|
Originally published In Press as doi:10.1074/jbc.M209352200 on November 6, 2002
J. Biol. Chem., Vol. 278, Issue 3, 1612-1617, January 17, 2003
trans-Targeting of the Phage Mu Repressor Is
Promoted by Conformational Changes That Expose Its ClpX
Recognition Determinant*
Kimberly R.
Marshall-Batty and
Hiroshi
Nakai
From the Department of Biochemistry and Molecular Biology,
Georgetown University Medical Center, Washington, D. C. 20057
Received for publication, September 12, 2002, and in revised form, October 28, 2002
 |
ABSTRACT |
Dominant negative forms of the phage Mu
repressor, including the mutant Vir repressors, are not only rapidly
degraded by the ClpXP protease but also promote degradation of the
unmodified, wild-type repressor. This trans-targeting of
the wild-type repressor depends upon a determinant within its
C-terminal domain, which is needed for recognition by ClpX. An
environmentally sensitive fluorescent probe
(2-(4'-maleimidylanilino)naphthalene-6-sulfonic acid (MIANS)) attached
to the C terminus of the full-length repressor indicated that Vir
induces the movement of this domain into a more exposed configuration.
Vir also promoted attachment of MIANS to the C terminus of the
repressor at an accelerated rate, and it greatly increased the rate of
phosphorylation of a cAMP-dependent protein kinase motif
attached to the repressor C terminus. While an excess of Vir was needed
to promote repressor phosphorylation at maximal rates, the presence of
ClpX could increase phosphorylation rates at lower Vir levels.
trans-Targeting of the Mu repressor is therefore promoted
by exposing its ClpX recognition determinant, and the action of ClpX
can assist Vir in exposing these determinants.
 |
INTRODUCTION |
Degradation of substrates by the Escherichia coli ClpXP
protease is carried out by recognition of the substrates by the
molecular chaperone ClpX, which promotes the ATP-dependent
unfolding and transfer of the substrates to the active site of the ClpP
subunit (1-4). The proteolytic component is made up of a tetradecamer of ClpP subunits, which form an inner proteolytic chamber where the
serine active sites are located (5). ClpX, which forms a hexameric ring
(6), binds proteins that bear a recognition motif found either at the N
or C terminus of natural substrates (7-9), a determinant for which no
apparent consensus sequence has yet emerged.
One mechanism for regulating degradation of ClpXP substrates is
trans-targeting, in which a regulatory protein promotes
degradation of a second protein. Substrates of this targeting mechanism
include the DNA polymerase subunit UmuD', the stationary phase and
stress response sigma factor S, peptides marked with the
ssrA degradation tag, and the phage Mu immunity repressor
(Fig. 1A). Proteolysis of
these proteins is promoted respectively by the UmuD' precursor UmuD
(10), RssB (11-14), SspB (15), and dominant negative forms of phage Mu
repressor called Vir1
(16-18). The mutant Vir repressors have an altered sequence at the C
terminus due to a frameshift mutation (Fig. 1C). They not only are rapidly degraded by ClpXP but also promote degradation of the
unmodified repressor (hereby called Rep to indicate the wild-type
repressor). Repressor peptides marked with the ssrA tag can
also promote degradation of Rep (19).

View larger version (29K):
[in this window]
[in a new window]
|
Fig. 1.
Repressor domains and mutants.
A, the three major domains of the repressor. The
leucine-rich domain located between the DBD and the CTD is hypothesized
to play a role in repressor oligomerization (38) and is required for
repressor activity (19, 47, 48). B, repressor proteins with
a single cysteine at the C terminus for the attachment of MIANS. There
is a C17A change in the DBD so that MIANS does not bind at that site.
C, sequence at the CTD of wild-type, mutant, and engineered
repressors. Those residues that are different from the Rep sequence are
marked with and an asterisk.
|
|
For the Mu life cycle, trans-targeting can potentially be a
mechanism for promoting derepression in response to specific
physiological conditions. The Mu genome is a transposable element, a
property that is exploited in the establishment of lysogeny and phage
DNA replication (see Ref. 20 for a review). Rep, encoded by the c gene, establishes lysogeny by shutting down Mu
transposition functions A and B after the first
integration event. Binding to Mu operator sequences, Rep shuts down
transcription of the transposition genes (21) and also competes for MuA
transposase binding sites within the operator (22, 23). Degradation of
the Mu repressor induced by co-expression of Vir can trigger lytic
development. Physiological conditions that promote derepression include
carbon starvation and entry into stationary phase, a process termed S derepression, which is dependent upon clpX, clpP,
lon, and rpoS host functions (24). Although Mu
lytic development does not proceed at optimal rates under these
conditions, derepression can lead to transposase-dependent
genetic rearrangements (25-27). An interesting possibility is that
ssrA-tagged repressor peptides, which can arise when
ribosomes become stalled on mRNA (28-30), may trigger repressor
degradation under starvation and stationary phase conditions (19).
