Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M209352200 on November 6, 2002

J. Biol. Chem., Vol. 278, Issue 3, 1612-1617, January 17, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/3/1612    most recent
M209352200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Marshall-Batty, K. R.
Right arrow Articles by Nakai, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Marshall-Batty, K. R.
Right arrow Articles by Nakai, H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

trans-Targeting of the Phage Mu Repressor Is Promoted by Conformational Changes That Expose Its ClpX Recognition Determinant*

Kimberly R. Marshall-Batty and Hiroshi NakaiDagger

From the Department of Biochemistry and Molecular Biology, Georgetown University Medical Center, Washington, D. C. 20057

Received for publication, September 12, 2002, and in revised form, October 28, 2002

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Dominant negative forms of the phage Mu repressor, including the mutant Vir repressors, are not only rapidly degraded by the ClpXP protease but also promote degradation of the unmodified, wild-type repressor. This trans-targeting of the wild-type repressor depends upon a determinant within its C-terminal domain, which is needed for recognition by ClpX. An environmentally sensitive fluorescent probe (2-(4'-maleimidylanilino)naphthalene-6-sulfonic acid (MIANS)) attached to the C terminus of the full-length repressor indicated that Vir induces the movement of this domain into a more exposed configuration. Vir also promoted attachment of MIANS to the C terminus of the repressor at an accelerated rate, and it greatly increased the rate of phosphorylation of a cAMP-dependent protein kinase motif attached to the repressor C terminus. While an excess of Vir was needed to promote repressor phosphorylation at maximal rates, the presence of ClpX could increase phosphorylation rates at lower Vir levels. trans-Targeting of the Mu repressor is therefore promoted by exposing its ClpX recognition determinant, and the action of ClpX can assist Vir in exposing these determinants.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Degradation of substrates by the Escherichia coli ClpXP protease is carried out by recognition of the substrates by the molecular chaperone ClpX, which promotes the ATP-dependent unfolding and transfer of the substrates to the active site of the ClpP subunit (1-4). The proteolytic component is made up of a tetradecamer of ClpP subunits, which form an inner proteolytic chamber where the serine active sites are located (5). ClpX, which forms a hexameric ring (6), binds proteins that bear a recognition motif found either at the N or C terminus of natural substrates (7-9), a determinant for which no apparent consensus sequence has yet emerged.

One mechanism for regulating degradation of ClpXP substrates is trans-targeting, in which a regulatory protein promotes degradation of a second protein. Substrates of this targeting mechanism include the DNA polymerase subunit UmuD', the stationary phase and stress response sigma factor sigma S, peptides marked with the ssrA degradation tag, and the phage Mu immunity repressor (Fig. 1A). Proteolysis of these proteins is promoted respectively by the UmuD' precursor UmuD (10), RssB (11-14), SspB (15), and dominant negative forms of phage Mu repressor called Vir1 (16-18). The mutant Vir repressors have an altered sequence at the C terminus due to a frameshift mutation (Fig. 1C). They not only are rapidly degraded by ClpXP but also promote degradation of the unmodified repressor (hereby called Rep to indicate the wild-type repressor). Repressor peptides marked with the ssrA tag can also promote degradation of Rep (19).


View larger version (29K):
[in this window]
[in a new window]
 
Fig. 1.   Repressor domains and mutants. A, the three major domains of the repressor. The leucine-rich domain located between the DBD and the CTD is hypothesized to play a role in repressor oligomerization (38) and is required for repressor activity (19, 47, 48). B, repressor proteins with a single cysteine at the C terminus for the attachment of MIANS. There is a C17A change in the DBD so that MIANS does not bind at that site. C, sequence at the CTD of wild-type, mutant, and engineered repressors. Those residues that are different from the Rep sequence are marked with and an asterisk.

For the Mu life cycle, trans-targeting can potentially be a mechanism for promoting derepression in response to specific physiological conditions. The Mu genome is a transposable element, a property that is exploited in the establishment of lysogeny and phage DNA replication (see Ref. 20 for a review). Rep, encoded by the c gene, establishes lysogeny by shutting down Mu transposition functions A and B after the first integration event. Binding to Mu operator sequences, Rep shuts down transcription of the transposition genes (21) and also competes for MuA transposase binding sites within the operator (22, 23). Degradation of the Mu repressor induced by co-expression of Vir can trigger lytic development. Physiological conditions that promote derepression include carbon starvation and entry into stationary phase, a process termed S derepression, which is dependent upon clpX, clpP, lon, and rpoS host functions (24). Although Mu lytic development does not proceed at optimal rates under these conditions, derepression can lead to transposase-dependent genetic rearrangements (25-27). An interesting possibility is that ssrA-tagged repressor peptides, which can arise when ribosomes become stalled on mRNA (28-30), may trigger repressor degradation under starvation and stationary phase conditions (19).

