Originally published In Press as doi:10.1074/jbc.M209801200 on November 6, 2002
J. Biol. Chem., Vol. 278, Issue 3, 1618-1625, January 17, 2003
Okazaki Fragment Maturation in Yeast
I. DISTRIBUTION OF FUNCTIONS BETWEEN FEN1 AND DNA2*
Rao
Ayyagari
§,
Xavier V.
Gomes
¶,
Dmitry A.
Gordenin
, and
Peter M. J.
Burgers
**
From the
Department of Biochemistry and Molecular
Biophysics, Washington University School of Medicine, St. Louis,
Missouri 63110,
Laboratory of Molecular Genetics, NIEHS,
National Institutes of Health, Research Triangle Park, North
Carolina 27709, and § Lindenwood University, St. Charles,
Missouri 63301
Received for publication, September 24, 2002, and in revised form, October 30, 2002
 |
ABSTRACT |
In the presence of proliferating cell nuclear
antigen, yeast DNA polymerase
(Pol
) replicated
DNA at a rate of 40-60 nt/s. When downstream double-stranded DNA was
encountered, Pol
paused, but most replication complexes proceeded
to carry out strand-displacement synthesis at a rate of 1.5 nt/s. In
the presence of the flap endonuclease FEN1 (Rad27), the complex carried
out nick translation (1.7 nt/s). The Dna2 nuclease/helicase
alone did not efficiently promote nick translation, nor did it affect
nick translation with FEN1. Maturation in the presence of DNA ligase
was studied with various downstream primers. Downstream DNA primers,
RNA primers, and small 5'-flaps were efficiently matured by Pol
and
FEN1, and Dna2 did not stimulate maturation. However, maturation of
long 5'-flaps to which replication protein A can bind required both
DNA2 and FEN1. The maturation kinetics were optimal with a slight molar
excess over DNA of Pol
, FEN1, and proliferating cell nuclear
antigen. A large molar excess of DNA ligase substantially enhanced the
rate of maturation and shortened the nick-translation patch
(nucleotides excised past the RNA/DNA junction before ligation) to 4-6
nt from 8-12 nt with equimolar ligase. These results suggest that
FEN1, but not DNA ligase, is a stable component of the maturation complex.
 |
INTRODUCTION |
In eukaryotic cells, Okazaki fragments are efficiently matured
during elongation of DNA replication. Earlier models of this process,
based on in vitro replication studies of simian virus 40 DNA, implicated the FEN1 5'-FLAP-exo/endonuclease and RNase H1 as the
main degradative enzymes to remove the RNA moiety of the Okazaki
fragment and provide an appropriate gap for filling by a DNA polymerase
and sealing by DNA ligase I (for reviews, see Refs. 1 and 2). Recent
studies of the mutator phenotypes of RAD27 (encoding FEN1),
RNH35 (encoding RNase H1), and the double mutants suggest
that the two enzymes function in separate pathways (3). Rather, genetic
studies have suggested that an essential nuclease/helicase, Dna2, may
be an important component of the lagging-strand replication apparatus
based on several criteria, including synthetic lethality of
temperature-sensitive mutations in DNA2 with a deletion
mutation of the RAD27 gene (4, 5). DNA2 shows
genetic interactions with DNA polymerase alpha and alpha-accessory
proteins (6), and the temperature sensitivity of S. pombe
DNA2 mutants is suppressed by overexpression of each of several
genes playing a role in the elongation and maturation of Okazaki
fragments, including those encoding FEN1, DNA ligase, and DNA
polymerase
(Pol
)1
(7). Subsequent to the demonstration of a rather inefficient helicase activity in Dna2, a 5'
3'-endonuclease activity was characterized, and it is the nuclease rather than the helicase that
confers the essential phenotype (8-10). In addition, DNA2 is required for the proper maintenance of telomeres (11, 12).
Beyond its demonstrated function in Okazaki-fragment maturation, FEN1
plays an important role in several other DNA metabolic processes. In
DNA repair, FEN1 is required for long-patch base-excision repair
(13-15). Repetitive sequences are destabilized in RAD27 deletion strains, and such strains are strong mutators (16-18). Genetic and biochemical studies indicate that FEN1 preferentially restricts recombination between short repeated sequences (19-21). Lesions that accumulate in the absence of FEN1 require homologous recombination for repair as RAD27 deletion results in poor
growth or lethality in recombination-defective backgrounds (22, 23). Some, but not all of the rad27-
phenotypic defects are
suppressed by overexpression of the EXO1 gene that encodes a
related nuclease (11, 24). In addition, the temperature sensitivity of
a rad27-
mutant is suppressed by overexpression of the
DNA2 gene (5). In many if not all of these processes, the
activity of FEN1 depends on its interaction with the replication clamp
PCNA (proliferating cell nuclear antigen), and synthetic lethality is
observed between RAD27 and POL30 (encoding PCNA)
mutants (25, 26).
FEN1 is a structure-specific nuclease that cleaves substrates
containing unannealed 5'-flaps (reviewed in ref. 27). Biochemical and
structural studies are consistent with a model in which FEN1 loads by
sliding onto the 5'-unannealed strand of the flap. The crystal
structure of archeabacterial FEN1 shows a long flexible loop near the
active site, which forms a hole large enough to accommodate the DNA
substrate (28, 29). Sliding occurs most efficiently across
single-stranded DNA; double-stranded DNA flaps and protein-bound flaps
poorly support loading of FEN1 (30). Cleavage removes the flap at or
near the point of annealing. The favored substrate for the FEN1 class
of nucleases is actually a double-flap structure containing a 1-nt
3'-tail on the upstream primer adjacent to the 5'-flap. With this
double-flap substrate, the site of cleavage is one nucleotide into the
double-stranded region, thereby providing a suitable nick for
closure by DNA ligase (27, 31).
Recent studies have provided new insights in the process of
Okazaki-fragment maturation in the eukaryotic cell. These studies have
illuminated three key components of this process. First, the combined
action of Pol
and FEN1 is able to remove the RNA primer of an
Okazaki fragment by a process called nick translation (32-35).
Presumably, the process proceeds via strand-displacement synthesis by
the polymerase followed by flap cutting by FEN1. Second, in the
presence of the single-stranded DNA-binding protein RPA, long strand
displacement products, i.e. with long 5'-flaps, cannot be
cleaved by FEN1, but rather the nuclease activity of Dna2 is required
to partially degrade the flap and allow accessibility of FEN1 (34, 36).
Third, the nicks propagated during nick translation are substrates for
DNA ligase (34, 37). However, several important questions remain. Do
the polymerase and the accessory factors function as a stable complex
in which all reactions are coupled? To address this question, a study
of the stoichiometry of the process is important. Second, is the
generation of long flaps during maturation a prerequisite, requiring
the obligatory presence of Dna2 in the complex, or is it an exception?
