|
Originally published In Press as doi:10.1074/jbc.M204392200 on November 6, 2002
J. Biol. Chem., Vol. 278, Issue 3, 1533-1541, January 17, 2003
Characterization of the c-Myb-responsive Region and
Regulation of the Human Type I Collagen 2 Chain Gene by c-Myb*
Michele M.
Luchetti §,
Paolo
Paroncini ,
Petra
Majlingovà ,
Jon
Frampton¶ ,
Michael
Mucenski**,
Silvia Svegliati
Baroni ,
Paola
Sambo ,
Josee
Golay ,
Martino
Introna , and
Armando
Gabrielli
From the Laboratorio di Medicina Molecolare, Istituto
di Clinica Medica, Ematologia ed Immunologia Clinica, Università
di Ancona, 60020 Ancona, Italy, ¶ Division of Immunity and
Infection, Birmingham University Medical School,
Birmingham B15 2TT, United Kingdom, ** Division of
Pulmonary Biology, Children's Hospital Medical Center,
Cincinnati, Ohio 45229-3039, and
 Dipartimento di Immunologia e Biologia
Cellulare, Istituto Ricerche Farmacologiche Mario Negri,
20154 Milano, Italy
Received for publication, May 6, 2002, and in revised form, November 5, 2002
 |
ABSTRACT |
We have characterized the role of c-Myb and B-Myb
in the regulation of human type I collagen 2 chain gene expression
in fibroblastic cells. We have identified four Myb-binding sites (MBSs)
in the promoter. Transactivation assays on wild type and mutant
promoter-reporter constructs demonstrated that c-Myb, but not B-Myb,
can transactivate the human type I collagen 2 chain gene promoter
via the MBS-containing region. Electrophoretic mobility shift assay
experiments showed that c-Myb specifically binds to each of the four
MBS; however, the mutagenesis of site MBS-4 completely inhibited
transactivation by c-Myb, at least in the full-length promoter. In
agreement with these results, c-myb / mouse
embryo fibroblasts (MEFs) showed a selective lack of expression of type
I collagen 2 chain gene but maintained the expression of fibronectin
and type III collagen. Furthermore, transforming growth factor-
induced type I collagen 2 chain gene expression in
c-myb / MEFs, implying that the transforming
growth factor- signaling pathway is maintained and that the absence
of COL1A2 gene expression in
c-myb / MEFs is a direct consequence of the
lack of c-Myb. The demonstration of the importance of c-Myb in the
regulation of the type I collagen 2 chain gene suggests that
uncontrolled expression of c-Myb could be an underlying mechanism in
the pathogenesis of several fibrotic disorders.
 |
INTRODUCTION |
The myb oncogene family is composed of
c-myb, A-myb, and B-myb genes, each
encoding a distinct nuclear protein that displays transcription factor
activity (1). The myb genes are structurally related, and
initially they were believed to be expressed only in hematopoietic
cells, where they were found to play a pivotal role in the regulation
of growth and development (2-5). However, the different myb
family members have been reported to be expressed and to function in
some other cell types. Hence, although little information is available
relating to A-Myb, it has been demonstrated that c-Myb and B-Myb are
expressed in epithelial cells (6) and fibroblasts (7). In the latter
cells, the role of the Myb proteins has not been completely elucidated,
and despite their structural homology and similar patterns of
expression, B-Myb and c-Myb may exert opposite effects through
the repression or activation of the same gene(s) (9-13). With regard
to c-Myb, it has been demonstrated that it can induce insulin-like
growth factor-1-independent growth (14) and that it can control
fibroblast proliferation through the regulation of the intracellular
Ca2+ concentration (15) as well as the expression of cell
cycle-related genes, such as proliferating cell nuclear antigen
(16).
c-Myb protein can activate or repress gene transcription by binding
directly to the promoters of genes as in the case of mim-1 (17), cdc2 (18), c-myc (19, 20), CD4 (21), the
human T-cell lymphotrophic virus, type I, long terminal repeat (22), and c-myb itself (23). However, despite intensive
investigations, not many genes regulated by c-Myb have been identified
so far.
Following the finding of abnormal expression of the c-myb
gene in quiescent scleroderma fibroblasts, a disease characterized by
an augmented production of extracellular matrix protein, we have
speculated that c-Myb but not B-Myb could be involved in the
up-regulation of the type I collagen promoter (8). However, the
employment of animal and not human type I collagen promoters, the use
of the 3T3 fibroblast cell line rather than human fibroblasts, and the
lack of identification and characterization of the region of the
promoter involved in c-Myb binding has left open the issue of whether
c-Myb can modulate collagen gene expression (24).
In view of the potential relevance of this finding for the
understanding of the pathogenesis of scleroderma and of fibrotic disease in general, we have therefore decided to elucidate more exhaustively the role of c-Myb and B-Myb in the expression of the human
type I collagen gene. We have cloned the type I collagen 2 chain
(COL1A2) promoter and screened it for the presence of potential Myb-binding sites
(MBSs).1 Transactivation of
the COL1A2 promoter by c-Myb and B-Myb has then been
investigated in human fibroblasts and human fibroblast cell lines, and
the regions of the promoter that are critical for Myb-mediated
transactivation have been determined. Finally, the requirement for
c-Myb in the expression of the type I collagen 2 chain gene has been
demonstrated by comparison of embryonic fibroblasts derived from wild
type and c-myb / mice and of
normal human skin fibroblasts overexpressing c-Myb or a dominant
negative c-Myb derivative.
 |
EXPERIMENTAL PROCEDURES |
Computer Analysis of the Putative Myb-binding Sites Contained in
the COL1A2 Promoter--
The whole DNA sequence of the COL1A1 and
COL1A2 promoters (GenBankTM accession
numbers J03559, U06669, and AF004877, respectively) was subjected to
computer analysis and screened for putative MBSs using the software
MatInspector version 2.2 (25). The computer analysis utilized matrices
derived from the published MBSs consensus sequence (26-28), and
results were expressed in matrix similarity, where a value of 1 corresponds to complete homology.
Cloning of the Human COL1A2 Promoter--
The 5'-flanking region
of human COL1A2 gene, spanning from 2430 to +5 bp
(according to the GenBankTM accession number AF004877)
containing a CAAT-binding site ( 220) and a TATA box ( 170), was
cloned from genomic DNA of human fibroblasts using a PCR approach.
Briefly, fibroblast genomic DNA was extracted from monolayer cultures
of normal human fibroblasts using a commercial kit (Qiagen) according
to the manufacturer's instructions. Genomic DNA (250 ng) was amplified
in a final volume of 50 µl containing 50 mM KCl, 10 mM Tris-HCl, 1.5 mM MgCl2, 0.2 mM each dNTP, and 15 pmol of forward and reverse primers
(COL-F, TTACCACCCTGAGTCATTTTGC, and COL-B, GCACTTAGACATGCAGACTCCT), and 2 units of LA-Taq polymerase (Takara). PCR (20 cycles of 1 min at 95 °C, 1 min at 55 °C, and 3 min at 70 °C) was carried
out in a PTC-200 thermal cycler (MJ Research). The resulting DNA
fragment of 2430 bp was extracted from a 1% agarose gel, purified
using Geneclean kit (Qiagen) and cloned within the multiple cloning site region (mcsr) of the pT-Adv vector
(Clontech) using standard ligation procedure. Both
strands of the COL1A2 promoter inserted in the recombinant
plasmid pTCOL1A2-P were extensively sequenced to exclude the
possibility of random mutations inserted by PCR. The COL1A2
promoter was further digested from pTCOL1A2-P using SacI and EcoRV, gel-purified, and subcloned
between the SacI and SmaI sites upstream of the
firefly luciferase gene of the Promega vectors pGL3-Basic (pGbC1A2-P)
and pGL3-Enhancer (pGECA2-P) in which the SV40 enhancer sequences are
located downstream of the mcsr. Briefly, 100 ng of
COL1A2 promoter DNA was mixed with 30 ng of vector in 66 mM Tris-HCl, pH 7.6, 6.6 mM MgCl2,
10 mM DTT, 0.1 mM ATP, 2 µM
Hexamino-CoCl, and 450 units of T4 DNA ligase. The ligation mix was
incubated at 14 °C overnight, and 3 µl of the mix were used to
transform DH5- competent bacteria.
Plasmids--
The pGbC1A2-P and p-GECA-P recombinant plasmids
were derived as described above. The pGL-KHK plasmid was created by
digesting KHK-CAT (24) with BamHI and HindIII.
The resulting DNA fragment containing the KHK synthetic promoter was
purified by gel electrophoresis and blunted in a mix containing
100 µM of each dNTP, 0.01% BSA, 33 mM Tris
acetate, pH 7.9, 66 mM potassium acetate, 10 mM magnesium acetate, 0.5 mM DTT, and 4 units
of T4 DNA polymerase. The blunted KHK promoter was then subcloned into
the SmaI site of the pGL3-Basic mcsr, upstream
from the firefly luciferase gene.