Rep is stable in vivo even though it is degraded by ClpXP protease with approximately the same catalytic rate constant as that of Vir (31). Unlike Vir, Rep is degraded with a relatively high Michaelis constant (Km), and it becomes resistant to ClpXP in the presence of DNA. In the presence of Vir, Rep acquires the attributes of low Km and protease sensitivity in the presence of DNA. These results have suggested that a determinant recognized with high affinity by ClpX is already present in Rep but is not readily accessible, especially in the presence of DNA. trans-Targeting proteins such as Vir may function to expose such a determinant in Rep to promote its degradation. The self-associating property of repressor molecules, which exists in solution as a hexamer or higher order oligomer (32, 33), may promote Rep-Vir interactions for this process.

We have previously hypothesized (31, 34) that such interactions may induce movement of the repressor C-terminal domain (CTD, residues Ile-170 to Val-196; see Fig. 1A), which functions in modulating Rep degradation as well as DNA binding. Deletion of 18 residues from the C terminus (RepDelta 18 encoded by the sts62-1 allele; Fig. 1C) suppresses temperature-sensitive mutations in the N-terminal DNA binding domain (DBD; Lys-13 to Ser-80) and confers dominance over the vir alleles (35). In ssrA knock-out strains, truncated repressors like RepDelta 18 accumulate and block S derepression (36). There are a number of lines of evidence that indicates that the CTD includes key residues that make up the ClpX recognition determinant. Repressor mutants with an 18-residue deletion (RepDelta 18) or certain single amino acid replacements in the CTD have been found to be resistant to ClpXP degradation in the presence or absence of Vir (37). In addition, heat denaturation accelerates Rep degradation by ClpXP without Vir, while ClpXP-resistant CTD mutants cannot be degraded even after denaturation.

In this paper we demonstrate that Vir promotes conformational changes in Rep, inducing movement of the CTD such that it becomes more exposed. We previously determined that the Rep C terminus is found in a relatively hydrophobic environment, whereas the Vir C terminus is found in a hydrophilic environment (34). Here we demonstrate that Vir can induce the Rep C terminus to enter an even more hydrophilic environment, allowing enzymes to gain access to this domain more readily. Moreover, the action of ClpX is able to reduce the number of Vir molecules needed to promote maximal accessibility. The results indicate that Vir promotes trans-targeting by exposing ClpX recognition determinants within the CTD and that ClpX can assist Vir in this process.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Bacterial Strains, Plasmids, and Proteins-- Repressor proteins Rep and Vir3060 were overexpressed from plasmids pHS502 and pHS504, which contain the respective repressor alleles between the NdeI and BamHI sites of pET-11a (Novagen). Plasmids pGTN130 and pGTN206 for overproducing RepC17A and VirC17A were constructed from pHS502 and pHS504, respectively, using the Stratagene QuikChangeTM site-directed mutagenesis kit. Construction of plasmids pGTN204 (RepC197) and pGTN211 (VirC192), derivatives of pREP-1 (31), and pGTN210 (RepDelta 18), a derivative of pHS502, were described previously (34). RepNK was overproduced from pREP-NK, which was constructed by PCR amplification of the c+ gene in pJV300 (38), using an N-terminal primer that contains the coding sequence for the cAMP-dependent kinase motif (39). The primer adds the sequence GGACTTCGAAGAGCTTCTGTTATC encoding the peptides GIRRASVI between the first two codons (Met1 and Lys2) of the repressor gene. The RepNK coding sequence was inserted at the NcoI and BamHI sites of pET-19b (Novagen), using the NcoI site at the AUG start codon and a BamHI site adjacent the stop codon. RepCK was overproduced from pREP-CK, which is a derivative of pREP-1. The sequence CTTCGAAGAGCTTCTGTTGGTUAA encoding the peptide IRRASVG was fused to the C-terminal coding sequence of the c+ gene using the Stratagene ExSiteTM PCR-based mutagenesis kit.

All repressor proteins (34) and the ClpX protein (31) were purified as described previously. All protein concentrations are given in equivalents of protein monomers.

Fluorescence Spectroscopy-- Thiol-specific attachment of 2-(4'-maleimidylanilino)naphthalene-6-sulfonic acid (MIANS; Molecular Probes) to repressor proteins and quantitation of bound MIANS were conducted as described previously (34). A 3-6-fold excess of MIANS over the target repressor protein was added to each reaction mixture, which was incubated at 37 °C. In all experiments, greater than 90% of the target repressor proteins, which bear a single cysteine residue, had bound MIANS after incubation for 10 min.