Third, how far and how efficient does nick translation proceed before ligation? Fourth, does the 3'
5'-exonuclease activity of Pol
perform a function during maturation? And finally, are the efficiency and kinetics of maturation consistent with that of a process that by
necessity has to occur rapidly in vivo? In this
paper, we present kinetic studies of the maturation process and
show that the function of Dna2 is limited to situations where the
activity of FEN1 has been compromised. In a companion second paper, we
provide both genetic and biochemical evidence for the importance of the
3'
5'-exonuclease of Pol
in this process.
 |
EXPERIMENTAL PROCEDURES |
Materials--
Pol
, Dna2, and DNA ligase I were purified
from yeast overproduction strains (4, 38). The CDC9 gene
(DNA ligase I; a gift of Dr. Lee Johnston) was cloned into vector
pRS424-GAL to give pBL176 (Bluescript 2 µM ori TRP1
GAL10-CDC9). The DNA2 gene was overexpressed from a
derivative of plasmid pBM2 (a gift from Tim Formosa), such that the N
terminus of the DNA2 gene contained successive
His7 and hemagglutinin tags. Cell growth, induction, and extract preparation were as described (39). DNA ligase was purified
to homogeneity by chromatography over successive Affi-Gel blue, heparin
agarose, monoS, and MonoQ columns. Dna2 was purified to homogeneity by
chromatography over successive heparin agarose, nickel agarose, MonoQ,
and phenyl superose columns. Five µg of Dna2 were subjected to
SDS-PAGE followed by a Western analysis with antibodies to FEN1. No
contamination by FEN1 (detection limit ~2 ng) was detected.
Replication factor C (RFC), PCNA, replication protein A (RP-A), FEN1,
and fen1-ga (with a FF346,347GA mutation in the PCNA-binding motif)
were purified from Escherichia coli overproduction strains
as described (26, 40-42). A truncated form of RFC, in which residues
2-273 from Rfc1p was deleted, was used in this study (41). E. coli single-stranded DNA-binding protein (SSB) was a gift
from Dr. T. Lohman of this department (Washington University, St.
Louis, MO).
All oligonucleotides were obtained from Integrated DNA
Technologies and purified by polyacrylamide electrophoresis or HPLC before use. The 107-nt 5'- and 3'-biotinylated template Bio-V5 (Bio-5'-AGTGGGTTGGTTTTGGGT30CTCCCTTCTTCTCCTCCCTCTCCCTTCCCT31-Bio) was prepared by hybridizing two half-oligonucleotides to a bridging primer C12 (5'-AGGGAAGGGAGAGGGAGGAGAAGAAGGGAG) followed by
ligation with T4 DNA ligase and purification by preparative urea-PAGE. The template was primed again with C12, and the primer extended for
~2 nt with [
-32P]dATP and an exo
form
of DNA polymerase I, Klenow fragment. After phenol extraction, the
labeled primed template was purified over a G50 column, and the
downstream primer, either dc10 (5'-CCCAAAACCAACCCAC), dc11 (5'-C13AAAACCAACCCAC), or rc18
(5'-p-rArCrCrCrArArArArCCAACCCAC) hybridized to it at 50 °C.
Streptavidin was added in 2-fold molar excess where indicated.
Single-stranded Bluescript+ SKII DNA was obtained by superinfection of
E. coli DH5 containing the plasmid with helper phage M13K07
(43). After purification of the phage by polyethylene glycol
precipitation and banding in a CsCl gradient, phage DNA was isolated by
proteinase K digestion, phenol/chloroform extraction, and ethanol
precipitation (44). The preparation was contaminated with ~5% M13K07
DNA. However, as none of the primers used hybridized to the helper
phage and all DNA synthesis was primer-dependent, no
signals were generated from the helper phage DNA.
Bluescript SKII plasmid DNA was digested with EcoRI, 3'-end
labeled with carrier-free [
-32P]dATP and 10 µM dTTP by DNA polymerase I Klenow fragment and further
digested with ScaI. The labeled 1.14-kb fragment was
isolated by preparative agarose gel electrophoresis and hybridized to
SKII ssDNA.
Primers used for maturation assays were either SKdc10
(5'-p-ACGACGTTGTAAAACGACGGCCAGTGAGCG), SKdc11
(T10ACGACGTTGTAAAACGACGGCCAGTGAGCG), SKdc12
(T30ACGACGTTGTAAAACGACGGCCAGTGAGCG), or SKrc14
(5'-p-rArCrGrArCrGrUrU-GTAAAACGACGGCCAGTGAGCGC). To measure nick
translation patch length, oligonucleotides SKrc14-14 (5'-p-rArCrGrArCrGrUrU-GTAAAA), SKrc14-20
(5'-p-rArCrGrArCrGrUrU-GTAAAACGACGG), or SK14-30
(5'-p-rArCrGrArCrGrUrU-GTAAAACGACGGCCAGTGAGCG) were hybridized to
SKII ssDNA, extended with carrier-free [
-32P]dCTP by a
2-fold molar excess of Exo
DNA polymerase I Klenow
fragment, followed by a chase with 1 mM each dNTPs for
30 s to fix the label and extend the primer by 20-50 nt
(determined by 7 M urea/12% PAGE).
Replication Assays--
Standard 30-µl assays contained 20 mM Tris-HCl 7.8, 1 mM dithiothreitol, 100 µg/ml bovine serum albumin, 8 mM MgAc2, 1 mM ATP, 100 µM each dNTPs, 100 mM
NaCl, 100 fmol of primed template, 400 fmol (for oligonucleotides) or
10 pmol (for SKII DNA) of RPA, and 150 fmol of all other enzymes (RFC,
Pol
, FEN1, DNA2, ligase) unless indicated otherwise. In general,
the DNA was preincubated with RPA, PCNA, and RFC for 1 min at 30 °C,
and the reaction was started by adding the other proteins in a mix.
Incubations were performed at 30 °C. Radiolabel was either
incorporated in the primers by extension with a single radiolabeled
[
-32P]dNTP (300 Ci/mmol), as appropriate (see above),
or added as [
-32P]dATP during the replication assay.
In the latter case, the concentration of non-radioactive dATP was
lowered to 20 µM. Reaction products were analyzed by
electrophoresis on a 12% polyacrylamide/7 M urea gel, a 1% alkaline
agarose gel, or a 1% agarose gel in the presence of 0.5 µg/ml
ethidium bromide (43). The gels were dried and analyzed on a
PhosphoImager. Quantitation was carried out using ImageQuant software.
The images in the figures were contrast-enhanced for visualization purposes.
 |
RESULTS |
Kinetic Analysis of Strand Displacement and Nick
Translation--
To study the individual steps of Okazaki-fragment
maturation, we used two different primer-template systems. A circular
system was used to investigate coupling of replication to maturation, whereas a linear oligonucleotide-based system was used to allow high
resolution analysis of replication products. The replication clamp PCNA
serves as a key organizing and stabilizing factor of the maturation
complex as it specifically interacts not only with Pol
but also
with FEN1 and with DNA ligase (25, 45-48). However, because PCNA tends
to slide off of linear DNA substrates, we used an anchoring method with
biotin-streptavidin blocks previously devised for the analogous T4
system to stabilize occupancy of PCNA on oligonucleotides (49-51). In
this oligonucleotide-based system, displacement synthesis of a
downstream primer by Pol
was shown to depend not only on the
presence of PCNA and the clamp loader RFC, but also on the presence of
the streptavidin blocks (Fig.
1A). Control experiments
showed that the downstream primer was displaced and not degraded (data
not shown).

View larger version (64K):
[in this window]
[in a new window]
|
Fig. 1.
