![]()
|
|
||||||||
J. Biol. Chem., Vol. 278, Issue 3, 1721-1727, January 17, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the
Received for publication, August 21, 2002, and in revised form, November 6, 2002
Angiopoietin-1 (Ang-1) and angiopoietin-2 (Ang-2)
have been identified as ligands with different effector functions of
the vascular assembly and maturation-mediating receptor tyrosine kinase Tie-2. To understand the molecular interactions of the angiopoietins with their receptor, we have studied the binding of Ang-1 and Ang-2 to the Tie-2 receptor. Enzyme-linked immunosorbent
assay-based competition assays and co-immunoprecipitation experiments
analyzing the binding of Ang-1 and Ang-2 to truncation mutants of the
extracellular domain of Tie-2 showed that the first Ig-like loop of
Tie-2 in combination with the epidermal growth factor (EGF)-like
repeats (amino acids 1-360) is required for angiopoietin binding. The first Ig-like domain or the EGF-like repeats alone are not capable of
binding Ang-1 and Ang-2. Concomitantly, we made the surprising finding
that Tie-2 exon-2 knockout mice do express a mutated Tie-2 protein that
lacks 104 amino acids of the first Ig-like domain. This mutant Tie-2
receptor is functionally inactive as shown by the lack of ligand
binding and receptor phosphorylation. Collectively, the data show that
the first 104 amino acids of the Tie-2 receptor are essential but not
sufficient for angiopoietin binding. Conversely, the first 360 amino
acids (Ig-like domain plus EGF-like repeats) of the Tie-2 receptor are
necessary and sufficient to bind both Ang-1 and Ang-2, which suggests
that differential receptor binding is not likely to be responsible for
the different functions of Ang-1 and Ang-2.
The first vasculogenic formation of a primitive embryonic vascular
plexus occurs by in situ differentiation of angioblasts. Vasculogenesis is followed by angiogenesis, the sprouting and subsequent remodeling from a pre-existing vasculature. The vasculature in the adult is quiescent with a very low turnover rate of the lining
endothelial cell layer with a physiological proliferative turnover
within months to years (1, 2). However, it can rapidly respond to
angiogenic stimuli supporting a complex morphogenic program that leads
to vascular remodeling and induction of neo-angiogenesis. The balance
between neovessel formation and homeostasis of the resting vasculature
is maintained by a finely tuned balance of proangiogenic and
antiangiogenic mediators. The Tie/angiopoietin receptor ligand system
is critically involved in regulating both processes, maintaining
vascular homeostasis and vessel maturation as well as vascular
destabilization and remodeling (1, 3).
Two members of the Tie-receptor family with strong sequence homology,
Tie-1 and Tie-2, have been identified so far. Both molecules are
preferentially expressed by endothelial cells and were originally isolated as orphan receptors (4). They
are composed of three EGF1 homology repeats flanked by two
Ig-like loops. The second Ig-like loop is followed by a fibronectin
type III domain adjacent to the transmembrane domain. The
intracellular domain contains a split tyrosine kinase domain (Fig.
1).
Four Tie-2 ligands have been identified, Ang-1, Ang-2, Ang-3, and Ang-4
(5-7). Among these, Ang-1 and Ang-2 are characterized in most detail.
Both bind the Tie-2 receptor with similar affinity (5, 6). Ang-1 is
primarily expressed by pericytes, fibroblasts, and smooth muscle cells
(5). Upon Ang-1 binding, Tie-2 becomes autophosphorylated, promoting
endothelial cell migration and survival (5, 8, 9). Ang-1- and
Tie-2-deficient mice have similar phenotypes characterized by embryonic
lethality with severe vascular remodeling defects, insufficient vessel
stabilization, and perturbed vascular maturation (4, 10).
