STAT5b, a Mediator of Synergism between c-Src and the Epidermal
Growth Factor Receptor*
Michael T.
Kloth
,
Kristen K.
Laughlin
,
Jacqueline S.
Biscardi§,
Julie L.
Boerner§,
Sarah J.
Parsons§, and
Corinne M.
Silva
§¶
From the Departments of
Internal Medicine and
§ Microbiology and the Cancer Center, University of Virginia
Health System, Charlottesville, Virginia 22908
Received for publication, July 19, 2002, and in revised form, November 5, 2002
 |
ABSTRACT |
Overexpression of the epidermal growth
factor receptor (EGFR) and its association with the tyrosine kinase,
c-Src, is correlated with increased cellular proliferation and
tumorigenesis. Previous studies have shown that EGFR and c-Src
co-overexpression and association leads to the c-Src-mediated
phosphorylation of tyrosine 845 of the EGFR and that mutation of
Tyr845 ablates epidermal growth factor (EGF)-induced
DNA synthesis. Here, we investigate the contribution of the signal
transducers and activators of transcription (STAT5b) in the signaling
pathways regulated by EGFR and c-Src overexpression in human breast
tumor cell lines as well as in a mouse fibroblast model (C3H10T1/2). We
demonstrate that 1) activation of STAT5b by EGF requires overexpression of the EGFR, 2) co-overexpression of c-Src alone does not result in
EGF-induced activation of STAT5b but enhances that seen in EGFR-overexpressing cells, and 3) EGF-induced tyrosine phosphorylation of STAT5b requires Tyr845 of the EGFR. Furthermore, the
stable overexpression of a kinase-defective c-Src in the context of
EGFR overexpression results in a decrease in the tyrosine
phosphorylation of STAT5b in response to EGF and a more dramatic
decrease in EGF-induced transcriptional activation of STAT5b,
suggesting an integral role for c-Src in the physiological actions of
STAT5b. Using a dominant negative STAT5b, we provide evidence that one
such physiological action is to mediate EGF-induced DNA-synthesis.
Finally, the use of site-specific tyrosine mutants demonstrates that
EGF-induced phosphorylation of STAT5b involves not only tyrosine 699 of
STAT5b, which is required for its transcriptional activation, but
also three previously identified tyrosines in the C terminus of STAT5b
(Tyr725/Tyr740/Tyr743).
 |
INTRODUCTION |
Tumorigenesis frequently occurs as a result of the overexpression
of proteins that are otherwise involved in normal cellular processes.
Examples of such proteins include the human epidermal growth factor
receptor (HER)1 family and
cellular c-Src tyrosine kinase (1, 2). It has been estimated that
overexpression of HER family members (HER1/EGFR, HER2/neu, HER3, and
HER4) occurs in ~67% of human breast cancers (3-5). Elevated levels
of the EGFR are associated with the loss of
estrogen-dependent growth of tumors and are found
predominantly in metastatic sites rather than in primary tumors,
suggesting a role for the EGFR in later stages of tumor progression (3, 4, 6). Overexpression of c-Src is found in greater than 70% of breast
cancers and thus frequently accompanies EGFR overexpression (2, 7, 8).
Not only has c-Src been shown to be involved in the normal process of
EGF-induced mitogenesis (9-11), but evidence is also accumulating to
suggest that c-Src potentiates the action of EGFR family members during
tumorigenesis (1, 12-14).
Model cell lines have been instrumental in characterizing the role of
EGFR and c-Src co-overexpression and association in the process of
tumor formation. In the mouse fibroblast cell model (C3H10T1/2),
overexpression of both the EGF receptor and c-Src leads to synergistic
increases in mitogenesis, anchorage-independent growth, and
tumorigenesis in nude mice as compared with overexpression of the EGFR
or c-Src alone (14). This increased tumorigenesis correlates with the
EGF-induced physical association of the EGF receptor with c-Src,
tyrosine phosphorylation of EGF receptor at two novel sites, and an
increased tyrosine phosphorylation of two EGF receptor substrates: the
Src homology 2-containing adapter protein (Shc) and phospholipase C
.
These studies provide evidence for the cooperativity between c-Src and
EGF receptor in the process of tumor formation. Importantly, this
association between EGF receptor and c-Src has also been described in a
number of human breast cancer cell lines (13). A panel of 14 human breast tumor cell lines was characterized with regard to the presence or absence of the estrogen receptor, the levels of EGFR and c-Src, and
the presence or absence of EGFR/c-Src complexes. Five of the 14 cell
lines were found to overexpress both the EGF receptor and c-Src, and
such co-overexpression correlated with an association between these two
proteins and phosphorylation of the EGFR on the same two novel sites as
was found in the mouse fibroblast system. These findings suggested a
mechanistic cooperation between the two tyrosine kinases. In fact, as
compared with breast tumor cell lines expressing normal levels of
either protein, the EGFR/c-Src double overexpressors generally
exhibited increased EGF-stimulated mitogen-activated protein kinase
activity and formation of aggressive tumors in nude mice.
The mechanisms responsible for the cooperativity between the EGFR and
c-Src tyrosine kinases that lead to tumorigenesis are beginning to be
elucidated. The two novel tyrosine phosphorylations on the EGFR that
are dependent upon c-Src have been identified as Tyr845 and
Tyr1101 (15). Tyr1101 on the EGFR, which itself
is not an autophosphorylation site, is located in the C-terminal tail
of the EGFR among the known autophosphorylation sites. The function of
Tyr1101 is unknown. Tyr845 is located on the
activation loop of the catalytic domain. In other tyrosine kinase
receptors, such as platelet-derived growth factor,
colony-stimulating factor, insulin, hepatocyte growth factor, and
fibroblast growth factor, the homologous site is an autophosphorylation
site required for full activity of the enzyme (12). However,
EGF-stimulated phosphorylation of Tyr845 is dependent on
the kinase activity of c-Src (16). Furthermore, the kinase activity of
c-Src is required for the biological synergy between c-Src and the EGFR
that results in increased mitogenesis, growth in soft agar, and tumor
formation. Most importantly, mutation of Tyr845 to
phenylalanine ablates EGF-induced increases in DNA synthesis. This
ablation occurs despite the presence of intact EGFR kinase activity,
increases in Shc tyrosine phosphorylation, and activation of
mitogen-activated protein kinase (15, 16). This finding suggests that
other, as yet unidentified, biochemical signaling pathways that are
activated by the c-Src mediated phosphorylation of Tyr845
of the EGFR must be operative in triggering cell proliferation and tumorigenesis.
The signal transducers and activators of transcription (STATs),
originally identified in interferon signaling, can be activated by a
number of cytokines and growth factors, including EGF (17, 18).
Activation of STATs involves phosphorylation of a single tyrosine at
the C terminus, hetero- or homodimerization, and translocation to the
nucleus, where STATs bind to consensus elements in the promoter of
genes that are regulated (19, 20). STAT proteins are normally involved
in a variety of cellular processes including mitogenesis,
differentiation, and apoptosis (21), but accumulating evidence supports
a role for STAT proteins in oncogenesis. STAT1, -3, and -5 are all
activated in cells transformed by the v-Src oncogene (22-24),
and studies have demonstrated that STAT3 is required for
v-Src-induced transformation (25, 26). Our previous studies have
shown that the stable overexpression of the EGFR in 293HEK cells leads
to the EGF-induced tyrosine phosphorylation, DNA binding, and
transcriptional activation of STAT5b (27). Given the precedence for the
role of STAT proteins in oncogenesis, we have investigated the
potential role of these transcription factors in the signaling pathways
activated by EGFR and c-Src co-overexpression in the C3H10T1/2 mouse
fibroblast model and in human breast tumor cell lines. Here, we
demonstrate that overexpression of the EGFR, the kinase activities of
the EGFR and c-Src, and the c-Src-mediated phosphorylation of
Tyr845 of the EGFR are required for EGF-induced STAT5b
activation in breast cancer cell models. Finally, evidence is provided
that STAT5b is required for EGF-induced DNA synthesis. Together, these studies support the potentially important role of STAT5b in the process
of tumorigenesis.
 |
EXPERIMENTAL PROCEDURES |
Cell Lines--
C3H10T1/2 mouse fibroblast cell lines,
engineered to stably overexpress the human EGFR, wild type c-Src
(K+), or kinase-inactive (A430V) c-Src (K
),
have been described previously (14, 16). These cells were grown under
selection in Dulbecco's modified Eagle's medium containing 10% fetal
calf serum and 400 µg/ml G418. Mouse embryonic fibroblasts (MEFs)
from STAT5a/5b knockout mice were kindly provided by Dr. J. Ihle (St.