The pQCM plasmid, used for the production of the c-Myb recombinant
protein, was obtained by digesting pSGC-myb, carrying the full-length
coding region of the human c-myb gene, with NcoI
and BglII and subcloning the resulting c-myb gene
fragment (+1 to +1200 bp) upstream and in-frame with a His6
tag into the NcoI/BglII sites of the pQE-60
plasmid mcsr (Qiagen, Hilden, Germany). This c-myb DNA fragment contained the sequences encoding the
R1-R3 domains that are necessary for c-Myb DNA binding activity. The pSGC and pSGB plasmids, containing the entire coding region of the
c-myb and B-myb genes, respectively, and the pCys
130 plasmid, carrying the entire coding region of c-myb gene
mutated at codon 130, have already been described (24). The pGREMyb
plasmid, containing the full coding region of the c-myb
gene, and the pGREMen plasmid, in which sequences encoding the R2 and
R3 domains of c-Myb and the Drosophila engrailed gene
encoding the alanine-rich repressor domain (15), are linked (a kind
gift of Prof. M. Simons, Angiogenesis Research Center, Cardiovascular
Division, Boston).
All recombinant plasmids were grown and further purified using the
Endofree maxiprep method (Qiagen, Hilden, Germany).
Nested Deletions of the Human COL1A2 Promoter--
The
pTCOL1A2-P plasmid was used in PCRs to obtain the promoter
deletions. Nested primers starting from different regions of the
COL1A2 promoter (del1F-1500, AGCCTTTCAAACCTAGGGCCTG; del
2F-1269, GCCTCAGCAAAGGCAAGCTAG; del3F-950, TGGAGCCCTCCACCCTACAA;
del4F-575, GGACAGCTCCTGCTTTATCG; and del5F-290, TTCGCTCCCTCCTCTGCGCCC)
and a backward primer (GCCCATCTGCAGAATTCGGCTT) were used in PCRs
to generate five different DNA fragments spanning from 1500 to 290. Because the first two MBSs are closely located at position 1025 and
1045, it was not possible to separate them efficiently, and therefore
they were both deleted in the pGLD-1269 plasmid. Template DNA (250 ng)
was amplified in a final volume of 50 µl containing 50 mM
KCl, 10 mM Tris-HCl, 2 mM MgCl2,
0.2 mM each dNTP, 15 pmol of each primer, and 2 units of
LA-Taq polymerase (Takara, Otsu, Shiga, Japan). PCRs (1 min
at 95 °C, 1 min at 55 °C, and 3 min at 70 °C) were carried out
in an MJ Research PTC-200 thermal cycler for 20 cycles. Each fragment
was gel-purified and subcloned into the mcsr of pT-Adv
vector (Clontech, Palo Alto, CA) and thereafter into the SacI-SmaI sites of the pGL3Basic plasmid
mcsr to obtain the pGLD-1500, pGLD-1269, pGLD-950, pGLD-575,
and pGLD-290 recombinant plasmids, respectively. The pGLD1095 plasmid
was obtained by the digestion of pGbC1A2-P with NcoI, and
the resulting COL1A2 promoter fragment, spanning from
position 1095 to the NcoI site of the pGL3-Basic vector,
was subcloned within the NcoI site of the pGL3-Basic vector
mcsr. All plasmids were extensively sequenced to check for
mutations introduced by PCR.
Site-directed Mutagenesis--
The pGbC1A2-P and pGL-D1095
plasmids, containing only one MBS at position 1000, were used as
templates for site-directed mutagenesis. The sequences of the
primers used are as follows: MBM-1,
CGGTCTCCAGGTCGATATCAGTCGTGTCGGAGTGCCAG; MBM-2,
CGGTCTCCAGGTCACTAGTAGTCGTGTCGGAGTGCCAG; MBM-3,
CGGTCCCAGGTCCGCGGTAGTCGTGTCGGAGTGCCAG, both in the sense and
antisense orientations and each incorporating a restriction enzyme
(EcoRV, SpeI, and SacII, respectively)
for the screening of recombinant mutated plasmids. Only the MBM-3
primers were used to mutagenize the MBS-4 of the pGbC1A2-P plasmid
(containing the full-length COL1A2 promoter). The
site-directed mutagenesis was achieved using the "Ex-Site PCR-based
Site-directed Mutagenesis" kit (Stratagene, La Jolla, CA). Each
primer was phosphorylated at 37 °C for 30 min in 1× kinase buffer
(Takara, Otsu, Shiga, Japan) containing 10 units of T4 polynucleotide
kinase (Takara, Otsu, Shiga, Japan). 30 pmol of phosphorylated sense
and antisense primers were then used in a mix containing 400 ng of
template DNA, 5 units of Exsite DNA polymerase blend, 0.2 mM dNTPs, 20 mM Tris-HCl, pH 8.8, 10 mM KCl, 10 mM
(NH4)2SO4, 2 mM Mg
SO4, 0.1% Triton X-100, 0.1 mg/ml BSA. The PCR was carried
out in an MJ Research PTC-200 Thermal Cycler. At the end of the
reaction, 10 units of DpnI restriction enzyme and 2.5 units
of Pfu polymerase were added, and the mix was incubated at
37 °C for 2 h and 72 °C for 1 h. An aliquot of PCR
products was further ligated at 14 °C overnight with 5 mM rATP and 4 units of T4 DNA ligase in 10 mM
Tris-HCl, pH 8.8, 5 mM KCl, 5 mM
(NH4)2SO4, 0.1% Triton X-100, 0.1 mg/ml BSA. Ten microliters of the reaction were used to transform
XL-1-Blue competent bacteria. All recombinant plasmids were screened
for the inserted mutations using the above-mentioned restriction
enzymes, and thereafter both strands were extensively sequenced using a
CEQ-2000 DNA sequencing instrument (Beckman Instruments, Palo Alto, CA).
Cells and Cell Cultures--
Normal human skin fibroblasts (NSF)
were obtained from punch biopsies taken from the forearms of healthy
subjects. Primary explant cultures were established in
25-cm2 culture flasks in minimum Eagle's medium containing
10% FCS, 2 mM glutamine, penicillin (100 units/ml),
streptomycin (100 µg/ml), and amphotericin B (0.25 mg/ml). Minimum
Eagle's medium with these supplements is hereafter referred to as
"culture medium." Normal fibroblast human cell lines WS-1, HUDE,
and HFL-1 were purchased from ATTC and grown in Dulbecco's modified
Eagle's medium containing 10% FCS, 2 mM glutamine,
penicillin (100 units/ml), streptomycin (100 µg/ml), and amphotericin
B (0.25 mg/ml). Normal human fibroblastic cell lines transfected with
pGreMyb and pGreMen plasmids were grown in culture medium containing
0.2 µM dexamethasone (15). Monolayer cultures were
maintained at 37 °C in 5% CO2. Fibroblasts at the fifth
passage were used for all experiments. c-myb knock-out (c-myb / ) (29) embryonic
fibroblasts (MEFs) were cultured in Dulbecco's modified Eagle's
medium containing 20% FCS, 2 mM glutamine, penicillin (100 units/ml), streptomycin (100 µg/ml), and amphotericin B (0.25 mg/ml).
Fibroblasts at the fourth passage were used for Northern blot analysis.
For the stimulation experiments of wt and
c-myb / MEFs, recombinant TGF- was used at
a final concentration of 2 ng/ml.
Cell Transfection--
For transfection experiments, confluent
fibroblasts were harvested with trypsin and plated in 60-mm dishes in
culture medium. After 24 h, the medium was discarded, replaced
with fresh culture medium, and the cells transfected. Transfection
experiments were carried out in triplicate using a liposomal method
(Effectene, Qiagen) in the presence of an Enhancer and a DNA
condensation buffer (according to the manufacturer's instructions).
Plasmid DNA was purified with Endofree maxi-kit (Qiagen) to remove
bacterial endotoxins. Cells were transfected with a mix containing 0.7 µg of reporter plasmid ± 1.5 µg of effector plasmid, 8 µl
of Enhancer, 25 µl/µg DNA of Effectene, and culture medium
containing 10% FCS. To control transfection efficiency, the pRLSV
reporter plasmid (Promega), coding for Renilla luciferase,
was used in all experiments at a concentration of 0.05 µg/60-mm dish.
After 12 h, the medium was changed, and 24 h later the cells
were harvested and lysed in 100 µl of PBL buffer (Promega). Following
the manufacturer's instructions, 20 µl of the supernatant were used
in the "Dual Reporter Luciferase Assay" in which the activities of
firefly and Renilla luciferases are sequentially measured
from a single sample using two different enzymatic substrates. The
luciferase activities of the samples were measured with a TD-20/20
luminometer (Turner design), and the ratio of Renilla to
firefly luciferase values was used to normalize all of the transfection experiments.