Fluorescence measurements were taken with an Aminco-Bowman Series 2 luminescence spectrometer using a path length of 4 cm. All analyses were conducted in 25 mM HEPES-K+, 200 mM potassium glutamate, and 10 mM maganesium acetate with the indicated concentrations of repressor proteins in a sample volume of 200 µl. MIANS fluorescence was monitored at an excitation wavelength of 330 nm and an emission wavelength of 420 nm with constant stirring at 37 °C.

Phosphorylation of RepNK and RepCK-- RepNK radiolabeled to high specific activity for trypsin cleavage analysis was prepared as described previously (39) with modifications. Reaction mixtures (30 µl) contained 3 µM RepNK, 1.5 µM [gamma -32P]ATP (PerkinElmer Life Sciences; 3000 Ci/mmol), 25 mM Tris-HCl (pH 7.5), 2 mM DTT, 100 mM NaCl, 12 mM MgCl2, 10 mM NaF, and 25 units catalytic subunit of the cAMP-dependent protein kinase (PKA; New England Biolabs). Incubation was at 37 °C for 10 min, and the reaction was stopped by addition of EDTA to 30 mM.

The kinetics of phosphorylation of RepNK and RepCK was monitored under the same conditions except that the reaction mixture contained 60 µM [gamma -32P]ATP (10 Ci/mmol), 8 units of PKA, and repressor proteins at the indicated concentrations. When Vir, Rep, or ClpX were present together with RepNK or RepCK, the reaction mixture was assembled and allowed to incubate 10 min at 37 °C prior to adding [gamma -32P]ATP and PKA. Reaction mixtures were resolved by electrophoresis on a 10% or 12% SDS-polyacrylamide gel. The gel was stained with Coomassie Blue R-250 and dried down for quantitation on an Amersham Biosciences Storm 840 PhosphorImager system. Bands corresponding to the maximum incubation times were then excised, and the level of Cheronkov radiation was measured on a Beckman LS6500 Multi-purpose Scintillation Counter to determine the fraction of repressor proteins phosphorylated.

Trypsin Cleavage of Repressor Proteins-- Reaction mixtures (20 µl) contained 25 mM HEPES-K+ (pH 7.5), 200 mM potassium glutamate, 10 mM magnesium acetate and the indicated concentrations of 32P-RepNK (10,000-13,000 cpm/pmol) and unlabeled repressor proteins. 32P-RepNK and an unlabeled repressor protein were first mixed and allowed to incubate for 10 mins at 37 °C before addition of 1 µg trypsin. Digestion was allowed to proceed at the same temperature for 1 h, and then reactions were stopped by the addition of phenylmethylsulfonyl fluoride to 2% (w/v) final concentration. The cleavage patterns were analyzed on a 10% SDS-polyacrylamide gel. The gel was stained with Coomassie Blue, dried down, and subjected to autoradiography.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Mutant Repressors with an Altered CTD Induce Conformational Changes in Rep-- We examined whether mutant repressors with an altered CTD can influence the conformation of Rep molecules. We first examined their influence on the conformational state of Rep using the trypsin hypersensitive site at Arg-70 as a marker (34). When not bound to DNA, Rep is hypersensitive to cleavage at Arg-70, a property dependent upon the close proximity of the CTD to the DBD. Upon cleavage at Arg-70, the resulting peptides become susceptible to cleavage by trypsin at other sites. This hypersensitivity, which is lost as Rep interacts with DNA and the CTD moves away from the DBD, is absent in Vir and RepDelta 18. These repressor molecules therefore remain intact under conditions that promote degradation of Rep to small fragments.

We determined that both Vir and RepDelta 18 could induce Rep to lose hypersensitivity at this site. Purified wild-type repressor with a cAMP-dependent protein kinase motif at the N terminus (RepNK) was radiolabeled using [gamma -32P]ATP, mixed with an excess of unlabeled Rep, Vir, RepDelta 18, or RepNK, and treated with trypsin. The susceptibility of 32P-RepNK to tryptic digestion was influenced by the properties of the excess unlabeled repressor protein in the reaction mixture. 32P-RepNK in the presence of unlabeled Rep and RepNK was rapidly cleaved by trypsin (Fig. 2, lanes 5 and 8). In contrast, Vir and RepDelta 18 remained relatively resistant to cleavage and 32P-RepNK became resistant in their presence (lanes 6 and 7). This indicates that Vir and RepDelta 18 can induce conformational changes in Rep, most likely by inducing movement of the CTD with respect to the DBD.


View larger version (52K):
[in this window]
[in a new window]
 
Fig. 2.   Cleavage of Rep NK by trypsin is influenced by the presence of mutant repressors. Reaction mixtures (20 µl) contained 32P-RepNK (0.4 µM) and the indicated unlabeled repressor protein (4.3 µM). For cleavage analysis (lanes 5-8) 1 µg of trypsin was added, and the mixture was incubated for 1 h at 37 °C. Polypeptides were resolved by SDS-polyacrylamide gel electrophoresis, and the gel was stained with Coomassie Blue (A) and dried down for autoradiography (B).