Jude Children's Research Hospital, Memphis, TN) (28). These cells were
grown in Dulbecco's modified Eagle's medium plus 10% fetal calf
serum. Human breast cancer cell lines (MDA-MB468, MDA-MB231, MCF-7,
SK-BR-3, BT-20, and BT-549) were obtained from ATCC (Manassas, VA).
Cells were passaged twice per week and maintained in Dulbecco's
modified Eagle's medium plus 10% fetal calf serum.
Reagents--
Recombinant human growth hormone was from
Genentech (San Francisco, CA); recombinant human EGF was from
Invitrogen; and the c-Src inhibitor, PP2, was from Calbiochem.
Monoclonal anti-phosphotyrosine antibody (sc-7020) and polyclonal
anti-EGFR (sc-03) were from Santa Cruz Biotechnology, Inc. (Santa Cruz,
CA). Anti-phospho-STAT5A/B (Tyr694/Tyr699) is a mouse monoclonal
from Upstate biotechnology (Lake Placid, NY). Monoclonal anti-HA
antibody (16B12) was purchased from Babco (Richmond, CA). Polyclonal
STAT5a- and STAT5b-specific antibodies were developed in our laboratory
(29). Construction of the tyrosine mutants of human STAT5b has been
described previously (27). Prestained molecular weight standards as
well as all tissue culture reagents were from Invitrogen. Except where
noted, other reagents were either reagent or molecular biological grade
from Sigma.
Preparation of Protein Lysates--
Cells were preincubated in
Dulbecco's modified Eagle's medium containing 0.1% bovine serum
albumin overnight. In some experiments, cells were pretreated for 15 min at 37 °C with 10 µM PP2. After preincubation,
cells were treated either with medium alone (control), 200 ng/ml
recombinant human growth hormone, or 100 ng/ml rhEGF at 37 °C for 15 min. At the end of this incubation, cells were washed once in
phosphate-buffered saline containing 0.4 mM sodium orthovanadate (PBS-VO4), scraped into 2 ml of
PBS-VO4, and then pelleted by centrifugation. Cell pellets
were lysed in radioimmune precipitation buffer (150 mM
NaCl, 5 mM EDTA, 1% Triton X-100, 1% deoxycholate, 50 mM Tris, pH 7.4). All lysis buffers contained protease and
phosphatase inhibitors (25 µg/ml leupeptin, 0.071 trypsin inhibitory
units/ml aprotinin, 1 mM vanadate, 200 µM phenylmethylsulfonyl fluoride). Lysates were stored at
70 °C until use. Upon thawing, lysates were subjected to
ultracentrifugation (82,000 × g, 30 min, 4 °C), and
resulting supernatants were analyzed as described below. The protein
amount was determined using the BCATM protein assay from Pierce.
Western Blotting and Immunoprecipitation--
For
immunoprecipitation, 500 µg of protein lysate was incubated with
antibody overnight at 4 °C. Protein A-agarose or protein G-Plus
agarose (Santa Cruz Biotechnology) was added for an additional 1 h
at 4 °C. Agarose pellets were washed three times in radioimmune precipitation buffer, and bound proteins were removed by heating to
100 °C in 1× Laemmli buffer (30). For direct analysis of extracts,
detergent lysates, prepared as described above, were mixed 1:1 with 2×
Laemmli buffer. Both total lysates and immunoprecipitates were
fractionated through a 7.5% polyacrylamide gel, electrophoretically transferred to nitrocellulose, and blotted as described previously (31). Blocking buffers contained TBS-T (0.15 M NaCl, 0.1%
Tween 20, 50 mM Tris, pH 8.0) and either 3% bovine serum
albumin for the anti-phosphotyrosine antibody or 5% nonfat dry milk
for all other antibodies. Donkey anti-rabbit or sheep anti-mouse
antibodies conjugated to horseradish peroxidase were used as
secondary antibodies and detected by ECLTM (Amersham Biosciences). In
some cases, blots were reprobed after stripping in buffer (2% SDS, 0.1 M 2-mercaptoethanol, 62.5 mM Tris, pH 6.8) at
70 °C for 80 min.
Transient Transfection and Luciferase Assays--
C3H10T1/2
mouse fibroblasts were transfected according to the manufacturer's
protocol with Effectene ReagentTM from Qiagen (Valencia, CA) and a
reporter plasmid containing the lactogenic hormone response region
linked to firefly luciferase (LHRR-luciferase) as well as a plasmid
encoding Renilla luciferase under the control of the
thymidine kinase promoter commercially available from Promega Biotech
and kindly provided by Dr. Theodorescu (Department of Urology,
University of Virginia). The LHRR contains two copies of the STAT5
consensus sequence from the bovine
-casein gene (AGATTTCTAGGAATTCAAATC) as described (32). Renilla
luciferase expression was used as a normalization control for
transfection. Transfected cells (5 × 104/well) were
plated in 96-well plates and treated for 24 h with control (serum
free) medium or 100 ng/ml rhEGF. Lysates were prepared by means
of a Dual-Luciferase® reporter assay system from Promega (Madison,
WI), and firefly and Renilla luciferases were measured sequentially from each sample using a Packard Topcount. Firefly luciferase values were normalized to Renilla luciferase
values in each cell sample.
The pcDNA3 expression vectors (Invitrogen) for wild type
(WT) and the mutant Y845F EGFR have been described previously
(15, 16). The kinase-defective EGFR, which contains a lysine to alanine mutation in the ATP binding site (K721A) was a gift from L. Beguinot (Laboratory of Molecular Oncology, Milan, Italy). A vector containing a
cytomegalovirus promoter and the hemagglutinin (HA) epitope upstream of
a unique NotI site was used to construct the HA-tagged STAT5b expression vector as previously described (29). MCF-7 cells were
transfected with LipofectAMINE Plus (Invitrogen) and either WT, Y845F,
or K721A EGFR expression plasmid plus the expression vector for
HA-tagged STAT5b. After 36 h in serum-free medium, cells were
treated for 15 min with either medium alone or 100 ng/ml rhEGF.
Lysates were prepared, and anti-HA immunoprecipitates were analyzed as
described above. Alternatively, MCF-7 cells were transfected with EGFR
expression plasmids plus the LHRR-luciferase reporter plasmid
(described above). After overnight incubation in serum-containing
medium, cells were treated for 24 h in serum-free media
without or with 100 ng/ml EGF. Cells were lysed (as above), and
luciferase activity was determined using a Berthold single tube
luminometer. Replicates of three were done for each treatment group,
and values were normalized per microgram of protein.
MEFs from STAT5a/5b knockout mice were also transfected using
LipofectAMINE Plus (as above). Plasmids encoding WT EGFR, STAT5b constructs, and, in some experiments, kinase active (K+) or
kinase defective (K
) c-Src were transiently transfected
into MEF cells. After 48 h, cells were treated for 15 min with
medium alone (control) or 100 ng/ml EGF. Detergent lysates were
prepared as described above. Exogeneously expressed STAT5b protein was
immunoprecipitated from the lysates using our anti-STAT5b antibody.