Rep is stable in vivo even though it is degraded by ClpXP
protease with approximately the same catalytic rate constant as that of
Vir (31). Unlike Vir, Rep is degraded with a relatively high Michaelis
constant (Km), and it becomes resistant to ClpXP in
the presence of DNA. In the presence of Vir, Rep acquires the
attributes of low Km and protease sensitivity in the
presence of DNA. These results have suggested that a determinant recognized with high affinity by ClpX is already present in Rep but is
not readily accessible, especially in the presence of DNA. trans-Targeting proteins such as Vir may function to expose
such a determinant in Rep to promote its degradation. The
self-associating property of repressor molecules, which exists in
solution as a hexamer or higher order oligomer (32, 33), may promote
Rep-Vir interactions for this process.
We have previously hypothesized (31, 34) that such interactions may
induce movement of the repressor C-terminal domain (CTD, residues
Ile-170 to Val-196; see Fig. 1A), which functions in
modulating Rep degradation as well as DNA binding. Deletion of 18 residues from the C terminus (Rep 18 encoded by the
sts62-1 allele; Fig. 1C) suppresses
temperature-sensitive mutations in the N-terminal DNA binding domain
(DBD; Lys-13 to Ser-80) and confers dominance over the vir
alleles (35). In ssrA knock-out strains, truncated
repressors like Rep 18 accumulate and block S derepression (36).
There are a number of lines of evidence that indicates that the CTD
includes key residues that make up the ClpX recognition determinant.
Repressor mutants with an 18-residue deletion (Rep 18) or certain
single amino acid replacements in the CTD have been found to be
resistant to ClpXP degradation in the presence or absence of Vir (37).
In addition, heat denaturation accelerates Rep degradation by ClpXP
without Vir, while ClpXP-resistant CTD mutants cannot be degraded even
after denaturation.
In this paper we demonstrate that Vir promotes conformational changes
in Rep, inducing movement of the CTD such that it becomes more exposed.
We previously determined that the Rep C terminus is found in a
relatively hydrophobic environment, whereas the Vir C terminus is found
in a hydrophilic environment (34). Here we demonstrate that Vir can
induce the Rep C terminus to enter an even more hydrophilic
environment, allowing enzymes to gain access to this domain more
readily. Moreover, the action of ClpX is able to reduce the number of
Vir molecules needed to promote maximal accessibility. The results
indicate that Vir promotes trans-targeting by exposing ClpX
recognition determinants within the CTD and that ClpX can assist
Vir in this process.
 |
EXPERIMENTAL PROCEDURES |
Bacterial Strains, Plasmids, and Proteins--
Repressor
proteins Rep and Vir3060 were overexpressed from plasmids pHS502 and
pHS504, which contain the respective repressor alleles between the
NdeI and BamHI sites of pET-11a (Novagen). Plasmids pGTN130 and pGTN206 for overproducing RepC17A and VirC17A were
constructed from pHS502 and pHS504, respectively, using the Stratagene QuikChangeTM site-directed mutagenesis kit.
Construction of plasmids pGTN204 (RepC197) and pGTN211 (VirC192),
derivatives of pREP-1 (31), and pGTN210 (Rep 18), a derivative of
pHS502, were described previously (34). RepNK was overproduced from
pREP-NK, which was constructed by PCR amplification of the
c+ gene in pJV300 (38), using an N-terminal
primer that contains the coding sequence for the
cAMP-dependent kinase motif (39). The primer adds the
sequence GGACTTCGAAGAGCTTCTGTTATC encoding the peptides GIRRASVI
between the first two codons (Met1 and Lys2) of
the repressor gene. The RepNK coding sequence was inserted at the
NcoI and BamHI sites of pET-19b (Novagen), using
the NcoI site at the AUG start codon and a BamHI
site adjacent the stop codon. RepCK was overproduced from pREP-CK,
which is a derivative of pREP-1. The sequence CTTCGAAGAGCTTCTGTTGGTUAA
encoding the peptide IRRASVG was fused to the C-terminal coding
sequence of the c+ gene using the Stratagene
ExSiteTM PCR-based mutagenesis kit.
All repressor proteins (34) and the ClpX protein (31) were purified as
described previously. All protein concentrations are given in
equivalents of protein monomers.
Fluorescence Spectroscopy--
Thiol-specific attachment of
2-(4'-maleimidylanilino)naphthalene-6-sulfonic acid (MIANS; Molecular
Probes) to repressor proteins and quantitation of bound MIANS were
conducted as described previously (34). A 3-6-fold excess of MIANS
over the target repressor protein was added to each reaction mixture,
which was incubated at 37 °C. In all experiments, greater than 90%
of the target repressor proteins, which bear a single cysteine residue,
had bound MIANS after incubation for 10 min.
Fluorescence measurements were taken with an Aminco-Bowman Series 2 luminescence spectrometer using a path length of 4 cm. All analyses
were conducted in 25 mM HEPES-K+, 200 mM potassium glutamate, and 10 mM maganesium
acetate with the indicated concentrations of repressor proteins in a
sample volume of 200 µl. MIANS fluorescence was monitored at an
excitation wavelength of 330 nm and an emission wavelength of 420 nm
with constant stirring at 37 °C.