Vir Induces Movement of the Rep CTD to a More Hydrophilic Environment-- We previously determined that the Rep C terminus is in a hydrophobic environment, whereas the Vir3060 C terminus is in a relatively hydrophilic one (34). We used repressor proteins with the C17A substitution and a single cysteine introduced at the C terminus, modifications that do not alter the respective properties of the protein as a ClpXP substrate (data not shown; VirC192 and RepC197; see Fig. 1B). As demonstrated previously, when the thiol-specific fluorophore MIANS was attached to the single cysteine at the C terminus, we obtained emission maxima of 429 and 439 nm for RepC197 and VirC192, respectively (Fig. 3, A and B). The fluorescence intensity of VirC192-MIANS was greatly diminished in comparison with that of RepC197-MIANS, consistent with the probe at the Vir C terminus being in a more hydrophilic environment (40).


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 3.   Vir induces the Rep C terminus to enter a hydrophilic environment. Reaction mixtures contained RepC197 or VirC192 (1.5 µM), VirC17A or RepC17A (4.5 µM) where indicated, and MIANS (4.5 µM). The presence of cysteine-less repressor VirC17A and RepC17A are indicated in parentheses to emphasize that they do not bind MIANS and thus do not become fluorescent. The emission spectra of bound MIANS were obtained (A, C). The three major spectra in A were normalized to compare emission maxima (B).

When MIANS was attached to RepC197 in the presence of 3-fold excess VirC17A, which has no cysteine residues, fluorescence intensity was diminished (Fig. 3A), and the emission spectrum was red-shifted 20 nm to 449 nm (Fig. 3B), indicating that the Rep C terminus had entered an environment even more hydrophilic than that of the Vir C terminus. Although RepC197-MIANS in the presence of Vir has an emission maximum of longer wavelength, it has a higher fluorescence intensity than VirC192-MIANS. At the C terminus of Vir, MIANS is attached to basic residues (HRR), and these residues most likely further quench its fluorescence. The presence of 3-fold excess RepC17A instead of VirC17A slightly increased the fluorescence intensity and did not change emission maximum of the attached MIANS (Fig. 3C). The results indicate that Vir can induce movement of the Rep CTD such that it is more exposed to solvent and therefore more accessible to ClpX. Reducing the levels of VirC17A to a level equimolar to RepC197 diminished the red shift to ~1-2 nm (data not shown). An excess of Vir was therefore needed to efficiently induce the Rep conformational change.

Vir Increases the Rate of MIANS Attachment to the Rep C Terminus-- MIANS has the convenient characteristic of becoming fluorescent only upon attachment to cysteine residues, and we used this property to examine accessibility of Rep C terminus. MIANS is attached to VirC192 at a much faster rate than it is to RepC197 (34). In the presence of VirC17A, the rate of MIANS attachment to RepC197 was increased to the same rate as its attachment to VirC192 (Fig. 4A), indicating that the Vir-induced movement of the Rep CTD greatly increases its accessibility. In the attachment of MIANS to VirC192, a spike in fluorescence was reproducibly recorded at ~200 s (34), an anomaly not observed in the attachment of MIANS to RepC197 when VirC17A was present (Fig. 4A). Although the cause of this transient increase in fluorescence has not been definitively demonstrated, it may reflect a transient fluctuation in the conformation of the VirC192 protein population upon becoming saturated with MIANS.


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 4.   Kinetics attachment of MIANS to the CTD of repressor molecules. Reaction mixtures contained RepC197, VirC192, or Rep (1.5 µM), VirC17A or RepC17A (4.5 µM) where indicated (in parentheses to emphasize that they do not bind MIANS), and MIANS (9.5 µM). The time course of MIANS attachment indicated by increase in fluorescence was monitored at 37 °C. The proportion of repressor molecules with bound MIANS at the end of the incubation period was determined as described previously (34). A, effect of VirC17A on the time course of MIANS attachment to RepC197 and Rep. B, effect of RepC17A on the time course of MIANS attachment to RepC197.

Unlike its effect on RepC197, VirC17A decreased the rate of attachment of MIANS to the native C17 residue present in the DBD of Rep (Fig. 4A). This indicates that VirC17A is not increasing accessibility of all parts of Rep. Moreover, RepC17A had no effect on the attachment of MIANS to RepC197 (Fig. 4B).