DNA Synthesis Assay--
Dominant negative HA-tagged STAT5b was
engineered by inserting a stop codon at amino acid 748 of the WT STAT5b
expression plasmid, resulting in a 39-amino acid C-terminal truncation
in the transactivation domain of STAT5b (29). C-terminally truncated forms of STAT5b have been shown to inhibit transcriptional activation by WT STAT5b (29, 33). HA-tagged forms of WT STAT5b or dominant negative STAT5b were transfected into K+c-Src cells using
Effectene (Qiagen, Valencia, CA) or into SKBR3 cells using FUGENE 6 (Roche Molecular Biochemicals), according to the manufacturer's
directions. Cells were incubated in a humidified, 37 °C, 5%
CO2 plus 95% air environment for 24 h and then
serum-starved for 30 h prior to the addition of 100 µM 5-bromodeoxyuridine (BrdUrd) and 100 ng/ml EGF
treatment for an additional 18-20 h. Following fixation in 4%
paraformaldehyde, cells were incubated with the hemagglutinin-specific
antibody (16B12) and Texas Red-conjugated goat anti-mouse secondary
antibody (Jackson Immunoresearch). Cells were then treated with 2 N HCl for 1 h at 37 °C and incubated with a
fluorescein-conjugated monoclonal antibody directed against BrdUrd
(Roche Molecular Biochemicals). Alternatively, fluorescein-conjugated anti-HA antibody (Roche Molecular Biochemicals) and anti-BrdUrd-Alexa fluoro 594 (Molecular Probes, Inc., Eugene, OR) were used for detection
in the experiments with the SKBR3 cell line. Expression of the
HA-tagged STAT5b and BrdUrd incorporation into DNA were visualized and
scored using a Zeiss Axiovert 135TV inverted fluorescence microscope.
 |
RESULTS |
EGF-induced Activation of STAT5b in Human Breast Tumor Cell
Lines--
Six human breast cancer cell lines that were characterized
previously for expression level and the association between the EGFR
and c-Src tyrosine kinases were analyzed for EGF-induced STAT5b
tyrosine phosphorylation. As shown in Fig.
1A, all six of the cell lines
overexpress c-Src tyrosine kinase at levels between 3- and 19-fold
above that found in nontumorigenic human mammary cell lines.
Furthermore, all lines except the MCF-7 express detectable levels of
the EGFR (Fig. 1A). MDA-MB468, SK-BR-3, and BT-20 cells
express high levels of the EGFR, whereas MDA-MB231 and BT-549 cells
express slightly less. However, in all five of these lines, an
EGF-induced association between the EGFR and c-Src has been
demonstrated (13). To investigate EGF-induced STAT5b tyrosine
phosphorylation in these cells, STAT5b immunoprecipitates were
immunoblotted with anti-phosphotyrosine and anti-STAT5b antibodies (Fig. 1B). In the five cell lines in which the EGFR is
overexpressed, EGF treatment resulted in the tyrosine phosphorylation
of STAT5b. Even in BT-20 cells where STAT5b protein was barely
detectable by Western blotting (Fig. 1B, bottom
panel), EGF-induced STAT5b tyrosine phosphorylation was
readily observed (Fig. 1B, top panel). In contrast, although STAT5b protein was clearly detectable in MCF-7
cells, it was not tyrosine-phosphorylated in response to EGF. These
results indicate that, as in other cellular models, EGF activates
STAT5b in EGFR-overexpressing breast cancer cells. Furthermore,
overexpression of c-Src in the absence of EGFR overexpression (as in
MCF-7 cells) is not sufficient for EGF-induced tyrosine phosphorylation
of STAT5b. In Fig. 1C, Western blot analysis with the
commercially available
anti-phospho-STAT5a/5b(Tyr694/Tyr699) confirms
the results seen in Fig. 1B and demonstrates that EGF induces the phosphorylation of STAT5b at Tyr699 in this
panel of cell lines.

View larger version (46K):
[in this window]
[in a new window]
|
Fig. 1.
STAT5b activation in human breast cancer cell
lines. Each human breast tumor cell line (labeled above
each panel) was treated with serum-free medium ( )
or 100 ng/ml rhEGF (+) for 15 min at 37 °C. A, whole cell
lysates were prepared and analyzed by Western blotting with anti-EGFR
antibody. Relative -fold level of c-Src overexpression (compared with
normal breast epithelial cells) is indicated at the bottom
(from Biscardi et al. (13)). B, lysates were
immunoprecipitated with anti-STAT5b antibody and immunoblotted
(IB) with anti-phosphotyrosine (top
panel) or anti-STAT5b (bottom panel).
These results are representative of five independent experiments.
C, whole cell lysates were analyzed by immunoblotting with
anti-phospho-STAT5a/5b(Tyr694/Tyr699) antibody.
These results are representative of four independent experiments.
|
|
STAT5b Activation Requires EGFR Kinase Activity and
Tyr845 of the EGFR--
Studies in other cell systems have
shown that the activation of STAT1, STAT3, and STAT5 by EGF requires
the kinase activity of the EGF receptor (19, 34, 35). In addition,
studies by Biscardi et al. (15, 16) have demonstrated that
co-overexpression and association of the EGFR and c-Src tyrosine kinase
leads to the c-Src-mediated phosphorylation of Tyr845 on
the EGFR. Thus, we investigated the role of the kinase activity and
Tyr845 of the EGFR in the EGF-induced activation of STAT5b
in the breast tumor model. MCF-7 cells were transiently transfected
with plasmids encoding HA-tagged STAT5b and either wild type EGFR, a
K721A mutation that renders the EGFR kinase inactive, or an Y845F
mutant of the EGFR. Transfection of empty vector (pcDNA3.1) does
not result in an EGF-induced tyrosine phosphorylation of STAT5b (Fig.
2A), supporting the results of
Fig. 1 (MCF-7 cells). However, the exogenous expression of the WT EGFR
in MCF-7 cells results in an EGF-induced increase in STAT5b tyrosine
phosphorylation. In contrast, cells expressing the K721A EGFR were
incapable of EGF-induced STAT5b tyrosine phosphorylation. Both forms of
the EGFR were expressed similarly (Fig. 2A,
inset), although K721A had a significantly decreased level
of tyrosine phosphorylation (that remaining was probably due to
heterodimerization with endogenous EGFR). The results shown in Fig.
2A demonstrate that overexpression of the EGFR as well as
its kinase activity is required for EGF-induced activation of STAT5b in
MCF-7 breast tumor cells. Using the same model, either the WT EGFR or
the Y845F mutant were transiently transfected into MCF-7 cells along
with HA-tagged STAT5b. Whereas expression of the WT EGFR resulted in
EGF-induced STAT5b tyrosine phosphorylation, transfection of the same
amount of the Y845F mutant plasmid resulted in little, if any,
EGF-induced STAT5b tyrosine phosphorylation (Fig. 2B). Thus,
both the EGFR kinase activity, as well as tyrosine 845 of the EGFR, is
required for the EGF-induced tyrosine phosphorylation of STAT5b.

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 2.
The role of EGFR tyrosine kinase
and Tyr845 in STAT5b activation. A, MCF-7
cells were transiently transfected with 4 µg of plasmid encoding
HA-tagged STAT5b and 0.025 µg of the plasmids encoding wild type
EGFR, K721A kinase-inactive EGFR, or 0.025 µg of empty plasmid
(pcDNA3.1). After 48 h, cells were treated for 15 min with
serum-free medium (Cont) or 100 ng/ml EGF. Lysates
were prepared, and anti-HA immunoprecipitates were analyzed by Western
blotting with anti-phosphotyrosine (pTyr) antibody
(top panels) or anti-STAT5b antibody
(bottom panels). Results are representative of
five individual experiments. Inset, in a parallel
transfection, 4 µg of plasmid encoding either wild type or K721A EGFR
demonstrated equal expression of the EGFR forms (bottom
panels) and, as expected, a decrease in EGFR tyrosine
phosphorylation in the case of the kinase-defective (K721A) EGFR.
B, MCF-7 cells were transiently transfected with 4 µg of
plasmid encoding HA-tagged STAT5b and 0.025 µg of the plasmids
encoding wild type EGFR or the Y845F mutation of the EGFR. After
48 h, cells were treated for 15 min with serum-free medium
(Cont) or 100 ng/ml EGF. Lysates were prepared, and anti-HA
immunoprecipitates were analyzed by Western blotting with
anti-phosphotyrosine antibody (top panels) or
anti-STAT5b antibody (bottom panels).
Densitometric analysis of five individual experiments showed that the
Tyr(P)/STAT5b ratio for STAT5b tyrosine phosphorylation was 4.15 ± 0.54-fold above nonstimulated levels in cells expressing wild type
EGFR but only 0.89 ± 0.31 for cells expressing the Y845F EGFR.
Inset, in a parallel transfection, 4 µg of plasmid
encoding either wild type or Y845F EGFR demonstrated equal EGFR
expression (bottom panels) and EGFR tyrosine
phosphorylation (top panels). C, MCF-7
cells were transiently transfected with 0.025 µg of plasmid encoding
either the wild type (wt) EGFR, kinase-defective EGFR
(K721A), or Y845F mutation of the EGFR plus the LHRR-luciferase
reporter plasmid. Cells were treated with serum-free medium alone
(Cont) or 100 ng/ml EGF for 24 h. Cells were lysed, and
luciferase values were normalized to micrograms of protein/sample.