Phosphorylation of RepNK and RepCK--
RepNK radiolabeled to
high specific activity for trypsin cleavage analysis was prepared as
described previously (39) with modifications. Reaction mixtures (30 µl) contained 3 µM RepNK, 1.5 µM
[ -32P]ATP (PerkinElmer Life Sciences; 3000 Ci/mmol), 25 mM Tris-HCl (pH 7.5), 2 mM DTT,
100 mM NaCl, 12 mM MgCl2, 10 mM NaF, and 25 units catalytic subunit of the
cAMP-dependent protein kinase (PKA; New England Biolabs).
Incubation was at 37 °C for 10 min, and the reaction was stopped by
addition of EDTA to 30 mM.
The kinetics of phosphorylation of RepNK and RepCK was monitored under
the same conditions except that the reaction mixture contained 60 µM [ -32P]ATP (10 Ci/mmol), 8 units of
PKA, and repressor proteins at the indicated concentrations. When Vir,
Rep, or ClpX were present together with RepNK or RepCK, the reaction
mixture was assembled and allowed to incubate 10 min at 37 °C prior
to adding [ -32P]ATP and PKA. Reaction mixtures were
resolved by electrophoresis on a 10% or 12% SDS-polyacrylamide gel.
The gel was stained with Coomassie Blue R-250 and dried down for
quantitation on an Amersham Biosciences Storm 840 PhosphorImager
system. Bands corresponding to the maximum incubation times were then
excised, and the level of Cheronkov radiation was measured on a Beckman
LS6500 Multi-purpose Scintillation Counter to determine the fraction of
repressor proteins phosphorylated.
Trypsin Cleavage of Repressor Proteins--
Reaction mixtures
(20 µl) contained 25 mM HEPES-K+ (pH 7.5),
200 mM potassium glutamate, 10 mM magnesium
acetate and the indicated concentrations of
32P-RepNK (10,000-13,000 cpm/pmol) and unlabeled
repressor proteins. 32P-RepNK and an unlabeled
repressor protein were first mixed and allowed to incubate for 10 mins
at 37 °C before addition of 1 µg trypsin. Digestion was allowed to
proceed at the same temperature for 1 h, and then reactions were
stopped by the addition of phenylmethylsulfonyl fluoride to 2% (w/v)
final concentration. The cleavage patterns were analyzed on a 10%
SDS-polyacrylamide gel. The gel was stained with Coomassie Blue,
dried down, and subjected to autoradiography.
 |
RESULTS |
Mutant Repressors with an Altered CTD Induce Conformational Changes
in Rep--
We examined whether mutant repressors with an altered CTD
can influence the conformation of Rep molecules. We first examined their influence on the conformational state of Rep using the trypsin hypersensitive site at Arg-70 as a marker (34). When not bound to DNA,
Rep is hypersensitive to cleavage at Arg-70, a property dependent upon
the close proximity of the CTD to the DBD. Upon cleavage at Arg-70, the
resulting peptides become susceptible to cleavage by trypsin at other
sites. This hypersensitivity, which is lost as Rep interacts with DNA
and the CTD moves away from the DBD, is absent in Vir and Rep 18.
These repressor molecules therefore remain intact under conditions that
promote degradation of Rep to small fragments.
We determined that both Vir and Rep 18 could induce Rep to lose
hypersensitivity at this site. Purified wild-type repressor with a
cAMP-dependent protein kinase motif at the N terminus
(RepNK) was radiolabeled using [ -32P]ATP, mixed with
an excess of unlabeled Rep, Vir, Rep 18, or RepNK, and treated
with trypsin. The susceptibility of 32P-RepNK to
tryptic digestion was influenced by the properties of the excess
unlabeled repressor protein in the reaction mixture. 32P-RepNK in the presence of unlabeled Rep and RepNK
was rapidly cleaved by trypsin (Fig. 2,
lanes 5 and 8). In contrast, Vir and Rep 18
remained relatively resistant to cleavage and
32P-RepNK became resistant in their presence
(lanes 6 and 7). This indicates that Vir and
Rep 18 can induce conformational changes in Rep, most likely by
inducing movement of the CTD with respect to the DBD.

View larger version (52K):
[in this window]
[in a new window]
|
Fig. 2.
Cleavage of Rep NK by trypsin is influenced
by the presence of mutant repressors. Reaction mixtures (20 µl)
contained 32P-RepNK (0.4 µM) and the
indicated unlabeled repressor protein (4.3 µM). For
cleavage analysis (lanes 5-8) 1 µg of trypsin was added,
and the mixture was incubated for 1 h at 37 °C. Polypeptides
were resolved by SDS-polyacrylamide gel electrophoresis, and the gel
was stained with Coomassie Blue (A) and dried down for
autoradiography (B).
|
|
Vir Induces Movement of the Rep CTD to a More Hydrophilic
Environment--
We previously determined that the Rep C terminus is
in a hydrophobic environment, whereas the Vir3060 C terminus is in a
relatively hydrophilic one (34). We used repressor proteins with the
C17A substitution and a single cysteine introduced at the C terminus, modifications that do not alter the respective properties of the protein as a ClpXP substrate (data not shown; VirC192 and RepC197; see
Fig. 1B). As demonstrated previously, when the
thiol-specific fluorophore MIANS was attached to the single cysteine at
the C terminus, we obtained emission maxima of 429 and 439 nm for
RepC197 and VirC192, respectively (Fig.