Western Blot Analysis--
Cleared cell lysates, obtained from
NSF cells that had been cultured and transfected as described above,
were precipitated with 20% trichloroacetic acid, and aliquots
containing the same amount of protein were subjected to SDS-PAGE on
10% gels, according to standard procedures. The transfer from the gels
to nitrocellulose membranes (Bio-Rad) was achieved using a Trans Blot
Cell apparatus (Bio-Rad), and blotting was performed at 4 °C, 30 V
overnight in 25 mM Tris, 192 mM glycine, 20%
(v/v) methanol, 3.5 mM SDS. To ensure that comparable
amounts of proteins had been transferred to the nitrocellulose
membranes, proteins were revealed by staining with 0.05% (v/v) Ponceau
S (Sigma) for 1 min. The blots were then rinsed in TBS (50 mM Tris, 170 mM NaCl, 0.2% (v/v) Tween 20, pH 7.5) and incubated for 4 h in Blotto solution (TBS containing 5%
non-fat dried milk), before incubating overnight at 4 °C with rabbit
anti-c-Myb (Geneka) diluted 1:1000 in Blotto solution. The blots were
rinsed in TBS with several changes and then incubated for 60 min at
room temperature in a horseradish peroxidase-labeled donkey anti-rabbit
IgG (Amersham Biosciences) diluted 1:1000 in TBS. After further
washing, bound antibodies were detected using enhanced
chemiluminescence detection reagents (Amersham Biosciences). Images
were analyzed using a Molecular Images FX (Bio-Rad).
Production of the Recombinant Myb-HIS Fusion Protein--
pQCM
and the control plasmid pQE40 (Qiagen) were used to transform pREP-MC5
chemicompetent bacteria (Qiagen, Hilden, Germany). Single bacterial
colonies were picked from LB plates, grown in an orbital shaker at
37 °C in NZYC broth, and induced with 0.5 mM
isopropylthiogalactoside for 5 h. An aliquot of the culture was
lysed in 8 M urea and subjected to Western blot analysis to check the expression of recombinant proteins using the Penta-HIS antibody (a mouse monoclonal IgG1 antibody raised against the His6 tag coupled to horseradish peroxidase, Qiagen, Hilden,
Germany). Western blot analyses were carried out as described above and following the manufacturer's experimental conditions with minor variations. The batch purification of Myb-HIS recombinant protein was
achieved using an extraction method under native conditions. Briefly,
bacterial pellets were resuspended in 5 ml/g of B-PER II reagent
(Pierce) containing 20 mM imidazole and 0.1 mM
phenylmethylsulfonyl fluoride, briefly vortexed, and then incubated at
room temperature for 30 min. Thereafter, the solution was centrifuged
at 4 °C for 30 min, and the cleared lysate was recovered. 2 ml of
50% nickel-nitrilotriacetic acid slurry matrix (Qiagen, Hilden,
Germany) were added to the lysate and gently mixed by shaking at
4 °C for 1 h. The lysate/nickel-nitrilotriacetic acid mixture
was loaded onto a column, washed twice with 50 mM NaH2PO4, 300 mM NaCl, and Myb-HIS
recombinant protein was eluted with 50 mM
NaH2PO4, 300 mM NaCl, 250 mM imidazole. The purity of Myb-HIS recombinant protein in
the eluate was assessed by Western blot analyses using the Penta-HIS
antibody described above.
Electrophoretic Mobility Shift Assay (EMSA)--
EMSA
experiments were carried out using the Myb-HIS recombinant protein and
four double-stranded oligonucleotides (MBS-1, CCTCTCCCTAGTAGGGAGTGGAGGGTTGGATGGAGGCGGC; MBS-2,
TGGAGGCGGCCAGAGAAGAGGGAAGTTGGGTGCTGGGGAGAGAGTTAACA; MBS-3,
GGACCGGGGGGCTCACGGGAGGGTTGAAGGGTCCAGCTC; and MBS-4,
GTTCTCGGTCTCCAGGTCGGTTGGAGTCGTGTCGGACTGC), the sequences of which
(listed from 5' to 3') are complementary to COL1A2 promoter
regions that contain each of the four MBS (see Fig. 1A). The
gel-purified KHK promoter, obtained by the digestion of the pGL-KHK
plasmid with HindIII and BamHI, was used as a
cold competitor. Anti-c-Myb polyclonal antibody (Geneka, Montreal, Quebec, Canada), raised against a peptide derived from amino acid residues 2-16 of human c-Myb, was used to block the binding activity of Myb-HIS recombinant protein to its MBS. The Penta-HIS antibody described above was used to supershift the DNA-Myb-HIS complex. The
complementary single strand oligonucleotides were annealed at 95 °C
for 3 min, at 55 °C for 2 min, and at 37 °C for 15 min in 10 mM Tris-HCl, pH 7.5, 10 mM MgCl2,
50 mM NaCl. Three hundred nanograms of double-stranded
oligonucleotides were then labeled with [ -32P]dCTP
(3000 Ci/mmol) using 2.5 units of Klenow DNA enzyme and purified on a
silica column (Qiagen). The binding reaction was carried out at room
temperature for 30 min using 25,000 cpm of labeled DNA, 1 µg of
poly(dI-dC), and 10 µg of Myb-HIS in 50 mM NaCl/20
mM Hepes, pH 8, 1 mM EDTA, 10 mM
DTT, 0.5% non-fat dried milk, 5% glycerol in a final volume of 12 µl. For supershift and blocking experiments the binding reaction was
2 µl of Penta-HIS or anti-c-Myb polyclonal antibody, respectively,
and was preincubated at 4 °C for 15 min in the absence of the target
DNA. After the incubation period, 1.5 µl of loading buffer (250 mM Tris-HCl, pH 7.5, 40% glycerol) were added, and the
samples were immediately loaded onto a 6% acrylamide Retardation Gel
(NOVEX). Gel electrophoresis was carried out in a cold room at 100 V
for 2 h. The gel was then fixed with 10% acetic acid, 10%
methanol, dried, and exposed using the FX-Molecular Imager system
(Bio-Rad).
Northern Analysis--
The plasmid used for the detection of the
type I collagen 2 chain mRNA (Hf32) and type III collagen were a
kind gift of Dr. C. M. Lapiere (Laboratoire de Biologie des Tissue
Conjonctifs, University of Liege, Belgium). The fibronectin and TGF-
cDNAs were purchased from ATCC. The probe was labeled with
[32P]dCTP by standard random priming procedures to
specific activities of 5 × 108 cpm/µg DNA. Total
cellular RNA was extracted according to the guanidine
isothiocyanate-cesium chloride method. Eight micrograms of total RNA
were loaded in each lane of a 1% agarose-formaldehyde gel and
transferred to nylon membranes by standard blotting procedures. RNA was
fixed to the membranes by baking or UV cross-linking. Prehybridization
was performed for 7 h at 60 °C in 1 M NaCl, 1% SDS, 10% dextran sulfate, and 100 mg/ml denatured salmon sperm DNA.
Hybridization was performed overnight at 60 °C in the same buffer by
adding 1.2 × 106 cpm/ml of labeled probe. The filters
were washed twice for 10 min at 60 °C with 2× SSC, 1% SDS, 15 min
with 0.5× SSC, 0.5% SDS and finally twice at room temperature with a
large volume of 0.5× SSC. The blots were briefly dried, exposed in
screen cassette Bio-Rad, and hybridization signals obtained using a
Molecular Images FX (Bio-Rad).
Semiquantitative Analysis of c-myb RNA by PCR in MEFs--
Total
cellular RNA was extracted from MEFs as described above. Two micrograms
of total RNA were directly reverse-transcribed in 5 mM
MgCl2, 50 mM KCl, 10 mM Tris-HCl,
pH 8.3, 2.5 µM random hexamers, 1 mM dNTP, 1 unit/ml RNase inhibitor, and 2.5 units/ml Moloney murine leukemia
virus-reverse transcriptase. The samples were incubated for 10 min at
room temperature and then for 45 min at 42 °C. Three microliters of
the reverse transcription reactions were amplified by PCR in 2 mM MgCl2, 50 mM KCl, 10 mM Tris-HCl, 0.2 mM each dNTP, 2.5 units/ml
Taq DNA polymerase, and 5 ng/ml of each primer:
c-myb 1, ACTCAACTGCCCAATGAAGTCG; c-myb 2, TTCCTGTTCCACCTTGCG; actin 1, ATCGTGGGCCGCCCTAGGCACCA; actin 2, TTGGCCTTAGGGTTCAG GGGG. PCR was performed in an MJ-PT200 thermal cycler
using the following cycle: 30 min at 95 °C, 30 min at
58 °C, and 30 min at 72 °C, for 18 cycles. The predicted sizes of
the RT-PCR products were 445 and 244 bp, respectively. An aliquot of
each reaction was run in a 1.5% ultrapure agarose gel (Invitrogen) and
transferred to nylon membranes by standard Southern blotting procedures.
 |
RESULTS |
The Promoter of the Human Type I Collagen 2 Chain Gene Contains
Four Putative Myb-binding Sites--
In a previous report (8), we have
shown that c-Myb can up-regulate rat 1(I) collagen and mouse 2(I)
collagen promoters by 6-10-fold, whereas B-Myb was inactive. Here we
have tried to ascertain whether c-Myb could also up-regulate human type
I collagen gene expression. By using the computerized software
MatInspector version 2.2, we have analyzed the DNA sequence of the
promoter of the human type I collagen 2 chain (COL1A2-P),
and we found four putative MBSs. These are located between positions
1400 to 1000 (defined as a
"Myb-Responsive Region" (M-RR))
and display a high degree of homology with the published consensus
sequence, the degree of matrix similarity ranging from 0.87 to 0.93, where 1 corresponds to complete homology (Fig.