Shown is the mean -fold induction ± S.E. from three independent
experiments in triplicate per treatment group. Values for -fold
induction ± S.E. per group are as follows: WT EGFR, control
(1 ± 0.05) and EGF (3.05 ± 0.05); Y845F, control (0.70 ± 0.08) and EGF (0.98 ± 0.04); K721A, control (0.17 ± 0.03) and EGF (0.16 ± 0.09).
|
|
To investigate the effect of the EGFR on the transcriptional activity
of STAT5b, MCF-7 cells were transiently transfected with HA-STAT5b, WT
EGFR, K721A, or Y845F and the STAT5 response element (LHRR-luciferase).
Fig. 2C demonstrates that expression of WT EGFR results in a
~3-fold increase in LHRR-luciferase by EGF (see legend to Fig. 2).
This activation is completely ablated when the kinase-defective EGFR
(K721A) or the tyrosine mutant of the EGFR (Y845F) are transfected,
thus demonstrating that both the kinase activity and tyrosine 845 are
required for EGF-induced transcriptional activation of STAT5b.
STAT Activation in the C3H10T1/2 Mouse Fibroblast Model
System--
To further investigate the mechanism of EGF-induced
activation of STAT5b, mouse C3H10T1/2 cell lines that stably
overexpress the EGFR (NeoR) or wild type c-Src (K+c-Src)
were used (14). To compare STAT5b activation by EGF with that of a
known activator of STAT5b signaling in fibroblasts, these cells were
treated with EGF as well as with growth hormone (GH). Immunoblots of
STAT5b immunoprecipitates from Neo, NeoR, and K+c-Src cells
demonstrate that STAT5b is tyrosine-phosphorylated in response to the
cytokine GH in all three cell types, regardless of EGFR or c-Src levels
(Fig. 3A). In contrast, EGF
was able to activate STAT5b only in the cell line that overexpresses
the EGFR (NeoR), confirming results in the breast cancer panel (Fig.
1). Importantly, Fig. 3A also demonstrates that increased
levels of c-Src alone do not result in EGF activation of STAT5b
(K+c-Src). However, as shown in Fig. 3B,
overexpression of kinase active c-Src plus the EGFR
(K+c-Src/R) (16) resulted not only in an increase in basal
levels of STAT5b tyrosine phosphorylation but also a reproducible
increase in EGF-induced tyrosine phosphorylation of STAT5b (as compared with the NeoR cells overexpressing EGFR alone). In contrast,
overexpression of catalytically inactive c-Src along with the EGFR
(K
c-Src/R) led to a reduction in the level of EGF-induced
STAT5b tyrosine phosphorylation. The results of this and three
additional experiments were quantified by densitometry (taking into
account levels of STAT5b protein in the immunoprecipitates) and
depicted graphically in Fig. 3C. The Tyr(P)/STAT5b
ratios were as follows: NeoR (1.03 ± 0.10), K+c-Src/R
(1.94 ± 0.21), and K
c-Src/R (1.27 ± 0.11).
Similar results were obtained when cells were stimulated with EGF for
5, 30, and 60 min (data not shown). These data suggest that c-Src
kinase activity can regulate EGF-induced tyrosine phosphorylation of
STAT5b but is not required for it.

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 3.
STAT activation in 10T1/2 mouse
fibroblasts. A, Neo, NeoR, and K+c-Src
cells were treated for 15 min with serum-free medium (control),
200 ng/ml recombinant human GH, or 100 ng/ml rhEGF (EGF).
Detergent lysates were prepared and incubated with a STAT5b-specific
antibody. Immunoprecipitated proteins were separated by polyacrylamide
gel electrophoresis and transferred to nitrocellulose. Duplicate
filters were probed with anti-phosphotyrosine antibody (top
panels) or anti-STAT5b antibody (bottom
panels). These results are representative of four
independent experiments for STAT5b. B, NeoR cells that
overexpress the EGFR and EGFR-overexpressing cells that also
co-overexpress either the kinase-active c-Src (K+c-Src/R)
or kinase-defective c-Src (K c-Src/R) were treated for 15 min at 37 °C with serum-free medium (Cont) or 100 ng/ml rhEGF. Lysates were prepared and incubated with anti-STAT5b
antibody. Immunoprecipitates (Immunoppt) were analyzed as
described above. C, densitometric analysis of Tyr(P)
(pTyr) and protein levels of STAT5b from B and
two additional experiments was carried out, and the Tyr(P)/STAT5b
ratios were determined for each cell line. The mean ± S.E. ratio
from NeoR cells was arbitrarily set at 1, and the ratios from
K+c-Src/R and K c-Src/R cells were determined
relative to 1. The Tyr(P)/STAT5b ratios in EGF-treated were as follows:
NeoR (1.03 ± 0.10); K+c-Src/R (1.94 ± 0.21);
and K c-Src/R (1.27 ± 0.11). D, cells
were transfected with plasmids encoding LHRR-luciferase (firefly) and
thymidine kinase-luciferase (Renilla), seeded in 96-well
plates, and incubated with serum-free medium alone (Cont) or
with 100 ng/ml EGF for 24 h. Cells were lysed, and firefly
luciferase values were normalized to Renilla luciferase
values in each treatment group. Shown is the mean -fold
induction ± S.E. from four separate experiments, each performed
in quadruplicate per treatment group. -Fold EGF-stimulated values over
control are as follows: NeoR (4.6 ± 2.7); K+c-Src/R
(11.7 ± 3.7); and K c-Src/R (1.6 ± 0.5).
|
|
The role of c-Src in the transcriptional activity of STAT5b was
investigated by using the LHRR-luciferase reporter plasmid in the
C3H10T1/2 cells. Fig. 3D demonstrates that EGF treatment results in an ~5-fold increase in LHRR-luciferase activity over the
unstimulated levels in NeoR cells and an ~12-fold increase in
K+c-Src/R cells. In contrast, EGF treatment results in less
than 2-fold increase in the K
c-Src/R cells. Thus, the LHRR-luciferase data demonstrate a dramatic effect of c-Src activity on the EGF-induced transcriptional activation of STAT5b. Together, the results of Fig. 3
demonstrate that c-Src influences not only the tyrosine phosphorylation
of STAT5b but, more dramatically, the transcriptional activation of
STAT5b in response to EGF.
Role of c-Src and EGFR Kinases in EGF-induced Tyrosine
Phosphorylation--
The disparity between the level of EGF-induced
tyrosine phosphorylation of STAT5b and its transcriptional activity in
cells expressing kinase-defective c-Src (Fig. 3) suggests that there may be tyrosine phosphorylation sites on STAT5b that are insensitive to
c-Src kinase activity. We have recently identified three EGF-induced tyrosine phosphorylation sites in the C-terminal transactivation domain
of STAT5b (Tyr725, Tyr740, and
Tyr743), and these tyrosines apparently exert a negative
regulatory role in STAT5b transcriptional activation (27). We sought to determine the relative contribution of these three sites as well as the
well described site of cytokine-induced phosphorylation (Tyr699) in model systems overexpressing the EGFR and c-Src
tyrosine kinases. Tyrosine mutants of STAT5b along with the EGFR were
transiently transfected into MEFs from STAT5a/5b knockout mice, and
lysates from control and EGF-treated cells were isolated.
Immunoblotting of STAT5b immunoprecipitates demonstrates that the
STAT5b protein, wild type, or tyrosine mutants are expressed (Fig.
4A, lower
panels). Anti-phosphotyrosine blotting (Fig. 4A,
top panels) demonstrates that mutation of
tyrosine 699 of STAT5b alone (Y699F) does not eliminate EGF-induced
tyrosine phosphorylation. However, when tyrosines 725, 740, and 743 are
mutated in addition to tyrosine 699, no EGF-induced tyrosine
phosphorylation is observed, demonstrating that these four sites
account for all of the detectable EGF-induced tyrosine phosphorylation
of STAT5b in the MEF model.

View larger version (46K):
[in this window]
[in a new window]
|
Fig. 4.
Signaling in the MEF model system.