3, A and B). The
fluorescence intensity of VirC192-MIANS was greatly diminished in
comparison with that of RepC197-MIANS, consistent with the probe at the
Vir C terminus being in a more hydrophilic environment (40).

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 3.
Vir induces the Rep C terminus to enter a
hydrophilic environment. Reaction mixtures contained RepC197 or
VirC192 (1.5 µM), VirC17A or RepC17A (4.5 µM) where indicated, and MIANS (4.5 µM).
The presence of cysteine-less repressor VirC17A and RepC17A are
indicated in parentheses to emphasize that they do not bind MIANS and
thus do not become fluorescent. The emission spectra of bound MIANS
were obtained (A, C). The three major spectra in
A were normalized to compare emission maxima
(B).
|
|
When MIANS was attached to RepC197 in the presence of 3-fold excess
VirC17A, which has no cysteine residues, fluorescence intensity was
diminished (Fig. 3A), and the emission spectrum was
red-shifted 20 nm to 449 nm (Fig. 3B), indicating that the Rep C terminus had entered an environment even more hydrophilic than
that of the Vir C terminus. Although RepC197-MIANS in the presence of
Vir has an emission maximum of longer wavelength, it has a higher
fluorescence intensity than VirC192-MIANS. At the C terminus of Vir,
MIANS is attached to basic residues (HRR), and these residues most
likely further quench its fluorescence. The presence of 3-fold excess
RepC17A instead of VirC17A slightly increased the fluorescence
intensity and did not change emission maximum of the attached MIANS
(Fig. 3C). The results indicate that Vir can induce movement
of the Rep CTD such that it is more exposed to solvent and therefore
more accessible to ClpX. Reducing the levels of VirC17A to a level
equimolar to RepC197 diminished the red shift to ~1-2 nm (data not
shown). An excess of Vir was therefore needed to efficiently induce the
Rep conformational change.
Vir Increases the Rate of MIANS Attachment to the Rep C
Terminus--
MIANS has the convenient characteristic of becoming
fluorescent only upon attachment to cysteine residues, and we used this property to examine accessibility of Rep C terminus. MIANS is attached
to VirC192 at a much faster rate than it is to RepC197 (34). In the
presence of VirC17A, the rate of MIANS attachment to RepC197 was
increased to the same rate as its attachment to VirC192 (Fig.
4A), indicating that the
Vir-induced movement of the Rep CTD greatly increases its
accessibility. In the attachment of MIANS to VirC192, a spike in
fluorescence was reproducibly recorded at ~200 s (34), an anomaly not
observed in the attachment of MIANS to RepC197 when VirC17A was present
(Fig. 4A). Although the cause of this transient increase in
fluorescence has not been definitively demonstrated, it may reflect a
transient fluctuation in the conformation of the VirC192 protein
population upon becoming saturated with MIANS.

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 4.
Kinetics attachment of MIANS to the CTD of
repressor molecules. Reaction mixtures contained RepC197, VirC192,
or Rep (1.5 µM), VirC17A or RepC17A (4.5 µM) where indicated (in parentheses to
emphasize that they do not bind MIANS), and MIANS (9.5 µM). The time course of MIANS attachment indicated by
increase in fluorescence was monitored at 37 °C. The proportion of
repressor molecules with bound MIANS at the end of the incubation
period was determined as described previously (34). A,
effect of VirC17A on the time course of MIANS attachment to RepC197 and
Rep. B, effect of RepC17A on the time course of MIANS
attachment to RepC197.
|
|
Unlike its effect on RepC197, VirC17A decreased the rate of attachment
of MIANS to the native C17 residue present in the DBD of Rep (Fig.
4A). This indicates that VirC17A is not increasing accessibility of all parts of Rep. Moreover, RepC17A had no effect on
the attachment of MIANS to RepC197 (Fig. 4B).
ClpX Decreases the Amount of Vir Required to Promote Maximal
Accessibility of the Rep C Terminus--
The 7-residue
cAMP-dependent protein kinase motif (IRRASVG) was
engineered onto the C terminus of Rep (RepCK) to examine how Vir and
ClpX can influence the rate of its phosphorylation. Under the assay
conditions, RepCK was phosphorylated at a very low rate, and the
presence of ClpX did not significantly increase the rate of
phosphorylation (Fig. 5A).
However, Vir promoted a large increase in the rate of RepCK
phosphorylation (Fig. 5A). Increasing the Vir to RepCK ratio
from 1:1 to 4:1 progressively increased the rate of phosphorylation
(Fig. 5, A-D), indicating that the Rep CTD movement induced
by Vir exposes this domain and makes the attached kinase motif
accessible to phosphorylation. At a Vir to RepCK ratio of 4:1, the
presence of ClpX promoted only a slight increase in the phosphorylation
rate; but at lower levels of Vir, ClpX did promote a significant
increase in phosphorylation rates, indicating that the recognition and
unfolding of protomers in repressor oligomers by ClpX can further
expose the CTDs of additional Rep molecules. In contrast, Vir could not
promote any increase in the low level of phosphorylation of the kinase
motif at the Rep N terminus even in the presence of ClpX (Fig.