ClpX Decreases the Amount of Vir Required to Promote Maximal Accessibility of the Rep C Terminus-- The 7-residue cAMP-dependent protein kinase motif (IRRASVG) was engineered onto the C terminus of Rep (RepCK) to examine how Vir and ClpX can influence the rate of its phosphorylation. Under the assay conditions, RepCK was phosphorylated at a very low rate, and the presence of ClpX did not significantly increase the rate of phosphorylation (Fig. 5A). However, Vir promoted a large increase in the rate of RepCK phosphorylation (Fig. 5A). Increasing the Vir to RepCK ratio from 1:1 to 4:1 progressively increased the rate of phosphorylation (Fig. 5, A-D), indicating that the Rep CTD movement induced by Vir exposes this domain and makes the attached kinase motif accessible to phosphorylation. At a Vir to RepCK ratio of 4:1, the presence of ClpX promoted only a slight increase in the phosphorylation rate; but at lower levels of Vir, ClpX did promote a significant increase in phosphorylation rates, indicating that the recognition and unfolding of protomers in repressor oligomers by ClpX can further expose the CTDs of additional Rep molecules. In contrast, Vir could not promote any increase in the low level of phosphorylation of the kinase motif at the Rep N terminus even in the presence of ClpX (Fig. 5E), indicating that Vir and ClpX are not necessarily increasing accessibility of all domains of Rep. In addition, Rep and RepDelta 18 were unable to promote any increase in the phosphorylation rate of RepCK (Fig. 5F), indicating that these proteins do not promote exposure of the Rep CTD. These results indicate that ClpX can assist Vir in exposing the Rep CTD.


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 5.   Effect of Vir and ClpX on the phosphorylation of RepCK and RepNK. Phosphorylation with the catalytic subunit of the cAMP-dependent protein kinase was conducted in reaction mixtures containing RepCK or RepNK (0.5 µM) and ClpX (0.22 µM; 37 nM as hexamers) where indicated. Vir, RepDelta 18, or Rep were present at 2 µM (A), 1.5 µM (B, E, and F), 1.0 µM (C), and 0.5 µM (D) as indicated. A-D: black-square, RepCK only; black-diamond , RepCK with Vir; open circle , RepCK with ClpX; and triangle , RepCK with Vir and ClpX. E: , RepNK only; diamond , RepNK with Vir; and black-triangle, RepNK with Vir and ClpX. F: down-triangle, RepCK with Rep; *, RepCK with Rep and ClpX; and otimes , RepCK with RepDelta 18.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

trans-Targeting of Rep by Vir Is Promoted by Inducing Conformational Changes That Expose ClpX Recognition Determinants in the Rep CTD-- The CTD of Rep plays a critical role in both Rep degradation promoted by altered forms of the repressor and the formation of the repressor-operator complex, enabling the Rep population to respond to specific physiological conditions such as carbon starvation and entry into stationary phase (19, 24, 35, 36). Although ClpXP-sensitive Vir can promote Rep degradation, Rep does have intrinsic sensitivity to ClpXP protease by itself (31), indicating that it contains a ClpX recognition determinant. However, the context of this determinant influences to a large degree the efficiency with which it is recognized by ClpX. In the absence of DNA, Rep is degraded with a relatively high Km. In the presence of Vir, Rep is degraded with a lower Km that is essentially identical to that of Vir. Heat denaturation of Rep also allows it to be rapidly degraded without Vir (37).

Thus, what constitutes a ClpX recognition determinant is not simply determined by the presence of a recognition motif but also by factors such as accessibility and display of the motif. And what constitutes the minimal elements of the Rep ClpX recognition determinant remains to be defined. Nevertheless, the Rep CTD is an important part of that determinant. Cysteine replacement mutations at 8 of the last 17 C-terminal residues and a deletion of even a single residue at the C terminus result in gain of dominance over vir alleles (37). Biochemical analyses have shown that RepDelta 18, and at least two CTD mutants with a single cysteine replacement (V183C and V196C) have lost intrinsic sensitivity to ClpXP even after heat denaturation, indicating that a determinant within the CTD is required for ClpX recognition. Vir can induce the movement of the Rep CTD such that it is more exposed, most likely so that it can be bound by ClpX. Thus trans-targeting can be the result of unmasking a largely inaccessible recognition determinant.

Although an excess of Vir was needed to induce the conformational change, ClpX could assist in the Vir-induced exposure of the CTD. Very low levels of Vir must be effective in promoting derepression, for it is rapidly degraded in vivo and is not able to accumulate to high levels and yet it effectively promotes Rep degradation (17). Vir promotes recognition of Rep molecules by ClpX, which in turn aids Vir in inducing Rep conformational changes. Recognition and unfolding of protomers may dissociate ClpXP-sensitive repressor oligomers and create interacting surfaces for conversion of additional Rep molecules to the protease-sensitive conformation. The repressor molecules that induce the conversion to the sensitive conformation may not necessarily be Vir molecules and may be Rep molecules previously converted to this conformation.