A, MEFs from STAT5a/5b knockout mice were transiently
transfected with the EGF receptor as well as expression vectors for
either wild type STAT5b (wt), the tyrosine 699 mutant
(Y699F), or the mutant of the other three identified tyrosine
phosphorylation sites (tyrosines 725/740/743). Forty-eight hours after
transfection, cells were treated for 15 min either with medium
alone (Con) or 100 ng/ml EGF. Anti-STAT5b immunoprecipitates
were analyzed by immunoblotting with either anti-phosphotyrosine
( -pTyr) or -STAT5b. B, MEFs were
transiently transfected with WT STAT5b and either WT EGFR, the Y845F
mutant of the EGFR, or the kinase-defective K721A EGFR. Cells were
treated with EGF (100 ng/ml) or not (Con), and STAT5b
immunoprecipitates were analyzed by immunoblotting with
anti-phosphotyrosine or anti-STAT5b antibody. Analysis of three
independent experiments resulted in an EGF-induced increase in STAT5b
tyrosine phosphorylation of 26.9 ± 8.1-fold for WT EGFR and
8.9 ± 4.6-fold for the Y845F form of the EGFR. No tyrosine signal
was detectable with the K721A EGFR.
|
|
We next sought to determine whether the kinase activity and
Tyr845 of the EGFR were required for EGF-induced tyrosine
phosphorylation of STAT5b in the MEF system, as previously seen in
MCF-7 cells (Fig. 2). Fig. 4B demonstrates that whereas
transient transfection of the WT EGFR results in an EGF-induced
tyrosine phosphorylation of WT STAT5b in MEF cells, the kinase
defective EGFR (K721A) does not. Finally, although transfection of the
Y845F mutant results in a detectable level of EGF-induced tyrosine
phosphorylation, it is at least 3-fold lower than that seen with the WT
EGFR. This decrease is not as dramatic as that seen with the Y845F EGFR
in the MCF-7 model system (Fig. 2); however, this result clearly demonstrates the importance of Tyr845 in signaling to STAT5b.
The Role of c-Src in the Phosphorylation of the Novel Tyrosine
Sites--
Thus, using the MEF transfection system characterized in
Fig. 4, we investigated the role of the c-Src tyrosine kinase in EGF-induced tyrosine phosphorylations of STAT5b. Specifically, we
sought to determine whether
Tyr725/Tyr740/Tyr743 contributed to
the EGF-induced phosphorylation detected in the absence of c-Src kinase
activity (seen in Fig. 3B, K-c-Src/R). MEF cells
were transiently transfected with plasmids encoding EGFR plus the
various STAT5b mutants and then either pretreated or not with the c-Src
inhibitor PP2 before treatment with EGF. Fig.
5A demonstrates that
pretreatment with PP2 results in a decreased basal and EGF-induced
tyrosine phosphorylation of WT STAT5b. When Tyr699 is
mutated (Fig. 5B), there is not as dramatic a decrease in the EGF-induced tyrosine phosphorylation (with some still remaining), indicating that the three sites of phosphorylation
(Tyr725/Tyr740/Tyr743) are not
completely inhibited upon inhibition of c-Src kinase activity. In
contrast, when Tyr725/Tyr740/Tyr743
are mutated (Fig. 5C), no basal or EGF-induced tyrosine
phosphorylation is detected, indicating that most, if not all, of the
phosphorylation of Tyr699 is dependent on c-Src kinase
activity. Quantitation of four individual experiments is shown in Fig.
5D and supports the conclusion that PP2 has a more dramatic
effect on the EGF-induced phosphorylation of tyrosine 699 compared with
that of tyrosines 725/740/743.

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 5.
The effect of the c-Src inhibitor (PP2) on
STAT5b tyrosine phosphorylation. MEF cells were transiently
transfected with WT EGFR and the His-tagged STAT5b constructs wild type
(wt) (A), Y699F (B), or
Y725F/Y740F/Y743F (C). After 48 h, cells were either
pretreated with 0.5 µM PP2 (+PP2) or not and
then treated with 100 ng/ml EGF or control media
(Con). STAT5b immunoprecipitates were analyzed by Western
blotting with anti-phosphotyrosine or anti-STAT5b. D,
averages from densitometric analysis of four experiments with WT STAT5b
and three experiments with the tyrosine mutant STAT5b are shown. The
values are -fold induction with the control ( PP2) set at 1 for each STAT5b construct: WT STAT5b (EGF, 76.8 ± 65.0;
plus PP2 (Con), 1.65 ± 1.25; plus PP2 EGF, 2.28 ± .72); Y699F (EGF, 100.67 ± 75.64; plus PP2 (Con),
1.04 ± 0.98; EGF, 31.73 ± 30.64); Y725/740/743F (EGF,
5.72 ± 3.30; plus PP2 (Con), 0.63 ± 0.36; EGF,
0.70 ± 0.40).
|
|
To further investigate the effect of c-Src on EGF-induced tyrosine
phosphorylation of STAT5b, a second approach was used. The EGFR, STAT5b
(WT or tyrosine mutants), and c-Src (kinase-active (K+) or
kinase-defective (K
)) were transiently transfected into
MEF cells, and the EGF-induced tyrosine phosphorylation of STAT5b was
analyzed. Fig. 6A shows that
overexpression of K+c-Src, along with WT EGFR and WT
STAT5b, resulted in the constitutive tyrosine phosphorylation of the WT
STAT5b protein. This result supports that seen in Fig. 3B
with K+c-Src/R cells, demonstrating an increase in basal
tyrosine phosphorylation upon wild type c-Src overexpression. In
contrast, when a kinase-defective form of c-Src (K
) is
expressed along with the EGFR and WT STAT5b, no tyrosine phosphorylation (constitutive or EGF-induced) of STAT5b is readily detected. These results confirm that c-Src plays a critical role in
EGF-induced STAT5b tyrosine phosphorylation. Nevertheless, with longer
exposure of the anti-phosphotyrosine blot, one can detect an
EGF-induced tyrosine phosphorylation of WT STAT5b (Fig. 6A,
longer exposure). These results indicate that EGF can induce STAT5b
tyrosine phosphorylation even in the context of kinase-defective c-Src,
but to a greatly reduced extent. To determine which tyrosine(s) was
being phosphorylated on WT STAT5b, the EGF-induced phosphorylation of
the tyrosine site mutants was investigated. Fig. 6B
demonstrates that, as with WT STAT5b, the Y699F mutant can be
tyrosine-phosphorylated in response to EGF even in the presence of
K-c-Src (see longer exposure) but that catalytically active c-Src is
required for full phosphorylation. In Fig. 6C, the
Y725F/Y740F/Y743F mutant was analyzed in the context of K+
or K
c-Src. As seen in Fig. 6, A and
B, overexpression of K+c-Src results in a high
level of constitutive tyrosine phosphorylation of STAT5b. However, the
expression of K-c-Src inhibits the tyrosine phosphorylation of
Y725F/Y740F/Y743F, even upon longer exposure. This result suggests that
any amount of EGF-induced phosphorylation of Tyr699 is
dependent on c-Src kinase activity. Thus, the results of these experiments are consistent with those shown in Fig. 5, demonstrating that c-Src plays a role in regulating the phosphorylation of all of the
described tyrosines in the C terminus of STAT5b (699, 725, 740, and
743) but affects the EGF-induced phosphorylation of Tyr699
to a greater extent than the other three tyrosines. Since
Tyr699 is known to be required for the transcriptional
activation of STAT5b, these results offer an explanation for the
disparate effects of kinase-defective c-Src on STAT5b tyrosine
phosphorylation and transcriptional activation seen in the C3H10T1/2
cell model in Fig. 3.

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 6.
The role of c-Src kinase in STAT5b tyrosine
phosphorylation. MEF cells were transfected with plasmids encoding
EGFR, kinase-active (K+), or kinase inactive
(K ) c-Src, and wild type STAT5b (A), the Y699F
mutant of STAT5b (B); or the triple mutant of STAT5b
(Y725F/Y740F/Y743F) (C). After 48 h, cells were treated
with 100 ng/ml EGF or without (Cont), lysates were prepared,
and STAT5b was immunoprecipitated. Immunoprecipitates were
immunoblotted with anti-Tyr(P) ( -pTyr) or anti-STAT5b.