PCNA-dependent strand
displacement synthesis by Pol . Replication reactions contained
100 fmol of a 107-nt 3'- and 5'-biotinylated template with a 3'-end
labeled primer C12 and either second primer dc10 (A and
B, lanes 1-3), or rc18 (lanes
4-6), or dc11 (lanes 7-9). A, standard
replication reactions contained 125 mM NaCl, RPA, Pol ,
and RFC and PCNA where indicated for 10 min at 30 °C. Streptavidin
was added to the biotinylated template where indicated. B,
standard replication assays on the three different streptavidin-biotin
template/primer substrates as indicated above the figure contained 125 mM NaCl. The reactions were preincubated with RPA, PCNA,
and RFC for 1 min at 22 °C, and then started by addition of Pol .
Further incubation was at 22 °C for the indicated times. The
products were separated on a 7 M urea/12% polyacrylamide
gel. The length of extension products with relation to the downstream
primer is indicated. Precise gap filling by Pol produces a 60-mer
with oligonucleotides dc10 and dc11, and a 59-mer with oligonucleotide
rc18. See "Experimental Procedures" for details.
|
|
When the strand-displacement assay was carried out at 22 °C rather
than 30 °C and early time points were taken, rates of displacement of various downstream primers could be determined. The rate of strand-displacement synthesis was highest if the primer to be displaced
already contained a 5'-unannealed strand (Fig. 1B). Fully
hybridized RNA-DNA primers were also more readily displaced than the
analogous DNA primers. In all cases, two prominent pause sites were
observed. These pause sites were at the site of the nick, corresponding
to precise gap filling, and at the +1 position, corresponding to
displacement of a single nucleotide by the polymerase (Fig.
1B). The nature of the pause site and factors driving
departure from the pause are discussed in the accompanying paper
(52).
As expected from our knowledge of the preferred substrate for cleavage
by FEN1, the primers hybridized to the biotinylated template in this
assay system formed poor substrates for degradation by FEN1, even with
PCNA present (data not shown). However, when both Pol
and FEN1 were
added to this DNA substrate onto which PCNA had been loaded by RFC,
both enzymes acted synergistically to effect rapid nick translation
(Fig. 2). For FEN1 to act effectively during nick translation, interaction with PCNA is required. FEN1 interacts with PCNA through a consensus PCNA-binding motif
QGRLDGFF (42, 53, 54). A mutant form
of FEN1, fen1-ga (FF346,347GA), retains full nucleolytic activity but
shows a greatly reduced interaction with PCNA (42). Here, its capacity
to enhance DNA synthesis by Pol
through the downstream primer was
also greatly impaired (Fig. 2).

View larger version (103K):
[in this window]
[in a new window]
|
Fig. 2.
Interaction between FEN1 and PCNA required
for nick translation. Replication reactions were as described in
Fig. 1B, with oligonucleotide dc10 as the downstream primer,
and also contained when present 150 fmol of either wild-type
(wt) FEN1 or fen1-ga (-ga). The reactions were
preincubated with RPA, PCNA, and RFC for 1 min at 22 °C, and then
started by adding the other proteins in a mix. Aliquots were taken
after the indicated times at 22 °C and analyzed on a 7 M
urea/12% polyacrylamide gel. The major pause site (60-mer) is at the
precise position of the nick.
|
|
We used a circular ssDNA replication system to dissect the individual
steps of the maturation process. Single-stranded Bluescript DNA was
primed with a 1.14-kb 3'-end labeled primer and replicated with Pol
holoenzyme (Pol
, PCNA, and RFC) in the presence of RPA (Fig.
3A). Elongation proceeded
continuously until the 5'-end was reached after 30-45 s for most
complexes, corresponding to a rate of 40-60 nt/s. This rate is
consistent with the average rate of fork migration of 50 nt/sec
measured recently in a whole-genome analysis (55). Strand-displacement
synthesis by Pol
holoenzyme proceeded for a subset of the
complexes; 30-40% did not initiate strand-displacement synthesis
during the time course of the assay (Fig. 3B). Those
complexes that did carry out strand-displacement synthesis produced a
broad band of extension products, which was detected using denaturing
agarose electrophoresis. The median of this band corresponded to an
average rate of ~1.5 ± 0.5 nt/sec for strand-displacement
synthesis by Pol
holoenzyme. However, the fastest 10% of complexes
proceeded at a rate of 3-4 nt/s.

View larger version (55K):
[in this window]
[in a new window]
|
Fig. 3.
Strand-displacement synthesis and nick
translation by Pol and FEN1.
A, schematic of the assays. B,
strand-displacement synthesis. Alkaline agarose electrophoretic
analysis of strand displacement synthesis. Standard assays contained
100 mm NaCl, RPA, RFC, PCNA, and Pol for the indicated times at
30 °C (see "Experimental Procedures" for details). The reactions
were preincubated with RPA, PCNA, and RFC for 1 min at 30 °C, and
then started by adding Pol . The arrow indicates fully
replicated Bluescript SKII DNA (2.9 kb). The label remaining at 1.14 kb
is material that did not hybridize to the ss SKII DNA. C,
nick translation. Alkaline agarose electrophoretic analysis of
replication reactions as described under B, but with in
addition either FEN1, Dna2, or both added together with Pol . Only
the region around 2.9 kb is shown.
|
|
The same substrate also allowed us to measure rates of nick
translation. Because the 1.14-kb long primer is labeled at the 3'-position, it follows that this label will be lost from the DNA after
nick translation has proceeded for that distance (Fig. 3, A
and C). The time point at which half of the label has been lost is used to calculate the average rate of nick translation. This
time was corrected for the period (~45 s) required to completely replicate the ssDNA circle. With FEN1 present, half of the label was
lost after 11 min of incubation, corresponding to an average nick-translation rate of ~1.7 ± 0.5 nt/sec, comparable with the rate of strand displacement synthesis by Pol
holoenzyme in the absence of FEN1 (Fig. 3C). About 20% of the label remained
even after 20 min of incubation and probably represents disassembled complexes. The Dna2 nuclease poorly supported nick translation, whereas
its inclusion together with FEN1 did not alter the rate of nick
translation obtained with FEN1 alone. Nick translation over extended
stretches of DNA as carried out in this experiment allowed us to
determine an elongation rate for this process, but this assay does not
reflect a physiological maturation assay in which nick translation may
proceed for only a few nucleotides (see below). Therefore, in addition
to obtaining a rate of nick translation, it may be equally important to
determine the factors and conditions that initiate this process.
Gap Filling by Pol
Produces Ligatable Nicks--
To assess
with what efficiency and precision Pol
holoenzyme fills gaps
generated during DNA metabolic processes, e.g.
nucleotide-excision repair, we carried out replication assays on primed
circular Bluescript SKII ssDNA in the presence of DNA ligase. Covalent
closure of the replicated strand by DNA ligase was detected by
electrophoresis through an agarose gel in the presence of ethidium
bromide, which causes an abnormally rapid migration of covalently
closed circular DNA. With a 5'-phosphorylated fully hybridized primer,
replication by Pol
holoenzyme proceeded with remarkable precision
to form a ligatable nick. In the presence of DNA ligase, predominantly (87%) covalently closed DNA circles were produced (Fig.
4B, lane 1).