If Vir and ClpX catalytically generate Rep molecules with an exposed CTD, it is likely that such Rep molecules maintain this "exposed" conformation only transiently before returning to the "unexposed" conformation. For example, at a limiting Vir concentration, ClpX promotes increased phosphorylation of RepCK at a uniform rate over a 25-min time course (Fig. 5D). If stably exposed RepCK molecules accumulate during the time course, phosphorylation of RepCK should be accelerated in this time period. The presence of Vir and ClpX therefore appears to increase phosphorylation rates by maintaining a higher steady-state level of exposed RepCK. Less than stoichiometric amounts of Vir that efficiently promote Rep degradation in vitro (31) are not as effective in increasing RepCK phosphorylation. However, if the recognition and unfolding of Rep protomers lead to exposure of additional ClpX recognition motifs, protein unfolding by ClpX may be coupled to its recognition of additional protomers. In this way, when a threshold of inducing molecules such as ssrA-tagged repressor peptides accumulate under certain physiological conditions, they may begin a catalytic process to promote degradation of the bulk Rep population.

Implications for Understanding General Mechanisms Involved in trans-Targeting-- It is not yet clear whether the mechanism of trans-targeting of the Mu repressor by Vir will turn out to be similar to trans-targeting by other regulator proteins that promote degradation. Unlike Vir, trans-targeting proteins UmuD, RssB, and SspB target the respective substrates without being degraded themselves by ClpXP (10, 14, 15). Gonzalez et al. (10) determined that an alanine stretch introduced into the UmuD N-terminal segment, which is not present on UmuD', prevents UmuD-directed degradation of UmuD' by ClpXP. The result suggests that this is the segment recognized by ClpX in the UmuD-UmuD' heterodimer. UmuD as well as RssB and SspB may interact with ClpX to deliver the respective protease substrates to the active site of ClpX.

Nevertheless, ClpX substrates in general have been found to contain recognition motifs, for which there is no apparent consensus sequence. Thus, it is conceivable that these regulator proteins promote exposure of a motif within the target protein. For example, sigma S and phosphorylated RssB together bind with high affinity to ClpX even though neither alone do so (14); this leaves open the possibility that the complex exposes a determinant in sigma S bound by ClpX. Hoskins et al. (41) recently determined that the ClpX recognition motif present at the C terminus of MuA transposase can also be recognized at an interior position of a MuA-green fluorescent protein fusion, albeit less efficiently. This raises the possibility that a trans-targeting protein might promote exposure of a recognition motif present in the interior of the target protein.

Transmission of Conformation Changes as a General Mechanism in Disseminating Physiological Signals-- Studies of prions in mammals and prion-like proteins in yeast have raised interesting questions about the dissemination of conformational states among protein molecules and whether such a mechanism is generally employed in nature (42-46). While prions have been implicated in the transmission of a neurodegenerative disasease (spongiform encelopathy) in mammals, prion-like proteins in yeast have been implicated in the dissemination of heritable phenotypic traits. Although Vir is not known to promote protein-based inheritance, the way it promotes Rep degradation by inducing conformational changes reflects a prion-like mechanism at work in the dissemination of a molecular signal.

    ACKNOWLEDGEMENTS

We thank Shawna Lagan and Charan Gowda for constructing overproducers of repressor proteins with an attached kinase motif and also C. Gowda for purifying these proteins. We thank Elliott Crooke and Stella North for critically reading the manuscript.

    FOOTNOTES

* This work was supported by National Institutes of Health Grant GM58265 (to H. N.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger To whom correspondence should be addressed: Dept. of Biochemistry and Molecular Biology, School of Medicine, Georgetown University, Box 571455, Washington, D. C. 20057-1421. Tel.: 202-687-1442; Fax: 202-687-7186; E-mail: nakai@bc.georgetown.edu.