Initial exposure of the blots after ECL reaction was for less than 1 min, whereas longer exposures were for 5-10 min.
|
|
Requirement of STAT5b for EGF-induced Mitogenesis--
Since
Tyr845 of the EGFR has been shown to be required for
EGF-induced DNA synthesis in the mouse fibroblast model (15, 16) and
the data presented here demonstrate that EGF-induced tyrosine phosphorylation and transcriptional activation of STAT5b is dependent on Tyr845, we next investigated whether STAT5b activation
was required for EGF-induced DNA-synthesis. Thus, K+c-Src
mouse fibroblasts were transiently transfected with either WT or
dominant negative STAT5b, and the EGF-induced incorporation of BrdUrd
into newly synthesized DNA was measured (see "Experimental Procedures"). In addition, we investigated the effect of dnSTAT5b on
GH-induced proliferation, since we had found in Fig. 3 that GH
activates STAT5b in the mouse fibroblast model. As seen in Fig.
7A, EGF increased the
percentage of cells incorporating BrdUrd to 75% in nontransfected
cells, and GH increased incorporation to 68% (from a base line of
40%). Wild type STAT5b did not significantly affect this incorporation
in either case. In contrast, in cells expressing dominant negative
STAT5b, no increase in EGF- or GH-induced BrdUrd incorporation above
basal levels was observed. Thus, dominant negative STAT5b completely
inhibited EGF-induced as well as GH-induced DNA synthesis. Using the
BrdUrd incorporation assay, we also investigated the effect of dominant
negative STAT5b on EGF-induced proliferation in the SKBR3 breast cancer
cell line (Fig. 7B). Although the EGF-induced proliferation
in transfected cells was not as much as that seen in the mouse
fibroblast model (see legend to Fig. 7), transfection of the dominant
negative STAT5b not only inhibited, but actually decreased, EGF-induced
BrdUrd incorporation. Together, these results demonstrate that STAT5b
is required for EGF-induced DNA synthesis in both the mouse fibroblast
and breast cancer cell line model systems.

View larger version (14K):
[in this window]
[in a new window]
|
Fig. 7.
Dominant negative STAT5b decreases
EGF-induced DNA synthesis. K+c-Src (A) or
SKBR3 (B) cells were transiently transfected with plasmids
encoding HA-tagged WT or dominant negative STAT5b and scored for EGF-
and GH-induced BrdUrd incorporation into newly synthesized DNA, as
described under "Experimental Procedures." Results are expressed as
the mean percentage ± S.E. of STAT5b-positive cells that were
positive for BrdUrd incorporation. Controls include transfected cells
that did not express STAT5b and cells incubated in serum-free medium
without EGF. In separate experiments, cells transfected with a green
fluorescent protein-encoding plasmid exhibited nearly identical BrdUrd
incorporation in response to EGF, as did the controls in these
experiments (data not shown). Between 20 and 70 cells were counted for
each treatment group per experiment. In A, results for the
dominant negative STAT5b are from four independent experiments, and for
WT STAT5b results are from three independent experiments. The average
percentages of BrdUrd incorporation ± S.E. are as follows: for
not transfected (NT), control, 40.2 ± 2.4;
EGF, 72.5 ± 2.4; and GH, 68 ± 4.2; for WT STAT5b, control,
31 ± 2; EGF, 64.3 ± 4.8; and GH, 63.6 ± 4.4; for
dnSTAT5b, control, 29.3 ± 3.3; EGF, 27 ± 2.5; and GH,
34 ± 3.2. In B, results are from two independent
experiments, and the average percentages of BrdUrd incorporation ± S.E. are as follows: for not transfected, control, 33.5 ± 4.5, and EGF, 49 ± 4; for WT STAT5b: control, 54.5 ± 4.5, and EGF, 64.5 ± 2.5; and for dnSTAT5b, control, 34.5 ± 1.5, and EGF, 22.5 ± 2.5. Student's t test was
utilized to determine statistical significance between not
transfected- and dnSTAT5b-transfected cells. *,
p < 0.0001; #, p = 0.0018; **,
p = 0.0303.
|
|
 |
DISCUSSION |
Previous studies in both an engineered mouse fibroblast model as
well as in a panel of human breast tumor cell lines have demonstrated
that EGFR and c-Src co-overexpression results in a synergistic increase
in EGF-induced mitogenesis, growth of the cells in soft agar
(transformation), and, most dramatically, in the ability of the cells
to form tumors in vivo (1, 14, 16). Biochemical
characterization demonstrated that simultaneous overexpression of the
EGFR and c-Src tyrosine kinases led to their heterocomplex formation
and the resulting c-Src-dependent phosphorylation of the
EGFR on Tyr845 and Tyr1101 (15). Furthermore,
mutation of Tyr845 (Y845F) resulted in a dominant negative
EGFR, which reduced not only EGF, but also serum- and lysophosphatidic
acid-induced DNA synthesis, although it did not inhibit the tyrosine
kinase activity of the EGFR or the ability of EGF to activate the
mitogen-activated protein kinase pathway (15, 16). In the studies
presented here, we demonstrate in both models not only that STAT5b is
tyrosine-phosphorylated in response to EGF in EGFR-overexpressing cells
but that this tyrosine phosphorylation is dependent, in part, on c-Src
kinase activity and the presence of the c-Src-mediated phosphorylation site on the EGFR, Tyr845 (Fig. 2). Thus, the activation of
STAT5b is an integral signal in the pathway emanating from EGFR and
c-Src overexpression, association, and the c-Src-mediated
phosphorylation of Tyr845. Although the precise role of
tyrosine 845 phosphorylation is not known, it may function directly to
serve as a docking site for STAT5b, or it may act more indirectly to
promote the phosphorylation of another site on the EGFR or even other
signaling molecules in the complex. Since the phosphorylation of
Tyr845 is so labile (15), we propose that it serves an
indirect rather than direct role.
Our results support a mechanistically relevant interaction between
STAT5b and the EGFR that is mediated by c-Src tyrosine kinase activity.
C3H10T1/2 cells stably expressing a kinase-inactive c-Src showed a
decrease in EGF-induced STAT5b tyrosine phosphorylation. However, more
dramatic than the detectable decrease in tyrosine phosphorylation was
the observed decrease in transcriptional activation of STAT5b in cells
expressing kinase-inactive c-Src. These results suggest that the
mechanisms responsible for the effect of c-Src on the EGF-mediated
transcriptional activation of STAT5b are complex. Until recently,
tyrosine phosphorylation of STAT5b was reported to occur on a single
tyrosine residue (tyrosine 699). Tyrosine phosphorylation at this site
has been shown to be induced by cytokine treatment and to result in the
dimerization, translocation of STAT5b to the nucleus, DNA binding, and
transcriptional activation (17). However, our recently published
studies have shown that a Y699F mutant form of STAT5b that is not
tyrosine-phosphorylated in response to cytokine (GH) is
tyrosine-phosphorylated in response to EGF (27). Interestingly, an
EGF-induced, but not prolactin-induced, tyrosine phosphorylation of a
similar mutant of STAT5a (Y694F) has been described, although the sites
have not been identified (37). We have identified three tyrosine
residues in the C-terminal transactivation domain of STAT5b that
contribute to the non-Tyr699 EGF-induced tyrosine
phosphorylation in our model systems. Fig. 4, using STAT5a/5b knockout
MEFs, supports our previous studies in the 293HEK cell model and
demonstrates that tyrosines 725, 740, and 743 contribute to the
EGF-induced tyrosine phosphorylation of STAT5b. Furthermore, this
tyrosine phosphorylation is dependent on the kinase activity as well as
Tyr845 of the EGFR.
Having identified these additional sites of tyrosine phosphorylation,
the potential role of the c-Src tyrosine kinase in the EGF-induced
phosphorylation not only of Tyr699 but also of the newly
identified sites of phosphorylation,
Tyr725/Tyr740/Tyr743, was
investigated. Results of inhibitor studies as well as expression of
dominant negative c-Src indicated that the kinase activity of c-Src is
absolutely required for the EGF-induced tyrosine phosphorylation of
Tyr699. In contrast, c-Src kinase activity is not essential
for the phosphorylation of tyrosines 725/740/743, although it does
either directly or indirectly modulate their phosphorylation (Figs. 5 and 6). We propose that these results could explain the discrepancy between the complete lack of STAT5b transcriptional activity and the
EGF-induced tyrosine phosphorylation in the K
c-Src/R
cells (Fig. 3, B versus D), since the
observed EGF-induced tyrosine phosphorylation may be due to
phosphorylation of the other tyrosine sites (725/740/743). Previous
studies demonstrate that the tyrosine 725/740/743 sites negatively
regulate the transcriptional activation of STAT5b (27). Studies are
currently under way to determine the role of each individual tyrosine
in c-Src mediated, EGF-induced tyrosine phosphorylation of STAT5b,
since a mechanistic understanding of the role of these sites may lead
to the development of novel therapeutics to modulate STAT5b action in
breast tumor cells.