1A).

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 1.
Schematic representation of the human type I
collagen 2 chain gene
(COL1A2) promoter and of plasmids used in
transactivation assays. A, the COL1A2
promoter and the position of MBSs. NcoI, position of the
restriction enzyme site NcoI used to obtain the pGL-D1095
plasmid (see "Experimental Procedures" for more details). The table
shows from left to right: the nucleotide
sequences of the four MBSs (the core sequence regions are in
boldface and underlined), the nucleotide position
within the COL1A2 promoter, and the values of matrix
similarities to the MBS consensus sequences, where a value of 1 corresponds to complete homology. B, the recombinant plasmid
pGbC1A2-P obtained by cloning the COL1A2 promoter between
the SacI-SmaI sites of the pGL3-Basic
mcsr, upstream the firefly luciferase gene
(LUC+). C, the recombinant plasmid pGECA2-P
obtained by cloning the COL1A2 promoter between the
SacI-SmaI sites of the pGL3-Enhancer
mcsr, upstream the firefly luciferase gene (LUC+)
and an SV40 enhancer cassette (SV40-Enh).
|
|
When we extended the software analysis to the DNA sequence of the human
COL1A1 gene promoter, from the transcription start site to 2000 bp,
we did not find myb-binding sites. Thus, we have focused our
investigation on the regulation of COL1A2 gene expression by
c-myb.
c-Myb, but Not B-Myb, Up-regulates the Promoter of the Gene
Encoding the 2 Chain of Human Type I Collagen in Human
Fibroblasts--
To demonstrate that c-Myb is able to transactivate
the human COL1A2 promoter, we co-transfected the reporter
plasmid pGbC1A2-P (containing the COL1A2 promoter inserted
upstream from the firefly luciferase gene, Fig. 1B) and
either the pSGC or pSGB CMV promoter-driven plasmids which express
human c-Myb or B-Myb, respectively. Western blot analysis confirmed
that c-Myb was efficiently expressed from the pSGC vector (Fig.
2B). In a different set of
experiments, the pGECA-2 plasmid, in which the COL1A2
promoter is inserted upstream an SV40 enhancer cassette, was used as
the reporter vector (Fig. 1C). The transfection assays
demonstrated that c-Myb, but not B-Myb, up-regulates expression driven
by the COL1A2 promoter by 6-8-fold in the WS-1 and HUDE
cell lines and in NSF. A stronger degree of transactivation
(10-15-fold) was obtained in the HFL-1 cell line (Fig. 2A).

View larger version (29K):
[in this window]
[in a new window]
|
Fig. 2.
Transient transactivation of the
COL1A2 promoter by c-Myb or B-Myb in human
fibroblasts. A, co-transfection of human fetal lung
(HFL), human dermal embryonic cells (HUDE and
WS1), and NSF with the COL1A2 promoter-reporter
(COL1A2-P) and c-Myb or B-Myb expression vectors. The
results represent the mean of three separate experiments. All
transfections also included the pRL-SV vector that encodes
Renilla luciferase. The ratios of Renilla to
firefly luciferase activities obtained with the "Dual Reporter
Luciferase Assay" were used to normalize all the transfection
experiments. B, Western blot analysis of NSF transfected
with COL1A2 promoter-reporter (COL1A2-P) ± the c-Myb expression vector pSGC. Affinity-purified rabbit anti-c-Myb
polyclonal antibody was used as the primary antibody, and Western blot
detection was carried out following the manufacturer's instructions.
K562, nuclear extract prepared from K562 human chronic
myelogenous leukemia cell line used as positive control for c-Myb.
C, co-transfection of NSF with pGL-KHK plasmid (carrying the
KHK synthetic promoter) and c-Myb or B-Myb expression vectors. The
results represent the mean of three distinct experiments. Normalization
for transfection efficiency was performed as described in A. D, co-transfection of NSF with COL1A2
promoter-reporter (COL1A2-P) together with c-Myb (pSGC) and
B-Myb (pSGB) expression vectors at different molar ratios
(e.g. 1:1 = 1 µg/1 µg). The results represent the
mean of three distinct experiments. Normalization for transfection
efficiency was performed as described in A.
|
|
Furthermore, in the same cell types we performed co-transfection assays
using the expression plasmids pSGC and pSGB and the control reporter
plasmid pGL-KHK, which carries the KHK synthetic promoter inserted
upstream from the luciferase gene. In this case, both c-Myb and
B-Myb were able to stimulate luciferase expression by 8-fold
(Fig. 2C). Moreover, co-transfection assays using pSGC and
pSGB together with the reporter plasmid pGbC1A2-P demonstrated that
B-Myb could partially inhibit transactivation of the COL1A2 promoter driven by c-Myb (Fig. 2D).
The strength of the Myb-induced transactivation was also evaluated by
transfecting the pSGC or pSGB expression vectors together with the
reporter pGECA2-P in which the COL1A2 promoter was linked to
SV40 enhancer sequences. Stimulation of this promoter/enhancer combination by c-Myb was equivalent to that seen with the pGbC1A2-P reporter (data not shown), thus demonstrating that enhancer region(s) are not required for the effect of c-Myb on the COL1A2 promoter.
These results clearly prove that the human COL1A2 promoter
is strongly and specifically transactivated by c-Myb in several human
fibroblastic cell types, whereas B-Myb can potentially modulate this transactivation through partial inhibition of the positive effect
of c-Myb.
Transactivation of the Human Type I Collagen 2 Chain Gene
Promoter Requires the Presence of the 400-bp Myb-responsive Region
(M-RR)--
Next we investigated the role that the four MBSs of the
400-bp COL1A2 promoter Myb-responsive region (M-RR) might
play in c-Myb-mediated transactivation. We created a set of pGL
plasmids that carry different deletions of COL1A2 promoter
from 1500 to 290 in order to remove progressively each MBS (Fig.
3A). Transfection assays
utilizing the pSGC expression vector together with promoter constructs
containing deletions to 950, 575, and 250 demonstrated that one
or more MBSs were sufficient to allow c-Myb-dependent activation but that the loss of all four MBSs completely ablated the
response to the transactivator (Fig. 3B).

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 3.
Transient transactivation of full-length and
deleted COL1A2 promoter-reporter constructs by c-Myb
in NSF cells. The six nested deletions (D1500 to D290) of the
full-length COL1A2 promoter (FL) are
schematically represented on the left. The position of the
c-Myb-binding sites are represented by the black boxes.
Results of transfections ± the c-Myb expression vector pSGC are
indicated. The fold transactivation values are indicated on the
right of the figure. Results represent the mean of three
separate experiments. Normalization for transfection efficiency was
performed as described in the legend to Fig. 2A.
|
|
These results prove that the presence of the 400-bp M-RR in the
COL1A2 promoter is necessary for c-Myb-dependent
transactivation and suggest that each MBS could be important in
mediating the effect.
Mutagenesis of MBS-4 or Mutation of c-Myb Abrogates
Myb-dependent Transactivation of the Human Type I Collagen
2 Chain Gene Promoter--
To show further that c-Myb acts upon the
MBS in the COL1A2 promoter, mutagenesis experiments were
performed on MBS-4 at position 1000. MBS-4 (GGTTGG) was mutated in
the context of the following: (i) plasmid pGbC1A2-P, which contains all
four MBS, to CCGCGG (MBM-3); and (ii) plasmid pGLD-1095, which contains
only MBS-4, to sequences GATATC, ACTAGT, or CCGCGG (MBM-1, MBM-2, or
MBM-3, respectively). In transfection assays, c-Myb expressed from pSGC was unable to stimulate luciferase expression from the mutated pGLD-1095-based plasmids, demonstrating the requirement for the integrity of MBS-4 (Fig. 4A).
Moreover, mutation of MBS-4 alone in the context of the full-length
COL1A2 promoter strongly decreased up-regulation by c-Myb
(2.3 times less than on the wt promoter, Fig.
4A).

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 4.
Transient transactivation of the wild type
and mutated MBS COL1A2 promoter-reporters by c-Myb and
c-Myb(Cys130) in NSF cells. A, co-transfection of NSF with
or without the pSGC c-Myb expression vector together with either the
pGbC1A2-P and pGLD1095 promoter-reporters or with equivalent constructs
containing either the full-length promoter with only the MBS-4 mutated
(pGbC1A2-P-MBS4-mut) or the shorter promoter containing one
of three different mutations in the MBS-4 sequence (MBM-1, -2 and -3).
The MBS core sequence present in each construct is indicated, and the
mutated residues are shown in lowercase letters.
B, co-transfection of NSF with the full-length
COL1A2 promoter-reporter construct (COL1A2-P) and
the expression vector pSGC encoding either wild type c-Myb or the
version mutated at Cys-130. Results represent the mean of three
distinct experiments. Normalization for transfection efficiency was
performed as described in the legend to Fig. 2A.
|
|
To demonstrate that c-Myb is directly involved in transactivation of
the COL1A2 promoter, we used an expression vector, pCys130, which encodes a mutated c-Myb protein containing a Cys to Ser mutation
at position 130 that abrogates the binding ability of c-Myb to DNA (30,
31). The mutated c-Myb protein was unable to activate luciferase
expression from either the wild type pGLD-1095 or the full-length
COL1A2 promoter (Fig. 4B).