In contrast, Ang-2 is not capable of inducing Tie-2 autophosphorylation
in endothelial cells upon short term treatment (6). Instead, it appears
to act as a natural antagonist of Ang-1, which was inferred from the
observation that Ang-2 transgenic embryos exhibit a phenotype largely
similar to the embryonic lethal phenotype of Ang-1- and Tie-2-deficient
mice (6, 10). Ang-2 is expressed by endothelial cells at sites of
vascular remodeling and apparently acts by destabilizing the contacts
between endothelial cells and surrounding mural cells, most notably
pericytes (6). As such, it acts as a facilitator of vascular
morphogenesis and remodeling, acting proangiogenic in the presence of
angiogenic stimulators, such as VEGF (11), and antiangiogenic
and vessel regression inducing in the absence of proangiogenic
activity, e.g. as occurs physiologically during ovarian
luteal regression (12). The mechanistic basis of the opposing functions
of the angiopoietins is unknown. There are at least three possible
mechanisms: (i) Ang-2 may act as a competitive inhibitor of Ang-1
binding to Tie-2, (ii) Ang-2 may bind to Tie-2 in a subtly different
fashion and induce other downstream signaling pathways with a different
temporal activation pattern, or (iii) Ang-2 may also bind to another
endothelial cell surface receptor and thereby block
Ang-1-dependent Tie-2 signaling indirectly. The complexity
of differential Tie-2 functions is also highlighted by recent
studies, which indicate that Ang-2 does not simply act as an inhibitor
of Ang-1 but that it may also act agonistically by itself as shown by
the following: (i) Ang-2 is capable of stimulating endothelial Tie-2
autophosphorylation upon long term stimulation (i.e. longer
than 12 h; (13)),2 (ii)
Ang-2 induces sprouting of endothelial cells in a three-dimensional spheroidal angiogenesis assay (14), (iii) the phenotype of
Ang-2-deficient mice with defects of blood vascular regression and
lymphatic vessel remodeling cannot exclusively be explained by a model
in which Ang-2 acts as a Tie-2 antagonist (15).
Based on the above observations and considerations, the present study
was aimed at mapping the binding sites of Ang-1 and Ang-2 within the
Tie-2 receptor to elucidate whether differential receptor binding is
involved in regulating agonistic versus antagonistic functions of the angiopoietins. A number of Tie-2 truncation mutants was generated toward this end, and Ang-1 and Ang-2 binding was studied
biochemically as well as in ELISA-based competition assays. Complementary experiments with cells expressing a truncation mutant of
the murine Tie-2 receptor, which lacks parts of the mapped binding site
of Ang-1 and Ang-2 confirmed the amino-terminal binding site in the
Tie-2 receptor. Collectively, the experiments provide evidence that
different angiopoietin ligand binding sites in the Tie-2 receptor are
not involved in regulating agonistic versus antagonistic
functions of the angiopoietins.
Cells--
Immortalized endothelioma cell lines were generated
by infecting primary cells from several litters of embryonic day
9.5 embryos derived from matings of Tie-2+/
CHO cells were cultured in Angiopoietin and Tie-2 Expression Plasmids--
Human Ang-1 and
Ang-2 were cloned by RT-PCR from mRNA isolated from human melanoma
cells (A375) for Ang-1 and human umbilical vein endothelial cells for
Ang-2 using standard protocols. The amino-terminal signal sequences
were replaced by the signal sequence of human IgG1 fused to a
myc tag using the following linker:
AAGCTTGAATTCGTCGACGCCACCATGAACTGGATCTGGCGCATCCTCTTCCTCGTCGGCGCTGCTACCGGCGCTCATTCTGAGGTACAAGCCATGAAGAGCAGCGAACAAAAACTCATCTCAGAAGAGGATCTGTCCATGGTC. The linker with human Ang-1 or human Ang-2 was cloned into pVL1393 by
digesting the vector EcoRI/BamHI. The linker was
digested with EcoRI/NcoI, and the PCR products
were digested with NcoI/BamHI. The resulting
plasmids carry the signal sequence of human IgG1 fused to a
myc tag followed by human Ang-1 from aa Gly-18-Phe-498 (pVL1392/ myc-Ang-1) as well as the signal sequence of
human IgG1 fused to a myc tag followed by human Ang-2
from aa Asn-21-Phe-496 (pVL1392/myc-Ang-2).