Published, JBC Papers in Press, November 6, 2002, DOI 10.1074/jbc.M209352200

    ABBREVIATIONS

The abbreviations used are: Vir, repressor encoded by a virulent mutant of Mu; VirC192, Vir repressor with a C17A alteration and a cysteine added at the C terminus; VirC17A, cysteine-less Vir repressor having a C17A alteration; CTD, C-terminal domain; DBD, DNA binding domain; MIANS, 2-(4'-maleimidylanilino)naphthalene-6-sulfonic acid; Rep, wild-type Mu repressor; RepDelta 18, repressor truncated by 18 residues at the C-terminal end; RepC197, repressor with a C17A alteration and a cysteine residue added at the C terminus; RepC17A, cysteine-less repressor having a C17A alteration; RepNK, repressor with a kinase motif at the N terminus; RepCK, repressor with a kinase motif at the C terminus; PKA, catalytic subunit of the cAMP-dependent protein kinase.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Gottesman, S., Clark, W. P., de Crécy-Lagard, V., and Maurizi, M. R. (1993) J. Biol. Chem. 268, 22618-22626[Abstract/Free Full Text]
2. Kim, Y. I., Burton, R. E., Burton, B. M., Sauer, R. T., and Baker, T. A. (2000) Mol. Cell 5, 639-648[CrossRef][Medline] [Order article via Infotrieve]
3. Singh, S. K., Grimaud, R., Hoskins, J. R., Wickner, S., and Maurizi, M. R. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 8898-8903[Abstract/Free Full Text]
4. Wojtkowiak, D., Georgopoulos, C., and Zylicz, M. (1993) J. Biol. Chem. 268, 22609-22617[Abstract/Free Full Text]
5. Wang, J., Hartling, J. A., and Flanagan, J. M. (1997) Cell 91, 447-456[CrossRef][Medline] [Order article via Infotrieve]
6. Grimaud, R., Kessel, M., Beuron, F., Steven, A. C., and Maurizi, M. R. (1998) J. Biol. Chem. 273, 12476-12481[Abstract/Free Full Text]
7. Flynn, J. M., Levchenko, I., Seidel, M., Wickner, S. H., Sauer, R. T., and Baker, T. A. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 10584-10589[Abstract/Free Full Text]
8. Gonciarz-Swiatek, M., Wawrzynow, A., Um, S. J., Learn, B. A., McMacken, R., Kelley, W. L., Georgopoulos, C., Sliekers, O., and Zylicz, M. (1999) J. Biol. Chem. 274, 13999-14005[Abstract/Free Full Text]
9. Levchenko, I., Yamauchi, M., and Baker, T. A. (1997) Genes Dev. 11, 1561-1572[Abstract/Free Full Text]
10. Gonzalez, M., Rasulova, F., Maurizi, M. R., and Woodgate, R. (2000) EMBO J. 19, 5251-5258[CrossRef][Medline] [Order article via Infotrieve]
11. Bearson, S. M., Benjamin, W. H., Jr., Swords, W. E., and Foster, J. W. (1996) J. Bacteriol. 178, 2572-2579[Abstract/Free Full Text]
12. Muffler, A., Fischer, D., Altuvia, S., Storz, G., and Hengge-Aronis, R. (1996) EMBO J. 15, 1333-1339[Medline] [Order article via Infotrieve]
13. Pratt, L. A., and Silhavy, T. J. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 2488-2492[Abstract/Free Full Text]
14. Zhou, Y., Gottesman, S., Hoskins, J. R., Maurizi, M. R., and Wickner, S. (2001) Genes Dev. 15, 627-637[Abstract/Free Full Text]
15. Levchenko, I., Seidel, M., Sauer, R. T., and Baker, T. A. (2000) Science 289, 2354-2356[Abstract/Free Full Text]
16. Geuskens, V., Vogel, J. L., Grimaud, R., Desmet, L., Higgins, N. P., and Toussaint, A. (1991) J. Bacteriol. 173, 6578-6585[Abstract/Free Full Text]
17. Geuskens, V., Mhammedi-Alaoui, A., Desmet, L., and Toussaint, A. (1992) EMBO J. 11, 5121-5127[Medline] [Order article via Infotrieve]
18. Mhammedi-Alaoui, A., Pato, M., Gama, M.-J., and Toussaint, A. (1994) Mol. Microbiol. 11, 1109-1116[CrossRef][Medline] [Order article via Infotrieve]
19. O'Handley, D., and Nakai, H. (2002) J. Mol. Biol. 322, 311-324[CrossRef][Medline] [Order article via Infotrieve]
20. Symonds, N., Toussaint, A., van de Putte, P., and Howe, M. M. (eds) (1987) Phage Mu , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
21. Krause, H. M., and Higgins, N. P. (1986) J. Biol. Chem. 261, 3744-3752[Abstract/Free Full Text]
22. Leung, P. C., Teplow, D. B., and Harshey, R. M. (1989) Nature 338, 656-658[CrossRef][Medline] [Order article via Infotrieve]
23. Mizuuchi, M., and Mizuuchi, K. (1989) Cell 58, 399-408[CrossRef][Medline] [Order article via Infotrieve]
24. Lamrani, S., Ranquet, C., Gama, M. J., Nakai, H., Shapiro, J. A., Toussaint, A., and Maenhaut-Michel, G. (1999) Mol. Microbiol. 32, 327-343[CrossRef][Medline] [Order article via Infotrieve]