5E), indicating that Vir and ClpX are not necessarily
increasing accessibility of all domains of Rep. In addition, Rep and
Rep 18 were unable to promote any increase in the phosphorylation
rate of RepCK (Fig. 5F), indicating that these proteins do
not promote exposure of the Rep CTD. These results indicate that ClpX
can assist Vir in exposing the Rep CTD.

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 5.
Effect of Vir and ClpX on the phosphorylation
of RepCK and RepNK. Phosphorylation with the catalytic subunit of
the cAMP-dependent protein kinase was conducted in reaction
mixtures containing RepCK or RepNK (0.5 µM) and ClpX
(0.22 µM; 37 nM as hexamers) where indicated.
Vir, Rep 18, or Rep were present at 2 µM
(A), 1.5 µM (B, E, and
F), 1.0 µM (C), and 0.5 µM (D) as indicated. A-D: ,
RepCK only; , RepCK with Vir; , RepCK with ClpX; and , RepCK
with Vir and ClpX. E: , RepNK only; , RepNK with Vir;
and , RepNK with Vir and ClpX. F: , RepCK with Rep; *,
RepCK with Rep and ClpX; and , RepCK with Rep 18.
|
|
 |
DISCUSSION |
trans-Targeting of Rep by Vir Is Promoted by Inducing
Conformational Changes That Expose ClpX Recognition Determinants in the
Rep CTD--
The CTD of Rep plays a critical role in both Rep
degradation promoted by altered forms of the repressor and the
formation of the repressor-operator complex, enabling the Rep
population to respond to specific physiological conditions such as
carbon starvation and entry into stationary phase (19, 24, 35, 36).
Although ClpXP-sensitive Vir can promote Rep degradation, Rep does have
intrinsic sensitivity to ClpXP protease by itself (31), indicating that
it contains a ClpX recognition determinant. However, the context of
this determinant influences to a large degree the efficiency with which
it is recognized by ClpX. In the absence of DNA, Rep is degraded with a
relatively high Km. In the presence of Vir, Rep is
degraded with a lower Km that is essentially
identical to that of Vir. Heat denaturation of Rep also allows it to be
rapidly degraded without Vir (37).
Thus, what constitutes a ClpX recognition determinant is not simply
determined by the presence of a recognition motif but also by factors
such as accessibility and display of the motif. And what constitutes
the minimal elements of the Rep ClpX recognition determinant remains to
be defined. Nevertheless, the Rep CTD is an important part of that
determinant. Cysteine replacement mutations at 8 of the last 17 C-terminal residues and a deletion of even a single residue at the C
terminus result in gain of dominance over vir alleles (37).
Biochemical analyses have shown that Rep 18, and at least two CTD
mutants with a single cysteine replacement (V183C and V196C) have lost
intrinsic sensitivity to ClpXP even after heat denaturation, indicating
that a determinant within the CTD is required for ClpX recognition. Vir
can induce the movement of the Rep CTD such that it is more exposed,
most likely so that it can be bound by ClpX. Thus
trans-targeting can be the result of unmasking a largely
inaccessible recognition determinant.
Although an excess of Vir was needed to induce the conformational
change, ClpX could assist in the Vir-induced exposure of the CTD. Very
low levels of Vir must be effective in promoting derepression, for it
is rapidly degraded in vivo and is not able to accumulate to
high levels and yet it effectively promotes Rep degradation (17). Vir
promotes recognition of Rep molecules by ClpX, which in turn aids Vir
in inducing Rep conformational changes. Recognition and unfolding of
protomers may dissociate ClpXP-sensitive repressor oligomers and create
interacting surfaces for conversion of additional Rep molecules to the
protease-sensitive conformation. The repressor molecules that induce
the conversion to the sensitive conformation may not necessarily be Vir
molecules and may be Rep molecules previously converted to this conformation.
If Vir and ClpX catalytically generate Rep molecules with an exposed
CTD, it is likely that such Rep molecules maintain this "exposed"
conformation only transiently before returning to the "unexposed" conformation. For example, at a limiting Vir
concentration, ClpX promotes increased phosphorylation of RepCK at a
uniform rate over a 25-min time course (Fig. 5D). If stably
exposed RepCK molecules accumulate during the time course,
phosphorylation of RepCK should be accelerated in this time period. The
presence of Vir and ClpX therefore appears to increase phosphorylation rates by maintaining a higher steady-state level of exposed RepCK. Less
than stoichiometric amounts of Vir that efficiently promote Rep
degradation in vitro (31) are not as effective in increasing RepCK phosphorylation. However, if the recognition and unfolding of Rep
protomers lead to exposure of additional ClpX recognition motifs,
protein unfolding by ClpX may be coupled to its recognition of
additional protomers. In this way, when a threshold of inducing molecules such as ssrA-tagged repressor peptides accumulate
under certain physiological conditions, they may begin a catalytic
process to promote degradation of the bulk Rep population.