Formation of ligated DNA required that the primer contain a
5'-phosphate and the presence of DNA ligase (data not shown), and
proceeded with virtually 100% efficiency when FEN1, but not Dna2 was
included in the assay (lanes 2 and 3).

View larger version (43K):
[in this window]
[in a new window]
|
Fig. 4.
Coupling DNA replication to maturation.
A, schematic of the assays. B, maturation of a
double-stranded DNA (SKdc10) or RNA-DNA primer (SKrc14), both
containing a 5'-phosphate. Standard assays contained 100 mM
NaCl, RPA, RFC, PCNA, Pol , and FEN1, Dna2, and DNA ligase where
indicated for 4 min at 30 °C. The reactions were preincubated with
RPA, PCNA, and RFC for 1 min at 30 °C, and then started by adding
the other proteins in a mix (see "Experimental Procedures" for
details). C, maturation of primers with a 10-nt (SKdc11) or
30-nt (SKdc12) 5'-flap. Assays were carried out as in B, for
the indicated times. Analysis was on a 1% agarose gel with 0.5 µg/ml
ethidium bromide present.
|
|
Efficient Okazaki Fragment Maturation by Pol
and FEN1--
A
primer with 8 nt of RNA followed by 22 nt of DNA was used as a model
substrate for Okazaki-fragment maturation. Although the primer
contained a 5'-phosphate, no ligated products were detected when the
DNA was replicated with Pol
holoenzyme in the presence of DNA
ligase (Fig. 4, lane 6). Even a 10-fold excess of DNA ligase
in this assay failed to produce a detectable ligation product (data not
shown). Although this substrate specificity is one that might logically
be expected for a DNA ligase involved in Okazaki-fragment maturation,
surprisingly, previous biochemical studies of DNA ligase have shown
rather efficient ligation of (rA)-oligomer hybridized to poly(dT) (56).
Ligation of essentially all replicated molecules was observed when FEN1
was included in the assay, whereas Dna2 functioned poorly (lanes
7 and 8).
Maturation of Long Flaps Requires DNA2--
We used two primers in
our maturation studies, which contained 5'-flap; one flap was 10 nt
long and the other flap was 30 nt in length. The formation of ligated
products with the 10-nt flap was similar to observed with the RNA-DNA
primer, i.e. FEN1 was fully effective and the efficiency of
Dna2 was much lower, requiring a 10-min incubation at 30 °C to
catalyze the accumulation of 82% ligated circles (Fig. 4C,
lanes 1-6). On the other hand, replication of the primer
with the 30-nt flap showed dramatically different results. Only 27% of
the replication products had ligated after a 10-min replication
reaction in the presence of FEN1 as processing nuclease. Dna2 was more
effective with 88% ligation products after 10 min of reaction
(lanes 7-12). However, the presence of both FEN1 and DNA2
was essential to achieve both rapid and complete ligation (lanes
13-15). Our results with the 30-mer flap are in agreement with
recent studies of Okazaki-fragment maturation that indicate that
binding of RPA to long flap prevents the action of FEN1 (34).
Degradation of the long flap by Dna2 would produce shorter flaps, as
exemplified in our 10-mer flap substrate, which could then be
efficiently degraded by FEN1.
When E. coli SSB was used as ssDNA-binding protein,
maturation of DNA with the 30-mer flap primer was also very
inefficient, similar to observed with RPA (Fig.
5A, lane 2).
However, although addition of Dna2 rescued the maturation reaction with
RPA present, Dna2 did not rescue when the DNA was coated with SSB
(compare lanes 6 and 8 with lanes 2 and 4). Dna2 shows specific protein-protein interactions
with RPA, which may serve to load Dna2 at the RPA-bound flap (34). When
we substituted RPA with the large subunit of RPA, designated Rpa1, in
the maturation assay, Dna2 similarly rescued maturation of the
substrate with the 30-mer flap, suggesting that the important
biochemical interactions of Dna2 are with the large subunit of RPA
(lanes 10 and 12). As a control, maturation of
the substrate with the 10-mer flap was fully efficient under all
conditions.

View larger version (38K):
[in this window]
[in a new window]
|
Fig. 5.
DNA2 directed to the flap by the Rpa1 subunit
of RPA. Assays containing 100 mM NaCl, RPA, RFC, PCNA,
Pol , FEN1, DNA ligase, and Dna2 where indicated, were as described
in Fig. 4C, with either SKdc11- (10-mer flap) or SKdc12
(30-mer flap)-primed DNA, and with either 1.15 µg of RPA, 0.85 µg
of E. coli SSB, or 1 µg of Rpa1 present as single stranded
binding protein. Assays were for 4 min at 30 °C. Analysis was on a
1% agarose gel with 0.5 µg/ml ethidium bromide present.
|
|
Kinetic Analysis of Okazaki-fragment Maturation--
Using our
model RNA-DNA primed circular DNA, we determined the maturation time,
i.e. the time required to convert nicked DNA circles into
covalently closed DNA. An example of this analysis is given in Fig.
6B. The level of nicked
circles peaked at ~40% after 60 s, then decayed to zero with
the formation of covalently closed circles (Fig. 6, C and
D). In our analysis, the maturation time is defined as the
difference in the time required to replicate 50% of the DNA (nicked
and covalently closed circles) and the time required to convert 50% of
the nicked DNA to covalent closed circles: t[ccc]50 - t([nc]+[ccc])50. Under standard replication conditions
with the concentration of DNA at 3.3 nM, PCNA at 13 nM, and Pol
, FEN1, and DNA ligase at 5 nM,
the maturation time was 22-25 s.

View larger version (36K):
[in this window]
[in a new window]
|
Fig. 6.
Rates of Okazaki fragment maturation.
A, schematic of the assay. The primer was SKrc14 with 8 nt
of RNA followed by 22 nt of DNA. B, time course of
maturation under standard conditions with 3.3 nM DNA, 5 nM Pol , 5 nM of FEN1, and 5 nM
of DNA ligase. The reactions were preincubated with RPA, PCNA, and RFC
for 1 min at 30 °C, and then started by adding the other proteins in
a mix (see "Experimental Procedures" for details). Analysis was on
a 1% agarose gel with 0.5 µg/ml ethidium bromide present.
C, accumulation and disappearance of nicked circles under
the indicated experimental conditions. D, accumulation of
covalently closed circles.
|
|
Several variables were altered to probe the response of this parameter
to changing reaction conditions and enzyme levels. No difference was
observed when the NaCl concentration was raised from 100 mM
to 140 mM. Increasing the dNTP concentration from 100 µM to 400 µM each resulted in a higher rate
of formation of nicked circles. However, the maturation time remained
the same as covalently closed circles also accumulated more rapidly
(data not shown). Increasing the levels of PCNA to 50 nM or
reducing it to 5 nM, or increasing the level of Pol
to
10 nM did not alter the kinetics of maturation (data not
shown). An increase of the FEN1 concentration to 50 nM also
did not affect the kinetics, however, decreasing the FEN1 concentration
to 2 nM, a substoichiometrical level, provided some
insights in the process. The rate of maturation of about half of the
DNA molecules remained unaffected, but the rate of maturation of the
remaining molecules was drastically reduced, and even after 4 min,
15-20% nicked circles remained (Fig. 6, C and
D). These data strongly suggest that FEN1 forms an integral,
stable component of the maturation complex and does not readily
exchange among complexes.