25. Shapiro, J. A. (1984) Mol. Gen. Genet. 194, 79-90[CrossRef][Medline] [Order article via Infotrieve]
26. Maenhaut-Michel, G., and Shapiro, J. A. (1994) EMBO J. 13, 5229-5239[Medline] [Order article via Infotrieve]
27. Shapiro, J. A., and Leach, D. (1990) Genetics 126, 293-299[Abstract]
28. Keiler, K. C., Waller, P. R. H., and Sauer, R. T. (1996) Science 271, 990-993[Abstract]
29. Atkins, J. F., and Gesteland, R. F. (1996) Nature 379, 769-771[CrossRef][Medline] [Order article via Infotrieve]
30. Jentsch, S. (1996) Science 271, 955-956[CrossRef][Medline] [Order article via Infotrieve]
31. Welty, D. J., Jones, J. M., and Nakai, H. (1997) J. Mol. Biol. 272, 31-41[CrossRef][Medline] [Order article via Infotrieve]
32. Alazard, R., Ebel, C., Venien-Bryan, V., Mourey, L., Samama, J. P., and Chandler, M. (1998) Eur. J. Biochem. 252, 408-415[Medline] [Order article via Infotrieve]
33. Rousseau, P., Bétermier, M., Chandler, M., and Alazard, R. (1996) J. Biol. Chem. 271, 9739-9745[Abstract/Free Full Text]
34. Rai, S. S., O'Handley, D., and Nakai, H. (2001) J. Mol. Biol. 312, 311-322[CrossRef][Medline] [Order article via Infotrieve]
35. Vogel, J. L., Geuskens, V., Desmet, L., Higgins, N. P., and Toussaint, A. (1996) Genetics 142, 661-672[Abstract]
36. Ranquet, C., Geiselmann, J., and Toussaint, A. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 10220-10225[Abstract/Free Full Text]
37. Mukhopadyay, B., Marshall-Batty, K. R., Kim, B. D., O'Handley, D., and Nakai, H. (2002) Mol. Microbiol., in press
38. Vogel, J. L., Li, Z. J., Howe, M. M., Toussaint, A., and Higgins, N. P. (1991) J. Bacteriol. 173, 6568-6577[Abstract/Free Full Text]
39. Kelman, Z., Naktinis, V., and O'Donnell, M. (1995) Methods Enzymol. 262, 430-442[Medline] [Order article via Infotrieve]
40. Hiratsuka, T. (1992) J. Biol. Chem. 267, 14941-14948[Abstract/Free Full Text]
41. Hoskins, J. R., Yanagihara, K., Mizuuchi, K., and Wickner, S. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 11037-11042[Abstract/Free Full Text]
42. Prusiner, S. B. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 13363-13383[Abstract/Free Full Text]
43. Osherovich, L. Z., and Weissman, J. S. (2002) Dev. Cell 2, 143-151[CrossRef][Medline] [Order article via Infotrieve]
44. Uptain, S. M., and Lindquist, S. (2002) Annu. Rev. Microbiol. 56, 703-741[CrossRef][Medline] [Order article via Infotrieve]
45. Wickner, R. B., Taylor, K. L., Edskes, H. K., Maddelein, M. L., Moriyama, H., and Roberts, B. T. (2000) J. Struct. Biol. 130, 310-322[CrossRef][Medline] [Order article via Infotrieve]
46. Cohen, F. E., and Prusiner, S. B. (1998) Annu. Rev. Biochem. 67, 793-819[CrossRef][Medline] [Order article via Infotrieve]
47. Ilangovan, U., Wojciak, J. M., Connolly, K. M., and Clubb, R. T. (1999) Biochemistry 38, 8367-8376[CrossRef][Medline] [Order article via Infotrieve]
48. Rousseau, P., Laachouch, J. E., Chandler, M., and Toussaint, A. (2002) Res. Microbiol. 153, 511-518[Medline] [Order article via Infotrieve]


Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
K. R. Marshall-Batty and H. Nakai
Activation of a Dormant ClpX Recognition Motif of Bacteriophage Mu Repressor by Inducing High Local Flexibility
J. Biol. Chem., April 4, 2008; 283(14): 9060 - 9070.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. A. Defenbaugh and H. Nakai
A Context-dependent ClpX Recognition Determinant Located at the C Terminus of Phage Mu Repressor
J. Biol. Chem., December 26, 2003; 278(52): 52333 - 52339.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. B. Neher, R. T. Sauer, and T. A. Baker
Distinct peptide signals in the UmuD and UmuD' subunits of UmuD/D' mediate tethering and substrate processing by the ClpXP protease
PNAS, November 11, 2003; 100(23): 13219 - 13224.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/3/1612    most recent
M209352200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Marshall-Batty, K. R.
Right arrow Articles by Nakai, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Marshall-Batty, K. R.
Right arrow Articles by Nakai, H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement