminus itself, which includes the C-terminal Cav1 binding site, does not alter localization of TRPC1 (11, 15). These data suggest that plasma membrane localization of TRPC1 depends on the interaction of its N terminus, but not the C terminus, with Cav1. We have further shown that plasma membrane localization of both endogenous and exogenously expressed TRPC1 was disrupted when a mutant Cav1, lacking its protein scaffolding and membrane anchoring domains, was expressed in the cells. Our data show that this was not because of a generalized disruption of plasma membrane lipid raft domains. We have also shown that this mutant Cav1 interacts with wild-type TRPC1, although we do not yet understand how it interacts with TRPC1. However, because it lacks the membrane scaffolding domains, we hypothesize that the effect on TRPC1 localization is caused by the inability of this mutant Cav1 to anchor to the plasma membrane.
The role of Cav1 in the plasma membrane localization of TRPC1 is more clearly shown by our data that TRPC1 lacking the N-terminal Cav1 binding domain is not localized in the plasma membrane and failed to increase SOCE. Instead, it exerted a dominant negative effect on the SOCE and significantly reduced Tg-stimulated Ca2+ influx. In contrast, fulllength TRPC1 induced a 1.52.0-fold increase in SOCE. Together with our data showing that this mutant TRPC1 can interact with wild-type TRPC1, these data strongly suggest that TRPC1-Cav1 interactions play an important role in the generation of functional SOCE channels in the plasma membrane. Previously reported studies suggest that TRPC1 monomers interact with each other and with other TRPC proteins to form SOCE channels (35, 36, 40). Consistent with this, we have also observed that exogenously expressed TRPC1 interacts with each other and with the endogenous TRPC1 protein in HSG cells (33). Based on these data we suggest that TRPC1 lacking the N-terminal Cav1 domain interacts with the endogenous TRPC1 protein in HSG cells and thus prevents it from being routed to the plasma membrane. The resulting decrease in functional SOCE channels on the cell surface accounts for the loss of SOCE. An important implication of these data is that coassembly of the TRPC monomers takes place prior to plasma membrane insertion. An alternative explanation of our data is that TRPC1-Cav1 interaction is required for the retention of TRPC1 heteromers in the plasma membrane. Further studies will be needed to determine whether Cav1 is the scaffold that allows retention of TRPC1 in the plasma membrane or if it is involved in trafficking of the protein to the cell surface where it is assembled into SOCE channels. Irrespective of this, our data demonstrate that Cav1 has an important role in plasma membrane organization of functional TRPC1-containing SOCE channels.
Our data also suggest that not all components in the TRPC1 signaling
complex are trafficked together. We have shown that CCh-stimulated internal
Ca2+ release is not altered by expression of
Cav1
51169, which demonstrates that the signaling proteins
proximal to TRPC1 are functionally intact. A number of signaling proteins that
are acylated, such as H-ras and Ga subunit of heterotrimeric G
proteins, do not require Cav1 for sorting to the plasma membrane caveolae.
Rather, they are trafficked directly to the plasma membrane and are anchored
to the caveolae via their acyl side chains. TRPC1, however, does not appear to
have any known consensus sequences for lipid modification. This is consistent
with our suggestion that TRPC1 is recruited to the plasma membrane via a
direct interaction of its N terminus with Cav1. Our data demonstrate that Cav1
is required for the localization of TRPC1 in plasma membrane lipid raft
domains. Further, we have shown that the biochemical characteristics of TRPC1
are altered in cells expressing Cav1
51169. TRPC1 from these
cells was relatively more soluble in detergent than from cells expressing
full-length Cav1. Consistent with this, the biochemical characteristics of
YFP-Cav1
51169 were dramatically altered compared with those of
full-length caveolin. It was relatively enriched in the cytosolic fraction
rather than in the membrane fraction, and the small fraction of this protein
that was membrane-associated appeared to be completely soluble in Triton
X-100. In aggregate, these data demonstrate that interaction of TRPC1 with
Cav1 plays a critical role in the trafficking of TRPC1 to plasma membrane
lipid raft domains where it is assembled into a signaling complex with other
key Ca2+ signaling proteins. Our present study does not exclude the
possibility that Cav1 might exert additional effects on TRPC1 via its binding
to the C terminus. For example, apart from acting as a platform for the
assembly of signaling complexes, Cav1 also functions as a negative regulator
holding signaling proteins such as eNOS, protein kinase C, and heterotrimeric
G protein, in a basal, resting state
(41,
42) and is involved in
vesicular trafficking
(43).
In conclusion, although SOCE was first described more than a decade ago, the mechanisms involved in its regulation are not yet known. An increasing number of studies suggest that SOCE is associated with a plasma membrane signaling complex that includes key Ca2+ signaling proteins. Consistent with this, a number of TRPC channels, e.g. TRPC1, TRPC3, and TRPC4, have been reported to be associated with one or more members of this signalplex. Previous studies from our laboratory and others have shown that TRPC1 is a molecular component of SOCE channels in several cell types (58, 911, 15, 33). Further, we had reported that TRPC1 is assembled in a signaling complex with Cav1 (1315). Here we have demonstrated that plasma membrane localization of TRPC1 depends on an N-terminal Cav1 binding site. Importantly, disruption of plasma membrane localization of TRPC1 suppressed SOCE. Based on our present and previous data, we suggest that Cav1 contributes to the assembly of TRPC1-containing SOCE channels in plasma membrane caveolar lipid raft domains. Further studies will be required to determine exactly how stimulation of the Ca2+ signaling cascade results in activation of these SOCE channels.
| FOOTNOTES |
|---|
To whom correspondence should be addressed: Bldg. 10, Rm. 1N-113, National
Institutes of Health, Bethesda, MD 20892. Tel.: 301-496-5298; Fax:
301-402-1228; E-mail:
indu.ambudkar{at}nih.gov.
1 The abbreviations used are: SOCE, store-operated Ca2+ entry; aa,
amino acid(s); Ad, adenovirus; AEBSF, 4-(2-aminoethyl)-benzenesulfonyl
fluoride; Cav, caveolin-1; CCh, carbachol; GFP, green fluorescent protein;
GST, glutathione S-transferase; HA, hemagglutinin; HSG cells, human
submandibular gland cells; MDCK, Madin-Darby canine kidney; Tg, thapsigargin;
YFP, yellow fluorescent protein; TRPC, transient receptor potential canonical;
INAD, inactivation-no-after potential D; OG,
n-octyl-
-D-glycopyranoside. ![]()
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
T. Cai, H. Wang, Y. Chen, L. Liu, W. T Gunning, L. E. M. Quintas, and Z.-J. Xie Regulation of caveolin-1 membrane trafficking by the Na/K-ATPase J. Cell Biol., September 22, 2008; 182(6): 1153 - 1169. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. L. Gervasio, N. P. Whitehead, E. W. Yeung, W. D. Phillips, and D. G. Allen TRPC1 binds to caveolin-3 and is regulated by Src kinase - role in Duchenne muscular dystrophy J. Cell Sci., July 1, 2008; 121(13): 2246 - 2255. [Abstract] [Full Text] [PDF] |
||||