Inclusion of Dna2 in the assay, either at 5 nM or 25 nM, showed no effect when FEN1 was present at 5 nM; the kinetics of formation and decay of nicked circles
and of the formation of covalently closed circles were not affected by
Dna2 (data not shown). However, when FEN1 was present at the
substoichiometrical level of 2 nM, addition of Dna2 did not
affect the early stages of the reaction, but its presence prevented the
accumulation of nicked circles in the later stages of the reaction
(Fig. 6, C and D). Therefore, Dna2 appears to
function in the rescue of maturation complexes only if FEN1 activity is impaired.
Like FEN1, DNA ligase is known to interact with PCNA, and efficient
ligation requires that PCNA is properly loaded onto the substrate DNA
(47, 48, 57). Therefore, we expected DNA ligase to function as a stable
component of the maturation complex, as observed with FEN1.
Surprisingly, however, the rate of maturation was substantially
increased at higher concentrations of DNA ligase. At 50 nM
DNA ligase, nicked circles accumulated to the extent of only 26%
because they were more rapidly converted to covalently closed circles.
The maturation time was reduced to 15-17 s at 50 nM DNA
ligase (Fig. 6, C and D). A lower level of
ligase, 15 nM, yielded an intermediate value of 17-19 s
for the maturation time (data not shown). Therefore, it appears that
DNA ligase remains only loosely associated with the complex, and
increasing concentrations drives complex formation and increases
maturation rates.
DNA Ligase Controls the Nick Translation Patch
Length--
Although it is obvious that during Okazaki-fragment
maturation, nick translation has to proceed past the RNA-DNA junction, it is not known how far it proceeds prior to ligation or which factor(s) determine the patch length. Studies in the T4 DNA replication system, which is highly analogous to the eukaryotic systems, have indicated that ~30 nt of DNA are removed per Okazaki fragment during
coupled leading- and lagging-strand DNA replication (58). We wanted to
determine how much DNA was actually removed from a successfully
replicated and ligated DNA molecule. To address this question, a set of
RNA-DNA primers was used, each with 8 nt of RNA followed by either 6, 12, or 22 nt of DNA (Fig. 7A). A single radioactive label was incorporated with an
exonuclease-deficient DNA polymerase and locked into place by a short
pulse of DNA synthesis with a large excess of non-radioactive dNTPs,
extending about 20-50 nt past the labeled position. This substrate was
purified and used in the Okazaki-fragment maturation assay. Loss of
label in the covalently closed product indicates that nick translation proceeded past the labeled position prior to ligation. Fig.
7B shows the results obtained when the label was inserted
after the sixth nucleotide past the RNA-DNA junction, showing several
controls and the effect of varying levels of FEN1, Dna2, and DNA ligase on the percent retention of label in the covalently closed DNA. The
same assays were carried out with primers in which the label was
introduced at positions 12 or 22 after the RNA-DNA junction (data not
shown). For each experiment, the percent retention of label was plotted
as a function of the position of the label in nucleotides past the
RNA/DNA junction, and the level of 50% retention of label was
determined by interpolation or extrapolation to obtain the average nick
translation patch length (Fig. 7C).

View larger version (34K):
[in this window]
[in a new window]
|
Fig. 7.
Nick translation patch length during
maturation. A, schematic of the assay. The starred
position indicates the position of the label in each of three
individual primers. B, assays containing 100 mM
NaCl, RPA, RFC, PCNA, Pol , and FEN1, DNA ligase, or Dna2 as
indicated, were carried out with SKII ssDNA primed with 3'-end labeled
SKrc14-14 (5'-p-rArCrGrArCrGrUrU-GTAAAA*CN20-50; see
"Experimental Procedures"). The reactions were preincubated with
RPA, PCNA, and RFC for 1 min at 30 °C and then started by adding the
other proteins in a mix. Incubation was for 4 min at 30 °C and
analysis was on a 1% agarose gel with 0.5 µg/ml ethidium bromide
present. C, quantitation of label remaining for assays
similar to described in B but carried out with either 3'-end
labeled SKrc14-14, SKrc14-20
(5'- p-rArCrGrArCrGrUrU-GTAAAACGACGG*CN20-50), or
SKrc14-30
(5'-p-rArCrGrArCrGrUrU-GTAAAACGACGGCCAGTGAGCG*CN20-50)
as primer.
|
|
This type of analysis indicates that under our standard replication and
maturation conditions, the average nick translation patch is 8-12 nt
(the range of three independent experiments) past the RNA-DNA junction,
with or without Dna2 present. However, in the presence of 50 nM of DNA ligase, the patch size is reduced to only 4-6
nt. A lower concentration of DNA ligase (15 nM) was almost
as effective (Fig. 7B, lane 5). Very high levels
of FEN1 (50 nM) slightly increased the patch size to
10-15 nt from 8-12nt.
 |
DISCUSSION |
Our kinetic analysis of gap filling and Okazaki-fragment synthesis
has yielded a picture of a remarkably efficient interaction between Pol
and FEN1. PCNA is the organizing force in this coupling between
synthesis and degradation, as exemplified by the observation that a
FEN1 mutant that is only deficient for interaction with PCNA, is unable
to carry out nick translation with Pol
(Fig. 2). All of our studies
were carried out at 100-140 mM NaCl, which lends
specificity to the reactions by inhibiting binding of the enzymes to
the DNA when PCNA is not loaded (Figs. 1 and 2).
When Pol
encounters downstream double-stranded DNA, it pauses at
the position of a precise nick with high frequency as follows from the
observation that in the presence of DNA ligase, 87% ligation occurred
(Fig. 4B, lane 1). Without ligase present, pause
sites distributed evenly over the position of the precise nick and the +1 position (Fig. 1B). Not all replication complexes go into
a strand-displacement synthesis, which may be due to complex
dissociation upon encountering the double-stranded junction, which at
least in the T4 system is a fast process (59). Because of the
thermolabile nature of RFC, reloading of PCNA and complex reassembly is
not expected to be very efficient in our assay system, which may
explain why some DNA molecules never underwent strand-displacement
synthesis (60).
Although gap filling by Pol
coupled to ligation is a fairly
efficient process, it is by no means perfect, and certainly inside the
cell a ligation failure rate of 13% would be unacceptable (Fig. 4,
lane 1). Addition of FEN1 to the assay initiated nick translation and produced essentially fully ligated products. For the
maturation of RNA-ended junctions and flap junctions, the generation of
ligatable nicks became entirely dependent on nick translation, but
proceeded also very efficiently as long as flaps were small. The
balanced exchange of the nick between the 5'
3'-polymerase domain
of Pol
and the 5'
3'-exonuclease activity of FEN1 resembles
that of prokaryotic DNA polymerase I in which both activities are
combined in the same polypeptide (61). Remarkably, the rate of strand
displacement synthesis by Pol
(1.5 nt/sec) is comparable with the
rate of nick translation (1.7 nt/sec) when measured over long stretches
of DNA (Fig. 3). Therefore, it appears that the observed large
stimulation with which the polymerase proceeds through a downstream
primer in the presence of FEN1 may be due to more rapid initiation,
i.e. departure from the paused state, rather than elongation
of strand displacement or nick translation, respectively (Fig. 2).