Implications for Understanding General Mechanisms Involved in
trans-Targeting--
It is not yet clear whether the mechanism of
trans-targeting of the Mu repressor by Vir will turn out to
be similar to trans-targeting by other regulator proteins
that promote degradation. Unlike Vir, trans-targeting
proteins UmuD, RssB, and SspB target the respective substrates without
being degraded themselves by ClpXP (10, 14, 15). Gonzalez et
al. (10) determined that an alanine stretch introduced into the
UmuD N-terminal segment, which is not present on UmuD', prevents
UmuD-directed degradation of UmuD' by ClpXP. The result suggests that
this is the segment recognized by ClpX in the UmuD-UmuD' heterodimer.
UmuD as well as RssB and SspB may interact with ClpX to deliver the
respective protease substrates to the active site of ClpX.
Nevertheless, ClpX substrates in general have been found to contain
recognition motifs, for which there is no apparent consensus sequence.
Thus, it is conceivable that these regulator proteins promote exposure
of a motif within the target protein. For example, S and
phosphorylated RssB together bind with high affinity to ClpX even
though neither alone do so (14); this leaves open the possibility that
the complex exposes a determinant in S bound by ClpX.
Hoskins et al. (41) recently determined that the ClpX
recognition motif present at the C terminus of MuA transposase can also
be recognized at an interior position of a MuA-green fluorescent
protein fusion, albeit less efficiently. This raises the possibility
that a trans-targeting protein might promote exposure of a
recognition motif present in the interior of the target protein.
Transmission of Conformation Changes as a General Mechanism in
Disseminating Physiological Signals--
Studies of prions in mammals
and prion-like proteins in yeast have raised interesting questions
about the dissemination of conformational states among protein
molecules and whether such a mechanism is generally employed in nature
(42-46). While prions have been implicated in the transmission of a
neurodegenerative disasease (spongiform encelopathy) in mammals,
prion-like proteins in yeast have been implicated in the dissemination
of heritable phenotypic traits. Although Vir is not known to promote
protein-based inheritance, the way it promotes Rep degradation by
inducing conformational changes reflects a prion-like mechanism at work
in the dissemination of a molecular signal.
 |
ACKNOWLEDGEMENTS |
We thank Shawna Lagan and Charan Gowda for
constructing overproducers of repressor proteins with an attached
kinase motif and also C. Gowda for purifying these
proteins. We thank Elliott Crooke and Stella North for critically
reading the manuscript.
 |
FOOTNOTES |
*
This work was supported by National Institutes of Health
Grant GM58265 (to H. N.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed: Dept. of Biochemistry
and Molecular Biology, School of Medicine, Georgetown University, Box
571455, Washington, D. C. 20057-1421. Tel.: 202-687-1442; Fax:
202-687-7186; E-mail: nakai@bc.georgetown.edu.
Published, JBC Papers in Press, November 6, 2002, DOI 10.1074/jbc.M209352200
 |
ABBREVIATIONS |
The abbreviations used are:
Vir, repressor encoded by a virulent mutant of Mu;
VirC192, Vir repressor
with a C17A alteration and a cysteine added at the C terminus;
VirC17A, cysteine-less Vir repressor having a C17A alteration;
CTD, C-terminal
domain;
DBD, DNA binding domain;
MIANS, 2-(4'-maleimidylanilino)naphthalene-6-sulfonic acid;
Rep, wild-type Mu
repressor;
Rep 18, repressor truncated by 18 residues at the
C-terminal end;
RepC197, repressor with a C17A alteration and a
cysteine residue added at the C terminus;
RepC17A, cysteine-less
repressor having a C17A alteration;
RepNK, repressor with a kinase
motif at the N terminus;
RepCK, repressor with a kinase motif at the C
terminus;
PKA, catalytic subunit of the cAMP-dependent
protein kinase.
 |
REFERENCES |
| 1.
|
Gottesman, S.,
Clark, W. P.,
de Crécy-Lagard, V.,
and Maurizi, M. R.
(1993)
J. Biol. Chem.
268,
22618-22626[Abstract/Free Full Text]
|
| 2.
|
Kim, Y. I.,
Burton, R. E.,
Burton, B. M.,
Sauer, R. T.,
and Baker, T. A.
(2000)
Mol. Cell
5,
639-648[CrossRef][Medline]
[Order article via Infotrieve]
|
| 3.
|
Singh, S. K.,
Grimaud, R.,
Hoskins, J. R.,
Wickner, S.,
and Maurizi, M. R.
(2000)
Proc. Natl. Acad. Sci. U. S. A.
97,
8898-8903[Abstract/Free Full Text]
|
| 4.
|
Wojtkowiak, D.,
Georgopoulos, C.,
and Zylicz, M.
(1993)
J. Biol. Chem.
268,
22609-22617[Abstract/Free Full Text]
|
| 5.
|
Wang, J.,
Hartling, J. A.,
and Flanagan, J. M.