Soluble truncated Tie-2-Fc receptors were generated by PCR cloning. The
Tie-2 part of the constructs was generated by PCR using the following
primers: for sTie-2-(1-730)-Fc, f131Tie-2, 5'-ggagagatttcgggaagcatggactctttag-3', and rTie-2Mlu,
5'-acgcgtacaccagttcatgagaaaaggctgggtt-3'; for sTie-2-(1-440)-Fc,
f131Tie-2 and rTie-2-(1-440)Mlu,
5'-ggcacgcgtcaatgttgaagggcttttccaccat-3'; for sTie-2-(1-360)-Fc,
f131Tie-2 and rTie-2-(1-360)Mlu,
5'-ggcacgcgtcttctatatgatctggcaaatccac-3'; for sTie-2-(1-199)-Fc,
f131Tie-2 and rTie-2-(1-199)Mlu,
5'-ggcacgcgtcgaagaggtttcctcctatatacct-3'; for sTie-2-(211-360)-Fc,
fTie-2-(1-211)Eco, 5'-ggcgaattctgtgaagcccagaagtggggacctgaatgc-3' and
rTie-2-(1-360)Mlu; for sTie-2-(211-730)-Fc, fTie-2-(1-211)Eco and
rTie-2Mlu; and for sTie-2-(341-730)-Fc, fTie-2-(1-341)Eco, 5'-ggcgaattcgagagagaaggcataccgaggatgacccca-3' and rTie-2Mlu. The fragments were digested with EcoRI and MluI. The Fc tag
derives from the plasmid hFc(IgG)pUCBM20 and encompasses the CH2
and CH3 domain of human
IgG1.3 MluI- and
PstI-digested plasmids were used for the cloning of the
fusion genes containing the Fc tag. The expression plasmids for
sTie-2-(1-730)-Fc, sTie-2-(1-440)-Fc, sTie-2-(1-360)-Fc, and sTie-2-(1-199)-Fc were generated by ligating the corresponding PCR
fragment together with the Fc tag into the EcoRI and
PstI site of pVL1393 (Pharmingen). The expression plasmids
for sTie-2-(211-360)-Fc, sTie-2-(211-730)-Fc, and
sTie-2-(341-730)-Fc were generated by ligating the corresponding PCR
fragment and the Fc tag into the EcoRI and PstI
site of pAc67-A (Pharmingen).
RT-PCR Cloning of Mutated Tie-2 Sequences--
Total RNA was
isolated from several Tie-2 null and WT mouse endothelioma cell lines
using PeqGold RNAPureTM according to the manufacturer's
recommendations (PeqLab). The Superscript First-strand Synthesis system
(Invitrogen) was used for cDNA synthesis as recommended by the
manufacturer with the primer T2 FN1/2R
(5'-GAGGAGGGAGTCCGATAGAC-3') using 2 µg of total RNA
from Tie-2 WT or Tie-2 mutant endothelioma cell lines, respectively.
PCR was performed using the primers T2 UTR5
(5'-CCATGCGAGCGGGAAGTCGC-3') and T2 FN1R
(5'-ACACACAGCTCGTAGTCAGTCCGC-3'). RT-PCR from RNA of different
independent WT cell lines yielded a band of ~1.6 kb (expected size,
1642 bps), and RT-PCR from RNA of several Tie 2 mutant cell lines
yielded a band of about 1.3 kb. PCR products from RNA of two
independent Tie-2 mutant cell lines were cloned into pCRII using the TA
cloning kit (Invitrogen) yielding pCRII mTie-2 Production of Expression Vectors for Tie-2 WT and Mutant
Proteins--
First, the complete mouse Tie-2 open reading frame
sequence was cloned into pBSII (Stratagene) as a
BglII-partial/BsrGI fragment and then isolated
from the pBSII subclone as a XbaI/Bsp120I fragment, which
was then ligated into XbaI/NotI-digested
pJFE14 (18) (a gift from Regeneron Pharmaceuticals) to create pJFE14
mTie-2. pEF6 mTie-2 was created by releasing the Tie-2 open reading
frame sequence fragment from pJFE14 mTie-2 by digestion with
EcoRI and ClaI and ligation into
EcoRI/BstBI-digested pEF6 (Invitrogen).