Depending on the DNA ligase concentration, the nick-translation patch
during Okazaki-fragment maturation was 4-12 nt in length (past the
RNA/DNA junction). Our results cannot be easily compared with a recent
T4 maturation study, because the patch of ~30 nt in that study was a
weighted-average number calculated from all replication products,
whereas we uniquely measured the patch in successfully ligated
replication products (58). In our model system, the patch length is an
important determinant for the rate with which Okazaki fragments are
matured (see below).
Dna2 Requirement in Okazaki Fragment Maturation--
In our model
studies of Okazaki fragment maturation we used an RNA-primed circular
template on which the replication complex encounters the RNA primer
after complete replication around the circle (Fig. 6A). In
this system, we found no requirement for the Dna2 nuclease/helicase as
long as all relevant enzymes were present in slight excess over DNA.
Neither the efficiency of ligation (Fig. 4B), the rate of
maturation (Fig. 6) nor the size of the nick-translation patch (Fig. 7)
were affected by the presence of Dna2.
However, Dna2 became a stimulatory component of the maturation complex
when the concentration of FEN1 was less than stoichiometric (Fig.
6D). The data are consistent with a model in which those replication complexes that contained FEN1 matured normally, whereas the
remaining complexes showed a strong delay in maturation. The latter
deficiency was rescued by addition of Dna2. Presumably, those complexes
lacking FEN1 proceeded to carry out excessive strand-displacement
synthesis to the extent that even FEN1 recycled from completely ligated
products was unable to act on those DNA substrates. These inert
substrates probably resemble our model 30-mer flap substrate, which is
inactive for nick translation with FEN1 because of RPA binding to the
flap. Dna2 would then be able to bind to the flap and partially degrade
it because of its interaction with RPA. The large subunit, Rpa1,
suffices, because Rpa1, but not E. coli SSB, allowed rescue
of maturation of long flaps by Dna2.
Interestingly, although Dna2 alone supported Okazaki-fragment
maturation much more poorly than FEN1, a substantial percent of ligated
products was still observed, particularly with the flap substrates
(Fig. 4, B and C). Studies of the cutting
specificity of Dna2 on 5'-flap substrates have shown that it leaves a
5- to 10-nt 5'-flap (36). When in the same study the specificity of cutting by Dna2 was measured in an assay system in which replication by
Pol
encountered a downstream RNA/DNA primer (comparable with the
system shown in Fig. 4A), cutting by Dna2 of that RNA/DNA primer was observed mainly at sites 2-4 nt beyond the RNA/DNA junction. Because this activity depended on DNA replication, it was
proposed that strand-dispacement synthesis generated the flap to be cut
by Dna2. What could not be measured in this coupled replication-degradation assay was whether the Dna2-mediated cut occurred in the duplex region ahead of the displaced strand, or at the
precise nick position, or, most likely, into the ss region exposed by
strand displacement synthesis by Pol
. If the cutting specificity of
Dna2 remained the same regardless whether the DNA was a pre-formed ss
flap or a flap generated by strand-displacement synthesis, cutting
would be in the ss region only and leave a 5- to 10-nt 5'- flap (36).
In order for this 5'-flapped molecule to be matured into a ligatable
nick in the absence of FEN1 and barring additional degradation by Dna2,
one would have to assume that the 3'
5'-exonuclease activity of Pol
would have the ability to degrade back the strand it had
synthesized to allow the displaced strand to rehybridize to the
template to produce a proper nick for ligation. Therefore, assuming
that the Dna2 cleavage specificity is similar under our reaction
conditions (100 mM NaCl, 30 °C) and those used by Bae
and Seo (no salt, 37 °C; ref. 36), it is likely that the exonuclease
activity of Pol
is important in producing a ligatable nick in the
absence of FEN1. In the companion paper, this issue will be addressed in an assay system in which the 3'
5'-exonuclease of Pol
has been inactivated (52).
The sharp demarcation we notice in the maturation of a 10-mer
flap versus a 30-mer flap is because RPA requires a 30-mer
oligonucleotide for binding (62). However, it is conceivable that
in vivo the maturation of even small flaps requires Dna2
activity because other proteins in the replisome may bind to small
flaps and inhibit the activity of FEN1. Furthermore, as our in
vitro studies cannot address how often in vivo
maturation with FEN1 alone is unsuccessful, and, second, how many
unmatured Okazaki fragments would have to be accumulated to cause
lethality to the cell, we cannot address whether the essential nature
of DNA2 is due to its constitutively required presence at
each Okazaki fragment, or to the rescue of a small number of stalled
Okazaki fragments which otherwise would be lethal. However, our
in vitro results do suggest the latter as a reasonable
scenario (Fig. 8). Our data are not in
disagreement with a recent study by Bae et al. (34). Because
in that study all maturation experiments with DNA ligase were performed
on substrates with long 5'-flaps, an absolute requirement for Dna2 was
measured, as we did with our 30-mer flap substrate.

View larger version (11K):
[in this window]
[in a new window]
|
Fig. 8.
Model of the actions of Pol
, FEN1, and Dna2 during gap filling synthesis.
The model assumes that RPA binds to long flaps only. See text for
details.
|
|
DNA Ligase Is Loosely Associated with the Maturation
Complex--
The biphasic response resulting from the maturation
studies with substoichiometrical concentrations of FEN suggest that
FEN1 forms a stable integral component of the maturation complex. The same is not the case for DNA ligase. Even though DNA ligase has a
PCNA-binding domain similar to FEN1, and the interaction between PCNA
and DNA ligase I is critical for joining Okazaki fragments and for
long-patch base-excision repair in mammalian cells, we observed a
titratable response which saturated at an ~15-fold molar excess of
DNA ligase (47). Perhaps, on the DNA, the interaction between PCNA and
DNA ligase is less strong, or alternatively, FEN1 and/or Pol
compete with DNA ligase for the same binding site(s) on PCNA.
Presumably, other factor(s) may be required in vivo to keep
DNA ligase positioned in the maturation complex.
Efficiency of Okazaki Fragment Maturation--
Although
Okazaki-fragment maturation in our in vitro system is very
efficient, at least as measured by end-product formation, the rates of
maturation may still be incompatible with cellular metabolism. Assuming
that the average length of an Okazaki fragment is ~150 nt, it would
take 3-4 s for elongation to be complete at a fork rate of 50 nt/sec
(55). No information is available regarding the rate of initiation,
i.e. priming by DNA polymerase
-primase. However,
maturation under our most favorable conditions, with high
concentrations of DNA ligase, still takes an average of 15-17 s. Most
of this period is taken up by nick translation through an RNA-DNA
stretch of ~15 nt at ~1.7 nt/s. Under these conditions, one would
expect Okazaki fragments to accumulate inside the cell, which appears
not to be the case (63). Therefore, to improve maturation rates one
would either need to improve the rate of nick translation or bypass
extensive nick translation through helicase action to rapidly displace
the RNA-DNA section to be matured. Dna2, which has helicase activity,
did not accelerate maturation (Fig. 6) (4, 36). Furthermore, the
essential activity of Dna2 is the nuclease, rather than the helicase
(9). Therefore, another DNA helicase may be involved in this process.
 |
ACKNOWLEDGEMENTS |
We thank Kim Gerik and Carrie Welch for
technical assistance and John Majors for critical discussions during
the course of this work.
 |
FOOTNOTES |
*
This work was supported by National Institutes of Health
Grant GM58534.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
Present Address: 454 Corporation, 20 Commercial St., Branford,
CT 06405.