These data demonstrate that both MBS integrity and fully functional
c-Myb protein are necessary for the c-Myb-mediated transactivation of
the COL1A2 promoter. Furthermore, of the four MBS, MBS-4
seems to play the pivotal role in COL1A2 promoter
transactivation by c-Myb.
c-Myb Protein Binds to the MBSs DNA Sequences in the Promoter of
the Human Type I Collagen 2 Chain Gene Promoter--
In view of
results described above, we have investigated the DNA binding capacity
of c-Myb to the MBSs DNA sequences that are present in the M-RR of the
COL1A2 promoter. For this purpose we produced a c-Myb
recombinant protein, truncated at position +1200, conjugated to a
His6 tag. This protein, Myb-HIS, contains the three repeat
domains (R1, R2, and R3) that are necessary for DNA binding ability
(32-34). Gel retardation experiments (EMSA) demonstrated that Myb-HIS
is able to bind to the KHK synthetic promoter (Fig.
5A) and to a labeled
double-stranded oligonucleotide containing the sequence of MBS-4 (Fig.
5B). The Myb-HIS-DNA complexes were similar to those
obtained using nuclear extracts from the K562 cell line (Fig. 5,
A and B, 2nd lane). The binding
activity was abrogated by incubating Myb-HIS with a 100-fold molar
excess of cold competitor (Fig. 5, A and B,
4th lane) and with an anti-c-Myb polyclonal antibody raised
against the region of the protein that contains the R1-R3 domains
(Fig. 5, A and B, 5th lane). The same results were obtained using three different double-strand
oligonucleotides, each one containing one of the three other MBS
(MBS1-3) from the COL1A2 promoter (data not shown).

View larger version (35K):
[in this window]
[in a new window]
|
Fig. 5.
Results of gel retardation experiments
(EMSA). A, EMSA of K562 nuclear extract (n.e.)
and Myb-HIS recombinant protein incubated with labeled KHK synthetic
promoter, containing eight Myb-binding sites, and resolved on a
non-denaturing polyacrylamide gel. Neg., negative.
Comp, 100-fold molar excess of KHK synthetic promoter
unlabeled competitor. Anti-myb, blocking anti-c-Myb
polyclonal antibody raised against a peptide derived from amino acid
residues 2-16 of human c-Myb. B, EMSA performed as in
A except that the labeled probe oligonucleotide contained
MBS-4 from the COL1A2 promoter. C, EMSAs
performed using the Myb-HIS recombinant with labeled double-stranded
oligonucleotide containing the sequence of wild type MBS-4 (MBS-4
wt, 1st to 4th lanes) or one of the three
mutated MBS-4 sequences described elsewhere (5th to
7th lanes, MBM-1, -2, -3). Comp (2nd
lane), 100-fold molar excess of KHK synthetic promoter unlabeled
competitor. Anti-myb (3rd lane), blocking
anti-c-Myb polyclonal antibody. Anti-HIS (4th
lane), supershift using the mouse monoclonal Penta-HIS antibody. A
band is clearly visible in a higher position than the control
MYB-HIS-DNA complex (1st lane).
|
|
To confirm the binding specificity of Myb-HIS to the MBS, we carried
out binding reactions using the Penta-HIS antibody, raised against the
His6 tag of the recombinant protein, to supershift the
Myb-HIS-DNA complex. The reason for using this antibody was that the
available anti-c-Myb antibodies were directed against the COOH terminus
of the protein, which is deleted in our recombinant Myb-HIS, and
because the histidine tag does not usually participate in the function
of recombinant proteins (35-40). Moreover, the Penta-HIS antibody
easily detected the recombinant protein in Western blot analysis (data
not shown). Gel retardation experiments demonstrated that the Penta-HIS
antibody was able to supershift the Myb-HIS-DNA complex (Fig.
5C, 4th lane). Binding reactions between Myb-HIS
protein and double-stranded oligonucleotides containing the three
mutated MBS described above (MBM1-3) demonstrated that the mutated
sites could no longer specifically bind Myb-HIS (Fig. 5C,
5th to 7th lanes). These data demonstrate that
the Myb-HIS recombinant protein, containing the R1-R3 DNA binding
domains conjugated to a His6 tag, can specifically bind to
both the KHK synthetic promoter and to several double-stranded
oligonucleotides that contain the COL1A2 promoter MBSs and
that the Myb-HIS-DNA complex can be supershifted by the Penta-HIS
antibody. Specificity of binding is indicated by the fact that binding
can be blocked by the following: (a) a molar excess of cold
competitor; (b) an anti-c-Myb antibody directed against the
R1-R3 DNA binding domains; and (c) mutation of the MBSs.
All the above evidence clearly demonstrates that Myb-HIS binds to the
human type I collagen 2 chain gene promoter, requiring specific
interaction between the DNA-binding domain of c-Myb and the MBS.
The Lack of Transcription of Type I Collagen 2 Chain mRNA in
c-myb / Embryonic Fibroblasts Can Be Restored
by Ectopic Expression of c-Myb--
To confirm the relationship
between c-Myb and type I collagen 2 chain gene expression, we
studied mouse embryonic fibroblasts derived from embryos homozygous for
an inactivating mutation in the c-myb gene
(c-myb / MEFs). Although
c-myb / embryos do not survive
beyond day 16 of gestation because of a severe impairment of fetal
hematopoiesis, MEFs can be grown in cultures for several weeks (15) and
are suitable for the study of extracellular matrix gene expression. The
results of a representative Northern blot analysis of mRNA from
MEFs c-myb / cells (out of a total
of five experiments) are shown in Fig. 6A. Cells lacking c-Myb
expressed very low levels of 2(I) collagen mRNA when compared
with wild type cells, a faint band being visible only after long
exposures of the autoradiograms. This defect is specific because the
same cells maintained the expression of other important extracellular
matrix proteins, such as type III collagen and fibronectin (Fig.
6A). The transfection of the
c-myb / MEFs with a plasmid
encoding c-Myb restored the expression of the 2(I) collagen mRNA
to a level comparable with that of the wt MEFs (Fig.
6B), implying that the lack of the constitutive expression
of 2(I) collagen gene is caused by the lack of c-Myb expression and
not by a global impairment of other signaling pathways. This latter
conclusion is further supported by the normal expression of the 2(I)
collagen gene, but not c-myb, when the
c-myb / MEFs are stimulated by
TGF- (Fig. 6C). Wild type MEFs exhibited increases in
both c-myb and COL1A2 gene expression after
TGF- stimulation (Fig. 6C), thus mimicking the response
seen in human dermal fibroblasts (24).

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 6.
Northern blot and RT-PCR analysis of the
expression of extracellular matrix proteins and c-myb
in wild type and
c-myb /
MEFs. A, Northern blot analysis of RNA prepared from wild
type (wt) and c-myb /
MEFs. Eight micrograms of total RNA were loaded in each lane of a 1%
agarose-formaldehyde gel. The membrane was hybridized successively with
labeled cDNA probes for the (2)-type collagen gene
(COL1A2), fibronectin, the type III collagen gene
(COL3), and -actin. Autoradiographic exposure was for
24 h, except for COL1A2 gene (72 h). B,
Northern blot analysis of RNA prepared from wild type (wt)
and c-myb / MEFs
transfected ± the pGREMyb plasmid, expressing inducible full-length
c-Myb (c-myb/+). Cells were cultured in the presence of 0.2 µM dexamethasone. C, the upper part
shows Northern blot analysis of RNA prepared from wild type
(wt) and c-myb /
MEFs ± TGF- (2 ng/ml). The membrane was hybridized with
radiolabeled cDNA probes for the (2)-type collagen gene
(COL1A2) and -actin. The lower part is an
RT-PCR analysis of c-myb RNA and a corresponding control
reaction using primers specific for -actin.
|
|
Normal Human Skin Fibroblasts Expressing a Dominant Negative
Version of c-Myb Lose the Ability to Express the Type I
Collagen Gene--
Finally, to validate and confirm in human cells the
data obtained in c-myb / MEFs, we
transfected NSF with a plasmid constitutively expressing wild type
c-Myb (pGREMyb) or a dominant negative form of c-Myb (pGREMen). NSF
transfected with pGREMyb displayed an augmented expression of the type
I collagen gene, whereas they lost the ability to express the gene when
transfected with pGREMen (Fig. 7).

View larger version (47K):
[in this window]
[in a new window]
|
Fig. 7.