An increasing number of studies support a role for the c-Src tyrosine
kinase in the phosphorylation of STAT5b as well as other STAT proteins.
Olayioye et al. (37) have demonstrated that c-Src kinase
activity is required for the EGF-induced tyrosine phosphorylation of
STAT1, -3, -5a, and -5b in both NIH3T3 cells engineered to overexpress
the EGFR and in A431 cells, which endogenously express high levels of
EGFR. This activation is most sustained for STAT5b and is independent
of the activity of the JAK tyrosine kinases. A role for Src family
members in the tyrosine phosphorylation of STAT5a and STAT5b in a COS
cell transfection model has also been described by Kazansky et
al. (38). In these studies, the c-Src-mediated tyrosine
phosphorylation of STAT5b resulted in the nuclear translocation of
STAT5b, although this STAT5b was unable to activate a well described
STAT5 response element. Our studies provide evidence not only that
c-Src plays an important role in the EGF-induced transcriptional
activation of STAT5b but also that STAT5b tyrosine phosphorylation
occurs through the c-Src-mediated phosphorylation of Tyr845
of the EGFR. Thus, a complex picture of the role of c-Src in STAT
activation is emerging. Not only does c-Src potentially play a direct
role in the phosphorylation of STAT5b, but it also plays an indirect
role in the EGF-induced phosphorylation of STAT5b. Our studies
demonstrate that one such role is through the c-Src-mediated phosphorylation of Tyr845 of the EGFR (Fig. 2).
Furthermore, we now know that the c-Src-mediated phosphorylation of
STAT5b occurs not only at Tyr699 but also at three other
tyrosines 725/740/743 (Figs. 5 and 6).
In addition to our studies with STAT5b, there is now evidence that
STAT3 is activated in both the C3H10T1/2 mouse fibroblast model as well
as the human breast cancer cell lines (39). In their work, Garcia
et al. (39) demonstrate that the c-Src and JAK family
kinases mediate the constitutive activation of STAT3 in EGFR- and
c-Src-overexpressing cells, whereas the EGFR mediates the EGF-induced
STAT3 activation. We also find evidence of the constitutive activation
of STAT5b in the K+c-Src/R fibroblasts (Fig. 2B)
but not in the human breast cancer cell lines (Fig. 1). The role of the
c-Src-mediated phosphorylation of Tyr845 of the EGFR in
STAT3 activation has not yet been addressed. Nevertheless, the already
apparent differences in the role of STATs in the fibroblast versus epithelial cell model or the subtle differences in
STAT3 versus STAT5b signaling are not surprising given that
these signaling molecules could be contributing different functions to
the process of tumorigenesis. Our studies (not shown) in the
EGFR/c-Src-overexpressing cell line, MDA-MB468, demonstrated that, in
addition to STAT5b, STAT1, STAT3, and STAT5a were also
tyrosine-phosphorylated in response to EGF treatment. Together, all of
these studies provide supportive evidence for a potential role of STAT
proteins in both the initiation and the EGF-induced progression of
breast tumorigenesis in models of EGFR and c-Src co-overexpression.
Finally, there is evidence that STAT3 and STAT5b are required for the
basal and EGF-induced proliferation in these model systems. Garcia
et al. (39) showed that the c-Src and JAK kinases are required not only for STAT3 activation but also for growth regulation in human breast cancer cells (39). Furthermore, a dominant negative STAT3 not only inhibited the growth of these cells but also resulted in
cell death (apoptosis). Here, we provide evidence that a dominant negative STAT5b ablates the EGF-induced stimulation of DNA synthesis (Fig. 7). Since previous studies showed that mutation of tyrosine 845 of the EGFR (Y845F) also leads to an inhibition of EGF-induced DNA
synthesis, we propose that STAT5b provides a direct link between the
increased EGF-induced proliferation in EGFR- and c-Src-overexpressing breast cancer cells. Although proliferation is only the first step on
the pathway toward eventual transformation and tumorigenesis, there is
now increasing evidence that STAT proteins are involved in these
processes also. Kazansky et al. (40) have shown that STAT5b
can enhance the v-Src transformation of NIH 3T3 cells, whereas a
dominant negative STAT5b decreases cell growth and transformation of
these cells. Studies with STAT5a knockout mice have shown that these
mice have a delay in the onset of tumor growth factor-
-induced hyperplasia (which occurs through the EGFR) (41). Furthermore, STAT5a+/
mice, expressing a decreased level of STAT5a,
show a significant delay in cancer progression in response to mammary
gland-specific expression of T-antigen (42). Thus, there is an
increasing body of evidence that the STAT proteins (STAT3, -5a, and
-5b) play a crucial role in initiation, transformation, and progression of tumorigenesis. Future studies will be aimed at identifying the
mechanisms involved in this progression, and we propose that STAT5b, as
well as STAT5a and STAT3, will provide good therapeutic targets to
inhibit the process of tumorigenesis.
 |
ACKNOWLEDGEMENTS |
We thank the Parsons-Weber-Parsons research
group for thoughtful comments.
 |
FOOTNOTES |
*
This work was supported by Army Breast Cancer Initiative,
Department of Defense Grant DAMB 17-99-1-9431 (to C. M. S.);
Department of Health and Human Services Grants CA71449 and CA39438 and
Council for Tobacco Research Grant 4621 (to S. J. P.); and Army
Breast Cancer Initiative, Department of Defense, Grant DAMD 17-97-7329 (to J. S. B.). Molecular biology core facilities were supported by
National Institutes of Health Grant P30-HD28934.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
To whom correspondence should be addressed: Box 800578, Health
System, University of Virginia, Charlottesville, VA 22908. Tel.:
434-924-0165; Fax: 434-982-4316; E-mail: cms3e@virginia.edu.
Published, JBC Papers in Press, November 11, 2002, DOI 10.1074/jbc.M207289200
 |
ABBREVIATIONS |
The abbreviations used are:
HER, human epidermal
growth factor receptor;
EGF, epidermal growth factor;
rhEGF, recombinant human EGF;
EGFR, EGF receptor;
STAT, signal transducer and
activator of transcription;
MEF, mouse embryonic fibroblast(s);
GH, growth hormone;
LHRR, lactogenic hormone response region;
HA, hemagglutinin;
BrdUrd, bromodeoxyuridine;
PBS, phosphate-buffered
saline.
 |
REFERENCES |
| 1.
|
Biscardi, J. S.,
Tice, D. A.,
and Parsons, S. J.
(1999)
Adv. Cancer Res.
76,
61-119[Medline]
[Order article via Infotrieve]
|
| 2.
|
Ottenhoff-Kalff, A. E.,
Rijksen, G.,
van Beurden, E. A.,
Hennipman, A.,
Michels, A. A.,
and Staal, G. E.
(1992)
Cancer Res.
52,
4773-4778[Abstract/Free Full Text]
|
| 3.
|
Sainsbury, J.,
Farndon, J.,
Needham, G.,
Malcolm, A.,
and Harris, A.
(1987)
J. Clin. Pathol.
38,
1225-1228[Abstract/Free Full Text]
|
| 4.
|
Toi, M.,
Osaki, A.,
Yamada, H.,
and Toge, T.
(1991)
Eur. J. Cancer
27,
977-980[Medline]
[Order article via Infotrieve]
|
| 5.
|
Harris, J.,
Lippmann, M.,
Veronesi, U.,
and Willett, W.
(1992)
N. Engl. J. Med.
327,
473-480[Medline]
[Order article via Infotrieve]
|
| 6.
|
Battaglia, F.,
Scambia, G.,
Rossi, S.,
Panici, P. B.,
Bellantone, R.,
Polizzi, G.,
Querzoli, P.,
Negrini, R.,
Iacobelli, S.,
and Crucitti, F.
(1988)
Eur. J. Cancer Clin. Oncol.