**
To whom correspondence should be addressed. Tel.: 314-362-3872 Fax:
314-362-7183; E-mail: burgers@biochem.wustl.edu.
Published, JBC Papers in Press, November 6, 2002, DOI 10.1074/jbc.M209801200
 |
ABBREVIATIONS |
The abbreviations used are:
Pol
, DNA
polymerase
;
RFC, replication factor C;
RPA, replication protein A;
PCNA, proliferating cell nuclear antigen;
ss, single-stranded;
nt, nucleotide;
SSB, single-stranded DNA-binding protein.
 |
REFERENCES |
| 1.
|
Bambara, R. A.,
Murante, R. S.,
and Henricksen, L. A.
(1997)
J. Biol. Chem.
272,
4647-4650[Free Full Text]
|
| 2.
|
MacNeill, S. A.,
and Burgers, P. M.
(2000)
in
The Yeast Nucleus: Frontiers in Molecular Biology
(Fantes, P.
, and Beggs, J., eds)
, pp. 19-57, Oxford University Press, Oxford
|
| 3.
|
Chen, J. Z.,
Qiu, J.,
Shen, B.,
and Holmquist, G. P.
(2000)
Nucleic Acids Res.
28,
3649-3656[Abstract/Free Full Text]
|
| 4.
|
Budd, M. E.,
Choe, W.-C.,
and Campbell, J.
(1995)
J. Biol. Chem.
270,
26766-26769[Abstract/Free Full Text]
|
| 5.
|
Budd, M. E.,
and Campbell, J. L.
(1997)
Mol. Cell. Biol.
17,
2136-2142[Abstract]
|
| 6.
|
Formosa, T.,
and Nittis, T.
(1999)
Genetics
151,
1459-1470[Abstract/Free Full Text]
|
| 7.
|
Kang, H. Y.,
Choi, E.,
Bae, S. H.,
Lee, K. H.,
Gim, B. S.,
Kim, H. D.,
Park, C.,
MacNeill, S. A.,
and Seo, Y. S.
(2000)
Genetics
155,
1055-1067[Abstract/Free Full Text]
|
| 8.
|
Bae, S. H.,
Choi, E.,
Lee, K. H.,
Park, J. S.,
Lee, S. H.,
and Seo, Y. S.
(1998)
J. Biol. Chem.
273,
26880-26890[Abstract/Free Full Text]
|
| 9.
|
Lee, K. H.,
Kim, D. W.,
Bae, S. H.,
Kim, J. A.,
Ryu, G. H.,
Kwon, Y. N.,
Kim, K. A.,
Koo, H. S.,
and Seo, Y. S.
(2000)
Nucleic Acids Res.
28,
2873-2881[Abstract/Free Full Text]
|
| 10.
|
Budd, M. E.,
Choe, W.,
and Campbell, J. L.
(2000)
J. Biol. Chem.
275,
16518-16529[Abstract/Free Full Text]
|
| 11.
|
Parenteau, J.,
and Wellinger, R. J.
(1999)
Mol. Cell. Biol.
19,
4143-4152[Abstract/Free Full Text]
|
| 12.
|
Choe, W.,
Budd, M.,
Imamura, O.,
Hoopes, L.,
and Campbell, J. L.
(2002)
Mol. Cell. Biol.
22,
4202-4217[Abstract/Free Full Text]
|
| 13.
|
Klungland, A.,
and Lindahl, T.
(1997)
EMBO J.
16,
3341-3348[CrossRef][Medline]
[Order article via Infotrieve]
|
| 14.
|
Kim, K.,
Biade, S.,
and Matsumoto, Y.
(1998)
J. Biol. Chem.
273,
8842-8848[Abstract/Free Full Text]
|
| 15.
|
Matsumoto, Y.
(2001)
Progr. Nucleic Acids Res. Mol. Biol.
68,
129-138[Medline]
[Order article via Infotrieve]
|
| 16.
|
Johnson, R. E.,
Kovvali, G. K.,
Prakash, L.,
and Prakash, S.
(1995)
Science
269,
238-240[Abstract/Free Full Text]
|
| 17.
|
Tishkoff, D. X.,
Filosi, N.,
Gaida, G. M.,
and Kolodner, R. D.
(1997)
Cell
88,
253-263[CrossRef][Medline]
[Order article via Infotrieve]
|
| 18.
|
Kokoska, R. J.,
Stefanovic, L.,
Tran, H. T.,
Resnick, M. A.,
Gordenin, D. A.,
and Petes, T. D.
(1998)
Mol. Cell. Biol.
18,
2779-2788[Abstract/Free Full Text]
|
| 19.
|
Negritto, M. C.,
Qiu, J.,
Ratay, D. O.,
Shen, B.,
and Bailis, A. M.
(2001)
Mol. Cell. Biol.
21,
2349-2358[Abstract/Free Full Text]
|
| 20.
|
Xie, Y.,
Liu, Y.,
Argueso, J. L.,
Henricksen, L. A.,
Kao, H. I.,
Bambara, R. A.,
and Alani, E.
(2001)
Mol. Cell. Biol.
21,
4889-4899[Abstract/Free Full Text]
|
| 21.
|
Henricksen, L. A.,
Veeraraghavan, J.,
Chafin, D. R.,
and Bambara, R. A.
(2002)
J. Biol. Chem.
277,
22361-22369[Abstract/Free Full Text]
|
| 22.
|
Johnson, R. E.,
Kovvali, G. K.,
Prakash, L.,
and Prakash, S.
(1998)
Curr. Genet.
34,
21-29[CrossRef][Medline]
[Order article via Infotrieve]
|
| 23.
|
Symington, L. S.
(1998)
Nucleic Acids Res.
26,
5589-5595[Abstract/Free Full Text]
|
| 24.
|
Tishkoff, D. X.,
Boerger, A. L.,
Bertrand, P.,
Filosi, N.,
Gaida, G. M.,
Kane, M. F.,
and Kolodner, R. D.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
7487-7492[Abstract/Free Full Text]
|
| 25.
|
Li, X., Li, J.,
Harrington, J.,
Lieber, M. R.,
and Burgers, P. M.
(1995)
J. Biol. Chem.
270,
22109-22112[Abstract/Free Full Text]
|
| 26.
|
Eissenberg, J. C.,
Ayyagari, R.,
Gomes, X. V.,
and Burgers, P.
(1997)
Mol. Cell. Biol.
17,
6367-6378[Abstract]
|
| 27.
|
Kao, H. I.,
Henricksen, L. A.,
Liu, Y.,
and Bambara, R. A.
(2002)
J. Biol. Chem.
277,
14379-14389[Abstract/Free Full Text]
|
| 28.
|
Hosfield, D. J.,
Mol, C. D.,
Shen, B.,
and Tainer, J. A.
(1998)
Cell
95,
135-146[CrossRef][Medline]
[Order article via Infotrieve]
|
| 29.
|
Hwang, K. Y.,
Baek, K.,
Kim, H. Y.,
and Cho, Y.
(1998)
Nat. Struct. Biol.