Northern blot analysis of type I collagen
mRNA from NSFs overexpressing c-Myb or a dominant negative c-Myb
variant. Northern blot analysis of RNA prepared from NSFs
transfected with the pGREMyb plasmid, expressing inducible full-length
c-Myb (c-myb/+) or with pGREMen, expressing a
dominant negative variant of c-Myb
(c-myb/ ) ± 0.2 µM
dexamethasone (+Dexa). Eight micrograms of total RNA were
loaded in each lane of a 1% agarose-formaldehyde gel. The membrane was
hybridized with labeled cDNA probes for the (2)-type
collagen gene (COL1A2) and -actin. Autoradiographic
exposure was for 24 h.
|
|
This demonstrates that c-Myb also plays a crucial role in the
regulation of the type I collagen gene in human cells.
 |
DISCUSSION |
Type I collagen is a heterotrimeric molecule consisting of two
1(I) chains and one 2(I) chain. Fibroblasts and osteoblasts are
the major collagen-producing cells in tissues, such as skin and bone,
that present large amounts of type I collagen (41). Fibroblasts also
appear to be the collagen-releasing cells in those tissues that contain
smaller amounts of type I collagen. Hence, because the genes encoding
the 1(I) and 2(I) chains are expressed in several cell types, at
distinct stages of development, and under various physiologic
conditions, their regulation is consequently complex (42-44).
Interactions between a number of cis-regulatory elements and
sequence-specific trans-acting factors are involved in the
stage-specific and tissue-specific regulation of type I collagen gene
transcription. Common cis-acting elements present in the
genes encoding both the 1 and 2 polypeptides have been
demonstrated to be responsible for their co-regulation (46).
Recent studies have examined collagen gene transcriptional regulation
using the human and mouse 1(I) and 2(I) gene promoter regions
(COL1A1 and COL1A2) and have led to the identification of
several cis-elements and transcription factors that control constitutive expression. Thus, Ets factors (45), CCAAT-binding factor
(46, 47), K-ROX (48, 49), NF- B (50), Sp-1 (51, 52), and SMADs (53,
54) have all been found to regulate type I collagen gene expression.
These transcription factors may act alone or in concert, as is seen for
example in the case of regulation elicited by the TGF- signaling
pathway which has a positive effect on COL1A2 promoter
activity in cooperation with Sp-1 (55, 56).
At present the mechanisms that regulate the expression of collagen
genes in pathologic fibroblasts are not known. Cells isolated from
fibrotic tissues have an activated phenotype. Both the COL1A1 and
COL1A2 promoters exhibit severalfold higher activity when studied in scleroderma fibroblasts as compared with fibroblasts derived
from healthy controls (57, 58). In activated Ito cells derived from
cirrhotic liver increased COL1A1 mRNA levels correlate with
increased Sp-1 binding to the promoter (59); however, the specific
cis-elements and trans-acting factors responsible
for abnormal regulation of promoter activity in fibrotic disease have not been conclusively elucidated.
Previous work by our group (8, 24) has shown that c-Myb, a
transcription factor involved in differentiation and proliferation of
hematopoietic cells, is expressed by scleroderma fibroblasts cultured
in serum-deprived medium and is able to transactivate mouse and rat
type I collagen gene promoters. Because a detailed study of the
transcriptional regulation of the COL1A2 promoter by c-Myb
may shed light on the pathogenesis of scleroderma and could lead to
possible therapeutic strategies against this incurable disease, we felt
it important to investigate more thoroughly the relationship between
c-Myb and COL1A2 promoter regulation.
Previous studies (44, 52) have identified several functional
cis-acting elements in the 350-bp proximal region of the human COL1A2 gene promoter, whereas the data presented here
demonstrate that c-Myb stimulates transcription by binding to an M-RR
containing four MBSs located between 1400 and 1000 bp upstream of
the initiation site. Multiple MBSs are often present in promoters
regulated by c-Myb (33), so that the clustering of the
COL1A2 promoter MBSs implies that the M-RR could play a key
role in the regulation of COL1A2 gene expression by c-Myb.
Consistent with this hypothesis, we have found that deletion of the
M-RR abrogates the ability of c-Myb to regulate the COL1A2
promoter in transactivation assays.
The sequences of the four potential MBSs suggest that each could be
involved in the specific binding of c-Myb to the COL1A2 promoter. Indeed, using gel shift experiments we have shown that c-Myb
binds to each MBS; however, mutagenesis experiments demonstrated that
MBS-4 plays a pivotal role in up-regulation of the COL1A2 promoter by c-Myb. In fact, the presence of the MBS-4 in the
COL1A2 promoter appears to be sufficient to allow strong
transactivation by c-Myb. This finding could be explained by the fact
that the different means by which c-Myb activates its target gene
promoters via MBS do not necessarily require cooperative interactions
between multiple c-Myb molecules (60). However, it is noteworthy that the COL1A2 promoter with a mutation only in MBS-4 is still
transactivated to some extent by c-Myb suggesting that MBS-1, MBS-2,
and MBS-3 are perhaps important in cooperation with MBS-4.
We have shown that the likelihood that B-Myb cannot
transactivate the COL1A2 promoter in mouse fibroblasts (24)
holds true in human cells. Indeed, although c-Myb activates both the
COL1A2 and synthetic KHK promoters, B-Myb, which should be
capable of binding the same MBS, only activates the KHK construct and
can partially inhibit the transactivation of the COL1A2
promoter that is driven by c-Myb. Two possible explanations for this
distinction are as follows: (i) that B-Myb works as a repressor of type
I collagen gene expression, as demonstrated by our experiments and by
others (12); and (ii) that c-Myb may regulate human type I collagen
expression in cooperation with an as yet unknown protein that does not
operate in conjunction with B-Myb.
Our most direct evidence for a close link between c-Myb and
COL1A2 gene expression has been provided by showing the lack
of type I collagen expression in MEFs derived from
c-myb / embryos. That the absence
of c-Myb has a specific effect on the COL1A2 gene was
apparent because the expression of type III collagen and fibronectin
was normal in c-myb / MEFs.
Because the constitutive but not the TGF- -induced expression of the
COL1A2 gene is abrogated in
c-myb / MEFs, our data imply that
TGF- -responsive cellular pathways are not affected in these cells.
Furthermore, as already demonstrated in human dermal fibroblasts (24),
wild type MEFs stimulated by TGF- showed an increase in
c-myb gene expression, implying that c-Myb may regulate both
constitutive and cytokine-induced expression of the type I collagen
gene. However, although TGF- induces c-myb expression,
c-myb is not obligatory for COL1A2 induction by
this cytokine because TGF- induces COL1A2 in the absence
of c-myb in c-myb /
MEFs.
Thus, in summary, c-myb is not the only transcription factor
in the pathway that leads to collagen following TGF- stimulation and
c-myb, as shown in unstimulated cells (Fig.
7C), may be under the control of factors distinct from
TGF- . These findings raise intriguing questions about the role of
c-myb in the pathogenesis of SSc where it is overexpressed
in quiescent SSc fibroblasts, and TGF- is considered a key
pathogenetic factor, and these findings suggest that the scenario is
more complex than so far known, with distinct intracellular (collagen
transcription factors) and extracellular factors (cytokines, growth
factors, etc.) involved.
It is noteworthy that we have confirmed the results obtained in mouse
embryonic fibroblasts lacking the c-myb gene by expressing a
dominant negative c-Myb protein in NSF. As already demonstrated in 3T3
fibroblasts, such a dominant negative c-Myb protein suppresses transcription normally stimulated by endogenous c-Myb and blocks cell
cycle progression in these cells (15). Induction of the dominant
negative c-Myb in NSF led to the abrogation of COL1A2 gene
expression, confirming that c-Myb plays a crucial role in the
regulation of this gene transcription in both mouse (24) and, as shown
here, human fibroblasts. In this regard, it is noteworthy that although
the regions recognized by c-Myb in the mouse and human
COL1A2 gene promoter have a different location, they display a high degree of homology. Furthermore, c-Myb modulates the expression of type I collagen genes in a species-specific manner, as shown in the
case of other transcription factors (61). In fact, although multiple
MBSs are present in the rat promoter of
COL1A12 and in the promoter
of mouse and human COL1A2 genes, no MBSs have been found in
the human COL1A1 promoter. It is unlikely that this finding can be
ascribed to the limited extension of the published sequences of the
human COL1A1 promoter (62, 63), because we have analyzed a region
spanning from the transcription start site to 2000 bp which has the
size of the promoter region of COL1A2 and rat COL1A1 genes
where MBSs are present.
Thus, in summary, it can be speculated that in humans c-myb
modulates the expression of type I collagen gene expression acting preferentially on the COL1A2 gene and that the precise
mechanisms employed by c-Myb have evolved in a species-specific way
(64).
In conclusion, in linking c-Myb to the expression of type I collagen in
human fibroblasts, the present work emphasizes the physiological role
of c-Myb in human fibroblasts and its potential importance in fibrotic
conditions such as a scleroderma, in which the augmented production of
collagen could be maintained by the deregulated expression of this gene
(8). Further studies will be necessary to elucidate more clearly the
role by c-Myb in fibrotic disorders.
 |
FOOTNOTES |
*
This work was supported by Telethon Grant 0822.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
To whom correspondence should be addressed: Institute of Internal
Medicine, Haematology and Clinical Immunology, University of Ancona,
via Tronto 10/A, 60020 Ancona, Italy. Tel.: 39-0712206111; Fax:
39-0712206103; E-mail: mickey@deanovell.unian.it.