(1997)
Cell
91,
447-456[CrossRef][Medline]
[Order article via Infotrieve]
|
| 6.
|
Grimaud, R.,
Kessel, M.,
Beuron, F.,
Steven, A. C.,
and Maurizi, M. R.
(1998)
J. Biol. Chem.
273,
12476-12481[Abstract/Free Full Text]
|
| 7.
|
Flynn, J. M.,
Levchenko, I.,
Seidel, M.,
Wickner, S. H.,
Sauer, R. T.,
and Baker, T. A.
(2001)
Proc. Natl. Acad. Sci. U. S. A.
98,
10584-10589[Abstract/Free Full Text]
|
| 8.
|
Gonciarz-Swiatek, M.,
Wawrzynow, A., Um, S. J.,
Learn, B. A.,
McMacken, R.,
Kelley, W. L.,
Georgopoulos, C.,
Sliekers, O.,
and Zylicz, M.
(1999)
J. Biol. Chem.
274,
13999-14005[Abstract/Free Full Text]
|
| 9.
|
Levchenko, I.,
Yamauchi, M.,
and Baker, T. A.
(1997)
Genes Dev.
11,
1561-1572[Abstract/Free Full Text]
|
| 10.
|
Gonzalez, M.,
Rasulova, F.,
Maurizi, M. R.,
and Woodgate, R.
(2000)
EMBO J.
19,
5251-5258[CrossRef][Medline]
[Order article via Infotrieve]
|
| 11.
|
Bearson, S. M.,
Benjamin, W. H., Jr.,
Swords, W. E.,
and Foster, J. W.
(1996)
J. Bacteriol.
178,
2572-2579[Abstract/Free Full Text]
|
| 12.
|
Muffler, A.,
Fischer, D.,
Altuvia, S.,
Storz, G.,
and Hengge-Aronis, R.
(1996)
EMBO J.
15,
1333-1339[Medline]
[Order article via Infotrieve]
|
| 13.
|
Pratt, L. A.,
and Silhavy, T. J.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
2488-2492[Abstract/Free Full Text]
|
| 14.
|
Zhou, Y.,
Gottesman, S.,
Hoskins, J. R.,
Maurizi, M. R.,
and Wickner, S.
(2001)
Genes Dev.
15,
627-637[Abstract/Free Full Text]
|
| 15.
|
Levchenko, I.,
Seidel, M.,
Sauer, R. T.,
and Baker, T. A.
(2000)
Science
289,
2354-2356[Abstract/Free Full Text]
|
| 16.
|
Geuskens, V.,
Vogel, J. L.,
Grimaud, R.,
Desmet, L.,
Higgins, N. P.,
and Toussaint, A.
(1991)
J. Bacteriol.
173,
6578-6585[Abstract/Free Full Text]
|
| 17.
|
Geuskens, V.,
Mhammedi-Alaoui, A.,
Desmet, L.,
and Toussaint, A.
(1992)
EMBO J.
11,
5121-5127[Medline]
[Order article via Infotrieve]
|
| 18.
|
Mhammedi-Alaoui, A.,
Pato, M.,
Gama, M.-J.,
and Toussaint, A.
(1994)
Mol. Microbiol.
11,
1109-1116[CrossRef][Medline]
[Order article via Infotrieve]
|
| 19.
|
O'Handley, D.,
and Nakai, H.
(2002)
J. Mol. Biol.
322,
311-324[CrossRef][Medline]
[Order article via Infotrieve]
|
| 20.
|
Symonds, N., Toussaint, A., van de Putte, P., and Howe, M. M.
(eds)
(1987)
Phage Mu
, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
|
| 21.
|
Krause, H. M.,
and Higgins, N. P.
(1986)
J. Biol. Chem.
261,
3744-3752[Abstract/Free Full Text]
|
| 22.
|
Leung, P. C.,
Teplow, D. B.,
and Harshey, R. M.
(1989)
Nature
338,
656-658[CrossRef][Medline]
[Order article via Infotrieve]
|
| 23.
|
Mizuuchi, M.,
and Mizuuchi, K.
(1989)
Cell
58,
399-408[CrossRef][Medline]
[Order article via Infotrieve]
|
| 24.
|
Lamrani, S.,
Ranquet, C.,
Gama, M. J.,
Nakai, H.,
Shapiro, J. A.,
Toussaint, A.,
and Maenhaut-Michel, G.
(1999)
Mol. Microbiol.
32,
327-343[CrossRef][Medline]
[Order article via Infotrieve]
|
| 25.
|
Shapiro, J. A.
(1984)
Mol. Gen. Genet.
194,
79-90[CrossRef][Medline]
[Order article via Infotrieve]
|
| 26.
|
Maenhaut-Michel, G.,
and Shapiro, J. A.
(1994)
EMBO J.
13,
5229-5239[Medline]
[Order article via Infotrieve]
|
| 27.
|
Shapiro, J. A.,
and Leach, D.
(1990)
Genetics
126,
293-299[Abstract]
|
| 28.
|
Keiler, K. C.,
Waller, P. R. H.,
and Sauer, R. T.