5,
707-713[CrossRef][Medline]
[Order article via Infotrieve]
|
| 30.
|
Murante, R. S.,
Rust, L.,
and Bambara, R. A.
(1995)
J. Biol. Chem.
270,
30377-30383[Abstract/Free Full Text]
|
| 31.
|
Xu, Y.,
Potapova, O.,
Leschziner, A. E.,
Grindley, N. D.,
and Joyce, C. M.
(2001)
J. Biol. Chem.
276,
30167-30177[Abstract/Free Full Text]
|
| 32.
|
Rigby, P. W.,
Dieckmann, M.,
Rhodes, C.,
and Berg, P.
(1977)
J. Mol. Biol.
113,
237-251[CrossRef][Medline]
[Order article via Infotrieve]
|
| 33.
|
Turchi, J. J.,
and Bambara, R. A.
(1993)
J. Biol. Chem.
268,
15136-15141[Abstract/Free Full Text]
|
| 34.
|
Bae, S. H.,
Bae, K. H.,
Kim, J. A.,
and Seo, Y. S.
(2001)
Nature
412,
456-461[CrossRef][Medline]
[Order article via Infotrieve]
|
| 35.
|
Maga, G.,
Villani, G.,
Tillement, V.,
Stucki, M.,
Locatelli, G. A.,
Frouin, I.,
Spadari, S.,
and Hubscher, U.
(2001)
Proc. Natl. Acad. Sci. U. S. A.
98,
14298-14303[Abstract/Free Full Text]
|
| 36.
|
Bae, S. H.,
and Seo, Y. S.
(2000)
J. Biol. Chem.
275,
38022-38031[Abstract/Free Full Text]
|
| 37.
|
Waga, S.,
Bauer, G.,
and Stillman, B.
(1994)
J. Biol. Chem.
269,
10923-10934[Abstract/Free Full Text]
|
| 38.
|
Burgers, P. M.,
and Gerik, K. J.
(1998)
J. Biol. Chem.
273,
19756-19762[Abstract/Free Full Text]
|
| 39.
|
Burgers, P. M.
(1999)
Methods
18,
349-355[CrossRef][Medline]
[Order article via Infotrieve]
|
| 40.
|
Henricksen, L. A.,
Umbricht, C. B.,
and Wold, M. S.
(1994)
J. Biol. Chem.
269,
11121-11132[Abstract/Free Full Text]
|
| 41.
|
Gomes, X. V.,
Gary, S. L.,
and Burgers, P. M.
(2000)
J. Biol. Chem.
275,
14541-14549[Abstract/Free Full Text]
|
| 42.
|
Gomes, X. V.,
and Burgers, P. M. J.
(2000)
EMBO J.
19,
3811-3821[CrossRef][Medline]
[Order article via Infotrieve]
|
| 43.
|
Sambrook, J.,
Fritsch, E. F.,
and Maniatis, T.
(1989)
Molecular Cloning: A Laboratory Manual
, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
|
| 44.
|
Yamamoto, K. R.,
Alberts, B. M.,
Benzinger, R.,
Lawhorne, L.,
and Treiber, G.
(1970)
Virology.
40,
734-744[CrossRef][Medline]
[Order article via Infotrieve]
|
| 45.
|
Montecucco, A.,
Rossi, R.,
Levin, D. S.,
Gary, R.,
Park, M. S.,
Motycka, T. A.,
Ciarrocchi, G.,
Villa, A.,
Biamonti, G.,
and Tomkinson, A. E.
(1998)
EMBO J.
17,
3786-3795[CrossRef][Medline]
[Order article via Infotrieve]
|
| 46.
|
Mossi, R.,
Ferrari, E.,
and Hubscher, U.
(1998)
J. Biol. Chem.
273,
14322-14330[Abstract/Free Full Text]
|
| 47.
|
Levin, D. S.,
McKenna, A. E.,
Motycka, T. A.,
Matsumoto, Y.,
and Tomkinson, A. E.
(2000)
Curr. Biol.
10,
919-922[CrossRef][Medline]
[Order article via Infotrieve]
|
| 48.
|
Tom, S.,
Henricksen, L. A.,
Park, M. S.,
and Bambara, R. A.
(2001)
J. Biol. Chem.
276,
24817-24825[Abstract/Free Full Text]
|
| 49.
|
Burgers, P. M. J.,
and Yoder, B. L.
(1993)
J. Biol. Chem.
268,
19923-19936[Abstract/Free Full Text]
|
| 50.
|
Podust, L. M.,
Podust, V. N.,
Floth, C.,
and Hubscher, U.
(1994)
Nucleic Acids Res.
22,
2970-2975[Abstract/Free Full Text]
|
| 51.
|
Kaboord, B. F.,
and Benkovic, S. J.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
10881-10885[Abstract/Free Full Text]
|
| 52.
|
Jin, Y. H.,
Ayyagari, R.,
Resnick, M. A.,
Gordenin, D. A.,
and Burgers, P. M.
(2003)
J. Biol. Chem.
278,
1626-1633[Abstract/Free Full Text]
|
| 53.
|
Warbrick, E.
(1998)
Bioessays
20,
195-199[CrossRef][Medline]
[Order article via Infotrieve]
|
| 54.
|
Gary, R.,
Park, M. S.,
Nolan, J. P.,
Cornelius, H. L.,
Kozyreva, O. G.,
Tran, H. T.,
Lobachev, K. S.,
Resnick, M. A.,
and Gordenin, D. A.
(1999)
Mol. Cell. Biol.
19,
5373-5382[Abstract/Free Full Text]
|
| 55.
|
Raghuraman, M. K.,
Winzeler, E. A.,
Collingwood, D.,
Hunt, S.,
Wodicka, L.,
Conway, A.,
Lockhart, D. J.,
Davis, R. W.,
Brewer, B. J.,
and Fangman, W. L.
(2001)
Science
294,
115-121[Abstract/Free Full Text]
|
| 56.
|
Tomkinson, A. E.,
Tappe, N. J.,
and Friedberg, E. C.
(1992)
Biochemistry.
31,
11762-11771[CrossRef][Medline]
[Order article via Infotrieve]
|
| 57.
|
Matsumoto, Y.,
Kim, K.,
Hurwitz, J.,
Gary, R.,
Levin, D. S.,
Tomkinson, A. E.,
and Park, M. S.
(1999)
J. Biol. Chem.
274,
33703-33708[Abstract/Free Full Text]
|
| 58.
|
Bhagwat, M.,
and Nossal, N. G.
(2001)
J. Biol. Chem.
276,
28516-28524[Abstract/Free Full Text]
|
| 59.
|
Hacker, K. J.,
and Alberts, B. M.
(1994)
J. Biol. Chem.
269,
24221-24228[Abstract/Free Full Text]
|
| 60.
|
Yoder, B. L.,
and Burgers, P. M. J.
(1991)
J. Biol. Chem.
266,
22689-22697[Abstract/Free Full Text]
|
| 61.
|
Ma, W. P.,
Kaiser, M. W.,
Lyamicheva, N.,
Schaefer, J. J.,
Allawi, H. T.,
Takova, T.,
Neri, B. P.,
and Lyamichev, V. I.
(2000)
J. Biol. Chem.
275,
24693-24700[Abstract/< |