Wellcome Trust Senior Basic Biomedical Research Fellow.
Published, JBC Papers in Press, November 6, 2002, DOI 10.1074/jbc.M204392200
2
M. M. Luchetti, P. Paroncini, P. Majlingovà, J. Frampton, M. Mucenski, S. S. Baroni, P. Sambo, J. Golay, M. Introna, and A. Gabrielli, unpublished data.
 |
ABBREVIATIONS |
The abbreviations used are:
MBSs, Myb-binding
sites;
EMSA, electrophoretic mobility shift assay;
MEFs, mouse embryo
fibroblasts;
DTT, dithiothreitol;
BSA, bovine serum albumin;
NSF, normal human skin fibroblasts;
FCS, fetal calf serum;
TGF- , transforming growth factor- ;
RT, reverse transcriptase.
 |
REFERENCES |
| 1.
|
Introna, M.,
Luchetti, M.,
Castellano, M.,
Arsura, M.,
and Golay, J.
(1994)
Semin. Cancer Biol.
5,
113-124[Medline]
[Order article via Infotrieve]
|
| 2.
|
Boise, L. H.,
Grant, S.,
and Westin, E. H.
(1992)
Cell Growth Differ.
3,
53-61[Abstract]
|
| 3.
|
Allen, R. D.,
Bender, T. P.,
and Siu, G.
(1999)
Genes Dev.
13,
1073-1078[Abstract/Free Full Text]
|
| 4.
|
Sumner, R.,
Crawford, A.,
Mucenski, M.,
and Frampton, J.
(2000)
Oncogene
19,
3335-3342[CrossRef][Medline]
[Order article via Infotrieve]
|
| 5.
|
Oh, I. H.,
and Reddy, E. P.
(1999)
Oncogene
18,
3017-3033[CrossRef][Medline]
[Order article via Infotrieve]
|
| 6.
|
Zorbas, M.,
Sicurella, C.,
Bertoncello, I.,
Venter, D.,
Ellis, S.,
Mucenski, M. L.,
and Ramsay, R. G.
(1999)
Oncogene
18,
5821-5830[CrossRef][Medline]
[Order article via Infotrieve]
|
| 7.
|
Reiss, K.,
Travali, S.,
Calabretta, B.,
and Baserga, R.
(1991)
J. Cell. Physiol.
148,
338-343[CrossRef][Medline]
[Order article via Infotrieve]
|
| 8.
|
Piccinini, G.,
Luchetti, M. M.,
Caniglia, M. L.,
Carossino, A. M.,
Montroni, M.,
Introna, M.,
and Gabrielli, A.
(1996)
J. Invest. Dermatol.
106,
1281-1286[CrossRef][Medline]
[Order article via Infotrieve]
|
| 9.
|
Mizuguchi, G.,
Nakagoshi, H.,
Nagase, T.,
Nomura, N.,
Date, T.,
Ueno, Y.,
and Ishii, S.
(1990)
J. Biol. Chem.
265,
9280-9284[Abstract/Free Full Text]
|
| 10.
|
Golay, J.,
Capucci, A.,
Arsura, M.,
Castellano, M.,
Rizzo, V.,
and Introna, M.
(1991)
Blood
77,
149-158[Abstract/Free Full Text]
|
| 11.
|
Foos, G.,
Grimm, S.,
and Klempnauer, K. H.
(1992)
EMBO J.
11,
4619-4629[Medline]
[Order article via Infotrieve]
|
| 12.
|
Marhamati, D. J.,
and Sonenshein, G. E.
(1996)
J. Biol. Chem.
271,
3359-3365[Abstract/Free Full Text]
|
| 13.
|
Kypreos, K. E.,
Nugent, M. A.,
and Sonenshein, G. E.
(1998)
Cell Growth Differ.
9,
723-730[Abstract]
|
| 14.
|
Reiss, K.,
Ferber, A.,
Travali, S.,
Porcu, P.,
Phillips, P. D.,
and Baserga, R.
(1991)
Cancer Res.
51,
5997-6000[Abstract/Free Full Text]
|
| 15.
|
Bein, K.,
Husain, M.,
Ware, J. A.,
Mucenski, M. L.,
Rosemberg, R. D.,
and Simmons, M.
(1997)
J. Cell. Physiol.
173,
319-326[CrossRef][Medline]
[Order article via Infotrieve]
|
| 16.
|
Travali, S.,
Ferber, A.,
Reiss, K.,
Sell, C.,
Koniecki, J.,
Calabretta, B.,
and Baserga, R.
(1991)
Oncogene
6,
887-894[Medline]
[Order article via Infotrieve]
|
| 17.
|
Ness, S. A.,
Marknell, Å.,
and Graf, T.
(1989)
Cell
59,
1115-1125[CrossRef][Medline]
[Order article via Infotrieve]
|
| 18.
|
Ku, D.,
Wen, S.,
Engelhard, A.,
Nicolades, N. C.,
Lipson, K. E.,
Marino, T. A.,
and Calabretta, B.
(1993)
J. Biol. Chem.
268,
2255-2259[Abstract/Free Full Text]
|
| 19.
|
Zobel, A.,
Kalkbrenner, F.,
Vorbrueggen, G.,
and Moelling, H.
(1992)
Biochem. Biophys. Res. Commun.
186,
715-722[CrossRef][Medline]
[Order article via Infotrieve]
|
| 20.
|
Evans, J. L.,
Moore, T. L.,
Kuehl, W. M.,
Bender, T.,
and Ting, J. P.
(1990)
Mol. Cell. Biol.
10,
5747-5752[Abstract/Free Full Text]
|
| 21.
|
Siu, G.,
Wurster, A. L.,
Lipsick, J. S.,
and Hedrick, S. M.
(1992)
Mol. Cell. Biol.
12,
1592-1604[Abstract/Free Full Text]
|
| 22.
|
Bosselut, R.,
Lim, F.,
Romond, P. C.,
Frampton, J.,
Brady, J.,
and Ghysdael, J.
(1992)
Virology
186,
764-769[CrossRef][Medline]
[Order article via Infotrieve]
|
| 23.
|
Nicolaides, N. C.,
Gualdi, R.,
Casadevall, C.,
Manzella, L.,
and Calabretta, B.
(1991)
Mol. Cell. Biol.
11,
6166-6176[Abstract/Free Full Text]
|
| 24.
|
Piccinini, G.,
Golay, J.,
Flora, A.,
Songia, S.,
Luchetti, M.,
Gabrielli, A.,
and Introna, M.
(1999)
J. Invest. Dermatol.
112,
191-196[CrossRef][Medline]
[Order article via Infotrieve]
|
| 25.
|
Quandt, K.,
Frech, K.,
Karas, H.,
Wingender, E.,
and Werner, T.
(1995)
Nucleic Acids Res.
20,
4878-4884
|
| 26.
|
Howe, K. M.,
and Watson, R. J.
(1991)
Nucleic Acids Res.
19,
3913-3919[Abstract/Free Full Text]
|
| 27.
|
Ramsay, R. G.,
Ishii, S.,
and Gonda, T. J.
(1992)
J. Biol. Chem.
267,
5656-5662[Abstract/Free Full Text]
|
| 28.
|
Weston, K.
(1992)
Nucleic Acids Res.
20,
3043-3049[Abstract/Free Full Text]
|
| 29.
|
Mucenski, M. L.,
McLain, K.,
Kier, A. B.,
Swerdlow, S. H.,
Schreiner, C. M.,
Miller, T. A.,
Pietryga, D. W.,
Scott, W. J., Jr.,
and Potter, S. S.
(1991)
Cell
65,
677-689[CrossRef][Medline]
[Order article via Infotrieve]
|
| 30.
|
Grasse, F. A.,
LaMontagne, K.,
Whittaker, L.,
Stohr, S.,
and Lipsick, J. S.
(1992)
Oncogene
7,
1005-1009[Medline]
[Order article via Infotrieve]
|
| 31.
|
Guehmann, S.,
Vorbrueggen, G.,
Kalkbrenner, F.,
and Moelling, K.
(1992)
Nucleic Acids Res.
20,
2279-2286[Abstract/Free Full Text]
|
| 32.
|
Frampton, J.,
Gibson, T. J.,
Ness, S. A.,
Döderlein, G.,
and Graf, T.
(1991)
Protein Eng.
4,
891-901[Abstract/Free Full Text]
|
| 33.
|
Ogata, K.,
Hojo, H.,
Aimoto, S.,
Nakai, T.,
Nakamura, H.,
Sarai, A.,
Ishii, S.,
and Nishimura, Y.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
6428-6432[Abstract/Free Full Text]
|
| 34.
|
Lipsick, J. S.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
9320-9324[Abstract/Free Full Text]
|
| 35.
|
Sheibani, N.
(1999)
Prep. Biochem. Biotechnol.
29,
77-90[Medline]
[Order article via Infotrieve]
|
| 36.
|
Neidhardt, E. A.,
Punreddy, S. R.,
McLean, J. E.,
Hedstrom, L.,
and Grossman, T. H.