24,
1685-1690[CrossRef][Medline]
[Order article via Infotrieve]
|
| 7.
|
Luttrell, D. K.,
Lee, A.,
Lansing, T. J.,
Crosby, R. M.,
Jung, K. D.,
Willard, D.,
Luther, M.,
Rodriguez, M.,
Berman, J.,
and Gilmer, T. M.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
83-87[Abstract/Free Full Text]
|
| 8.
|
Muthuswamy, S. K.,
and Muller, W. J.
(1995)
Oncogene
11,
271-279[Medline]
[Order article via Infotrieve]
|
| 9.
|
Luttrell, D. K.,
Luttrell, L. M.,
and Parsons, S. J.
(1988)
Mol. Cell. Biol.
8,
497-501[Abstract/Free Full Text]
|
| 10.
|
Roche, S.,
Koegl, M.,
Barone, M. V.,
Roussel, M. F.,
and Courtneidge, S. A.
(1995)
Mol. Cell. Biol.
15,
1102-1109[Abstract]
|
| 11.
|
Wilson, L. K.,
Luttrell, D. K.,
Parsons, J. T.,
and Parsons, S. J.
(1989)
Mol. Cell. Biol.
9,
1536-1544[Abstract/Free Full Text]
|
| 12.
|
Biscardi, J. S.,
Ishizawar, R. C.,
Silva, C. M.,
and Parsons, S. J.
(2000)
Breast Cancer Res.
2,
203-210[CrossRef][Medline]
[Order article via Infotrieve]
|
| 13.
|
Biscardi, J. S.,
Belsches, A. P.,
and Parsons, S. J.
(1998)
Mol. Carcinog.
21,
261-272[CrossRef][Medline]
[Order article via Infotrieve]
|
| 14.
|
Maa, M.-C.,
Leu, T.-H.,
McCarley, D.,
Schatzman, R.,
and Parsons, S.
(1995)
Proc. Natl. Acad. Sci. U. S. A.
92,
6981-6985[Abstract/Free Full Text]
|
| 15.
|
Biscardi, J. S.,
Maa, M. C.,
Tice, D.,
Cox, M. E.,
Leu, T. H.,
and Parsons, S. J.
(1999)
J. Biol. Chem.
274,
8335-8343[Abstract/Free Full Text]
|
| 16.
|
Tice, D. A.,
Biscardi, J. S.,
Nickles, A. L.,
and Parsons, S. J.
(1999)
Proc. Natl. Acad. Sci. U. S. A.
96,
1415-1420[Abstract/Free Full Text]
|
| 17.
|
Ihle, J.,
Witthuhn, B.,
Quelle, F.,
Yamamoto, K.,
and Silvennoinen, O.
(1995)
Annu. Rev. Immunol.
13,
369-398[CrossRef][Medline]
[Order article via Infotrieve]
|
| 18.
|
Schindler, C.,
and Darnell, J. E.
(1995)
Annu. Rev. Biochem.
64,
621-651[Medline]
[Order article via Infotrieve]
|
| 19.
|
Leaman, D. W.,
Leung, S., Li, X.,
and Stark, G. R.
(1996)
FASEB J.
10,
1578-1588[Abstract]
|
| 20.
|
Liu, K. D.,
Gaffen, S. L.,
and Goldsmith, M. A.
(1998)
Curr. Opin. Immunol.
10,
271-278[CrossRef][Medline]
[Order article via Infotrieve]
|
| 21.
|
Leonard, W. J.,
and O'Shea, J. J.
(1998)
Annu. Rev. Immunol.
16,
293-322[CrossRef][Medline]
[Order article via Infotrieve]
|
| 22.
|
Garcia, R., Yu, C.-L.,
Hudnall, R.,
Catlett, K.,
Nelson, T.,
Fujita, D. J.,
Ethier, S. P.,
and Jove, R.
(1997)
Cell Growth Differ.
8,
1267-1276[Abstract]
|
| 23.
|
Sartor, C. I.,
Dziubinski, M. L., Yu, C. L.,
Jove, R.,
and Ethier, S. P.
(1997)
Cancer Res.
57,
978-987[Abstract/Free Full Text]
|
| 24.
|
Watson, C. J.,
and Miller, W. R.
(1995)
Br. J. Cancer
71,
840-844[Medline]
[Order article via Infotrieve]
|
| 25.
|
Bromberg, J. F.,
Horvath, C. M.,
Besser, D.,
Lathem, W. W.,
and Darnell, J. E.
(1998)
Mol. Cell. Biol.
18,
2553-2558[Abstract/Free Full Text]
|
| 26.
|
Turkson, J.,
Bowman, T.,
Garcia, R.,
Caldenhoven, E.,
DeGroot, R. P.,
and Jove, R.
(1998)
Mol. Cell. Biol.
18,
2545-2552[Abstract/Free Full Text]
|
| 27.
|
Kloth, M. T.,
Catling, A. D.,
and Silva, C. M.
(2002)
J. Biol. Chem.
277,
8693-8701[Abstract/Free Full Text]
|
| 28.
|
Teglund, S.,
McKay, C.,
Schuetz, E.,
Deursen, J. M. v.,
Stravopodis, D.,
Wang, D.,
Brown, M.,
Bodner, S.,
Grosveld, G.,
and Ihle, J. N.
(1998)
Cell
93,
841-850[CrossRef][Medline]
[Order article via Infotrieve]
|
| 29.
|
Silva, C. M.,
Kloth, M. T.,
Kawecki, M. A.,
and Catling, A. D.
(1998)
Proceedings of the 80th Annual Endocrine Society Meeting, June 24-27, New Orleans, LA
, pp. 1-119, The Endocrine Society, Bethesda, MD
|
| 30.
|
Laemmli, U. K.
(1970)
Nature
227,
680-685[CrossRef][Medline]
[Order article via Infotrieve]
|
| 31.
|
Silva, C. M., Lu, H.,
Weber, M. J.,
and Thorner, M. O.
(1994)
J. Biol. Chem.
269,
27532-27539[Abstract/Free Full Text]
|
| 32.
|
Silva, C., Lu, H.,
and Day, R.
(1996)
Mol. Endocrinol.
10,
508-518[Abstract]
|
| 33.
|
Moriggl, R.,
Gouilleux-Gruart, V.,
Jahne, R.,
Berchtold, S.,
Gartmann, C.,
Liu, X.,
Hennighausen, L.,
Sotiropoulos, A.,
Groner, B.,
and Gouilleux, F.
(1996)
Mol. Cell. Biol.
16,
5691-5700[Abstract]
|
| 34.
|
David, M.,
Wong, L.,
Flavell, R.,
Thompson, S. A.,
Wells, A.,
Larner, A. C.,
and Johnson, G. R.
(1996)
J. Biol. Chem.
271,
9185-9188[Abstract/Free Full Text]
|
| 35.
|
Quelle, F. W.,
Thierfelder, W.,
Witthuhn, B. A.,
Tang, B.,
Cohen, S.,
and Ihle, J. N.
(1995)
J. Biol. Chem.
270,
20775-20780[Abstract/Free Full Text]
|
| 36.
|
Fogh, J.,
Fogh, J. M.,
and Orfeo, T.
(1977)
J. Natl. Cancer Inst.
59,
221-226
|
| 37.
|
Olayioye, M. A.,
Beuvink, I.,
Horsch, K.,
Daly, J. M.,
and Hynes, N. E.
(1999)
J. Biol. Chem.
274,
17209-17218[Abstract/Free Full Text]
|
| 38.
|
Kazansky, A. V.,
Kabotyanski, E. B.,
Wyszomierski, S. L.,
Mancini, M. A.,
and Rosen, J. M.
(1999)
J. Biol. Chem.
274,
22484-22492[Abstract/Free Full Text]
|
| 39.
|
Garcia, R.,
Bowman, T. L.,
Niu, G., Yu, H.,
Minton, S.,
Muro-Cacho, C. A.,
Cox, C. E.,
Falcone, R.,
Fairclough, R.,
Parsons, S.,
Laudano, A.,
Gazit, A.,
Levitzki, A.,
Kraker, A.,
and Jove, R.
(2001)
Oncogene
20,
2499-2513[CrossRef][Medline]
[Order article via Infotrieve]
|
| 40.
|
Kazansky, A. V.,
and Rosen, J. M.
(2001)
Cell Growth Differ.
12,
1-7 |