(1996)
Science
271,
990-993[Abstract]
|
| 29.
|
Atkins, J. F.,
and Gesteland, R. F.
(1996)
Nature
379,
769-771[CrossRef][Medline]
[Order article via Infotrieve]
|
| 30.
|
Jentsch, S.
(1996)
Science
271,
955-956[CrossRef][Medline]
[Order article via Infotrieve]
|
| 31.
|
Welty, D. J.,
Jones, J. M.,
and Nakai, H.
(1997)
J. Mol. Biol.
272,
31-41[CrossRef][Medline]
[Order article via Infotrieve]
|
| 32.
|
Alazard, R.,
Ebel, C.,
Venien-Bryan, V.,
Mourey, L.,
Samama, J. P.,
and Chandler, M.
(1998)
Eur. J. Biochem.
252,
408-415[Medline]
[Order article via Infotrieve]
|
| 33.
|
Rousseau, P.,
Bétermier, M.,
Chandler, M.,
and Alazard, R.
(1996)
J. Biol. Chem.
271,
9739-9745[Abstract/Free Full Text]
|
| 34.
|
Rai, S. S.,
O'Handley, D.,
and Nakai, H.
(2001)
J. Mol. Biol.
312,
311-322[CrossRef][Medline]
[Order article via Infotrieve]
|
| 35.
|
Vogel, J. L.,
Geuskens, V.,
Desmet, L.,
Higgins, N. P.,
and Toussaint, A.
(1996)
Genetics
142,
661-672[Abstract]
|
| 36.
|
Ranquet, C.,
Geiselmann, J.,
and Toussaint, A.
(2001)
Proc. Natl. Acad. Sci. U. S. A.
98,
10220-10225[Abstract/Free Full Text]
|
| 37.
| Mukhopadyay, B., Marshall-Batty, K. R., Kim, B. D.,
O'Handley, D., and Nakai, H. (2002) Mol. Microbiol.,
in press
|
| 38.
|
Vogel, J. L., Li, Z. J.,
Howe, M. M.,
Toussaint, A.,
and Higgins, N. P.
(1991)
J. Bacteriol.
173,
6568-6577[Abstract/Free Full Text]
|
| 39.
|
Kelman, Z.,
Naktinis, V.,
and O'Donnell, M.
(1995)
Methods Enzymol.
262,
430-442[Medline]
[Order article via Infotrieve]
|
| 40.
|
Hiratsuka, T.
(1992)
J. Biol. Chem.
267,
14941-14948[Abstract/Free Full Text]
|
| 41.
|
Hoskins, J. R.,
Yanagihara, K.,
Mizuuchi, K.,
and Wickner, S.
(2002)
Proc. Natl. Acad. Sci. U. S. A.
99,
11037-11042[Abstract/Free Full Text]
|
| 42.
|
Prusiner, S. B.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
13363-13383[Abstract/Free Full Text]
|
| 43.
|
Osherovich, L. Z.,
and Weissman, J. S.
(2002)
Dev. Cell
2,
143-151[CrossRef][Medline]
[Order article via Infotrieve]
|
| 44.
|
Uptain, S. M.,
and Lindquist, S.
(2002)
Annu. Rev. Microbiol.
56,
703-741[CrossRef][Medline]
[Order article via Infotrieve]
|
| 45.
|
Wickner, R. B.,
Taylor, K. L.,
Edskes, H. K.,
Maddelein, M. L.,
Moriyama, H.,
and Roberts, B. T.
(2000)
J. Struct. Biol.
130,
310-322[CrossRef][Medline]
[Order article via Infotrieve]
|
| 46.
|
Cohen, F. E.,
and Prusiner, S. B.
(1998)
Annu. Rev. Biochem.
67,
793-819[CrossRef][Medline]
[Order article via Infotrieve]
|
| 47.
|
Ilangovan, U.,
Wojciak, J. M.,
Connolly, K. M.,
and Clubb, R. T.
(1999)
Biochemistry
38,
8367-8376[CrossRef][Medline]
[Order article via Infotrieve]
|
| 48.
|
Rousseau, P.,
Laachouch, J. E.,
Chandler, M.,
and Toussaint, A.
(2002)
Res. Microbiol.
153,
511-518[Medline]
[Order article via Infotrieve]
|
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
K. R. Marshall-Batty and H. Nakai
Activation of a Dormant ClpX Recognition Motif of Bacteriophage Mu Repressor by Inducing High Local Flexibility
J. Biol. Chem.,
April 4, 2008;
283(14):
9060 - 9070.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. A. Defenbaugh and H. Nakai
A Context-dependent ClpX Recognition Determinant Located at the C Terminus of Phage Mu Repressor
J. Biol. Chem.,
December 26, 2003;
278(52):
52333 - 52339.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. B. Neher, R. T. Sauer, and T. A. Baker
Distinct peptide signals in the UmuD and UmuD' subunits of UmuD/D' mediate tethering and substrate processing by the ClpXP protease
PNAS,
November 11, 2003;
100(23):
13219 - 13224.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|