(1999)
J. Mol. Microbiol. Biotechnol.
1,
183-188[Medline]
[Order article via Infotrieve]
|
| 37.
|
Daabrowski, S.,
Sobiewska, G.,
Maciunska, J.,
Synowiecki, J.,
and Kur, J.
(2000)
Protein Expression Purif.
19,
107-112[CrossRef][Medline]
[Order article via Infotrieve]
|
| 38.
|
Littlejohn, T. K.,
Takikawa, O.,
Skylas, D.,
Jamie, J. F.,
Walker, M. J.,
and Truscott, R. J.
(2000)
Protein Expression Purif.
19,
22-29[CrossRef][Medline]
[Order article via Infotrieve]
|
| 39.
|
Pawelczyk, T.,
Kowara, R.,
Golebiowski, F.,
and Matecki, A.
(2000)
Protein Expression Purif.
18,
320-326[CrossRef][Medline]
[Order article via Infotrieve]
|
| 40.
|
Birko, Z.,
Schauwecker, F.,
Pfennig, F.,
Szeszak, F.,
Vitalis, S.,
Keller, U.,
and Biro, S.
(2001)
FEMS Microbiol. Lett.
196,
223-227[Medline]
[Order article via Infotrieve]
|
| 41.
|
Karsenty, G.,
and Park, R. W.
(1995)
Int. Rev. Immunol.
12,
177-185[Medline]
[Order article via Infotrieve]
|
| 42.
|
De Wet, W.,
Bernard, M.,
Benson-Chanda, V.,
Chu, M. L.,
Dickson, L.,
Weil, D.,
and Ramirez, F.
(1987)
J. Biol. Chem.
262,
16032-16036[Abstract/Free Full Text]
|
| 43.
|
Hasegawa, T.,
Zhou, X.,
Garrett, L. A.,
Ruteshouser, E. C.,
Maity, S. N.,
and De Crombrugge, B.
(1996)
Nucleic Acids Res.
24,
3253-3260[Abstract/Free Full Text]
|
| 44.
|
Ihn, H.,
Ohnishi, K.,
Tamaki, T.,
LeRoy, E. C.,
and Trojanowska, M.
(1996)
J. Biol. Chem.
15,
359-367
|
| 45.
|
Trojanowska, M.
(2000)
Oncogene
19,
6464-6471[CrossRef][Medline]
[Order article via Infotrieve]
|
| 46.
|
Hu, Q.,
and Maity, S. N.
(2000)
J. Biol. Chem.
275,
4435-4444[Abstract/Free Full Text]
|
| 47.
|
Greenwel, P.,
Tanaka, S.,
Penkov, D.,
Zhang, W.,
Olive, M.,
Moll, J.,
Vinson, C., Di,
Liberto, M.,
and Ramirez, F.
(2000)
Mol. Cell. Biol.
20,
912-918[Abstract/Free Full Text]
|
| 48.
|
Ghayor, C.,
Herrouin, J. F.,
Chadjichristos, C.,
Ala-Kokko, L.,
Takigawa, M.,
Pujol, J. P.,
and Galera, P.
(2000)
J. Biol. Chem.
275,
27421-27438[Abstract/Free Full Text]
|
| 49.
|
Widom, R. L.,
Culic, I.,
Lee, J. Y.,
and Korn, J. H.
(1997)
Gene (Amst.)
198,
407-420[CrossRef][Medline]
[Order article via Infotrieve]
|
| 50.
|
Kouba, D. J.,
Chung, K.,
Nishiyama, T.,
Vindevoghel, L.,
Kon, A.,
Klement, J. F.,
Uitto, J.,
and Mauviel, A.
(1999)
J. Immunol.
162,
4226-4234[Abstract/Free Full Text]
|
| 51.
|
Ruiz, I. G.,
de la Torre, P.,
Diaz, T.,
Esteban, E.,
Morillas, J. D.,
Munoz-Yague, T.,
and Solis-Herruzzo, J. A.
(2000)
DNA Cell Biol.
19,
167-178[CrossRef][Medline]
[Order article via Infotrieve]
|
| 52.
|
Tamaki, T.,
Ohinishi, K.,
Hartl, C.,
LeRoy, E. C.,
and Trojanowska, M.
(1995)
J. Biol. Chem.
270,
4299-4304[Abstract/Free Full Text]
|
| 53.
|
Chen, S. J.,
Yuan, W.,
Mori, Y.,
Levenson, A.,
Trojanowska, M.,
and Varga, J.
(1999)
J. Invest. Dermatol.
112,
49-57[CrossRef][Medline]
[Order article via Infotrieve]
|
| 54.
|
Chen, S. J.,
Yuan, W., Lo, S.,
Trojanowska, M.,
and Varga, J.
(2000)
J. Cell. Physiol.
183,
381-392[CrossRef][Medline]
[Order article via Infotrieve]
|
| 55.
|
Poncelet, A. C.,
and Schnaper, H. W.
(2001)
J. Biol. Chem.
276,
6983-6992[Abstract/Free Full Text]
|
| 56.
|
Zhang, W., Ou, J.,
Inagaki, Y.,
Greenwel, P.,
and Ramirez, F.
(2000)
J. Biol. Chem.
275,
39237-39245[Abstract/Free Full Text]
|
| 57.
|
Kikuchi, K.,
Hartl, C. W.,
Smith, E. A.,
LeRoy, E. C.,
and Trojanowska, M.
(1992)
Biochem. Biophys. Res. Commun.
187,
45-50[CrossRef][Medline]
[Order article via Infotrieve]
|
| 58.
|
Hitraya, E. G.,
and Jimenez, S. A.
(1996)
Arthritis Rheum.
39,
1347-1354[Medline]
[Order article via Infotrieve]
|
| 59.
|
Rippe, R. A.,
Almounajed, G.,
and Brenner, D. A.
(1995)
Hepatology
22,
241-251[CrossRef][Medline]
[Order article via Infotrieve]
|
| 60.
|
Deng, Q. L.,
Ishii, S.,
and Sarai, A.
(1996)
Nucleic Acids Res.
24,
766-774[Abstract/Free Full Text]
|
| 61.
|
Sun, W.,
Hou, F.,
Panchenko, M. P.,
and Smith, B. D.
(2001)
Matrix Biol.
20,
527-541[CrossRef][Medline]
[Order article via Infotrieve]
|
| 62.
|
Bornstein, P.,
McKay, J.,
Morishima, J. K.,
Devarayalu, S.,
and Gelinas, R. E.
(1987)
Proc. Natl. Acad. Sci. U. S. A.
84,
8869-8873[Abstract/Free Full Text]
|
| 63.
|
Jimenez, S. A.,
Varga, J.,
Olsen, A., Li, L.,
Diaz, A.,
Herhal, J.,
and Koch, J.
(1994)
J. Biol. Chem.
269,
12684-12691[Abstract/Free Full Text]
|
| 64.
|
Peterkofsky, B.,
Gosiewska, A.,
Singh, K.,
Pearlman, S.,
and Mahmoodian, F.
(1999)
J. Cell. Biochem.
173,
408-422
|
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
N. Izumi, S. Mizuguchi, Y. Inagaki, S. Saika, N. Kawada, Y. Nakajima, K. Inoue, S. Suehiro, S. L. Friedman, and K. Ikeda
BMP-7 opposes TGF-{beta}1-mediated collagen induction in mouse pulmonary myofibroblasts through Id2
Am J Physiol Lung Cell Mol Physiol,
January 1, 2006;
290(1):
L120 - L126.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. S. Hofmann, X. Wang, C. P. Sullivan, P. Toselli, P. J. Stone, S. E. McLean, R. P. Mecham, B. M. Schreiber, and G. E. Sonenshein
B-Myb Represses Elastin Gene Expression in Aortic Smooth Muscle Cells
J. Biol. Chem.,
March 4, 2005;
280(9):
7694 - 7701.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Tanaka, T. T. Antoniv, K. Liu, L. Wang, D. J. Wells, F. Ramirez, and G. Bou-Gharios
Cooperativity between Far Upstream Enhancer and Proximal Promoter Elements of the Human {alpha}2(I) Collagen (COL1A2) Gene Instructs Tissue Specificity in Transgenic Mice
J. Biol. Chem.,
December 31, 2004;
279(53):
56024 - 56031.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Nagato, N. Matsuo, H. Sumiyoshi, K. Sakata-Takatani, M. Nasu, and H. Yoshioka
The Transcription Factor CCAAT-binding Factor CBF/NF-Y and Two Repressors Regulate the Core Promoter of the Human Pro-{alpha}3(V) Collagen Gene (COL5A3)
J. Biol. Chem.,
November 5, 2004;
279(45):
46373 - 46383.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. S. Hofmann, C. P. Sullivan, H.-Y. Jiang, P. J. Stone, P. Toselli, E. D. Reis, I. Chereshnev, B. M. Schreiber, and G. E. Sonenshein
B-Myb Represses Vascular Smooth Muscle Cell Collagen Gene Expression and Inhibits Neointima Formation After Arterial Injury
Arterioscler. Thromb. Vasc. Biol.,
September 1, 2004;
24(9):
1608 - 1613.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|