To produce pJFE14 mTie-2 Expression and Purification of myc-Ang-1, myc-Ang-2, and the
Truncated sTie-2-Fc Receptors--
The cDNA-containing plasmids
were used for transfection of Sf9 cells along with linearized
wild-type baculovirus DNA. Recombinant baculoviruses were obtained
using the BaculoGoldTM transfection kit following
standard protocols (Pharmingen). For protein production, Sf9
cells grown in serum-free medium at a density of 2 × 106 cells/ml were infected with a multiplicity of infection
of 10.
Myc-tagged Ang-1 and Myc-tagged Ang-2 were purified from Sf9
supernatants 72 h after infection. The supernatants were filtered and bound to Concanavalin A-Sepharose (Amersham Biosciences) (1 ml of Sepharose/100 ml Sf9 supernatant) overnight at 4 °C.
The beads were filled into an empty PD-10 column and washed with 10 column volumes of 25 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.5 mM CaCl2, 0.5 mM MnCl2. The angiopoietins were eluted with 25 mM Tris-HCl, pH 7.5, 150 M NaCl, 0.5 M methyl-
Different truncated sTie-2-Fc molecules were purified from Sf9
supernatants 96 h after infection. Cells were grown in medium without fetal calf serum supplementation. Supernatants were filtered and bound to protein-A-Sepharose CL-6B (Amersham Biosciences) (1 ml of
Sepharose/100 ml Sf9 supernatant) overnight at 4 °C. The
Sepharose beads were filled into an empty PD-10 column. The matrix was
washed with 5 column volumes of high salt buffer (50 mM
Tris-HCl, pH 7.5, 500 mM NaCl) and 5 column volumes of low salt buffer (50 mM Tris-HCl, pH 7.5, 150 mM
NaCl). The protein was eluted with eight column volumes 100 mM sodium citrate, pH 3.0. The elution fractions were
immediately titrated to pH 7.0 by the addition of 1 M Hepes
buffer, pH 9.0. Purified truncated sTie-2-Fc protein was dialyzed
against PBS and filter-sterilized. Individual preparations had a purity
of ~95%.
Transient Transfections and Selection of Stable Clones--
CHO
cells were transfected with the different Tie-2 expression plasmids
using LipofectAMINE 2000 (Invitrogen) according to the manufacturer's
instructions. For selection of a pool of a stably transfected clones,
10 µg/ml Blasticidin S was added to the medium.
Tie-2 Phosphorylation Assay and Western Blot
Analysis--
Experiments were performed as described (6). Briefly,
transfected CHO cells were starved overnight in serum-free medium. Cells were stimulated with 5 µg/ml Myc-Ang-1 or Myc-Ang-2 for 15 min,
after which the cells were lysed and Tie-2 was precipitated using
anti-Tie-2 (clone AB33) (Upstate Biotechnology). Samples were resolved
on a 10% SDS-PAGE. Blotted gels were probed with a P-Tyr antibody
(PY20) (Upstate Biotechnology). The stripped blots were then reprobed
with an anti-Tie-2 antibody (C-20) (Santa Cruz Biotechnology).
Solid Phase Binding Assay--
Myc-Ang-1 or Myc-Ang-2 (2 µg/well) was absorbed to the surface of 96-well plates (Nunc-Immuno
Plate Maxi-Sorb) for 18 h at 4 °C. The plates were washed twice
with TBS, and nonspecific binding was blocked with TBS containing 2%
BSA for 1 h at room temperature. Competition was performed by
adding 30 pmol to 0.3 pmol of the truncated sTie-2-Fc molecules in the
presence of 0.3 pmol of biotinylated full-length sTie-2-Fc in TBS. The
plates were washed after a 2-h incubation, and a streptavidin-alkaline
phosphatase conjugate was added for 1 h. Plates were then washed
three times with TBS and once with alkaline phosphatase buffer, after
which they were developed with 1 mg/ml
p-nitrophenyl-phosphate, and
A405 was determined spectrophotometrically. A
1000-fold excess of full-length sTie-2-Fc was added to determine 100%
competition (quadruplicate determination per plate). Likewise, 100%
binding of biotinylated sTie-2-Fc was determined in the absence of
unlabeled truncated sTie-2-Fc. Unspecific competition by the Fc tag was
controlled by using sVEGF-R2-Fc for competition (sVEGF-R2 was
essentially produced and purified according to the sTie-2-Fc production
protocol). All binding experiments were performed at least twice with
duplicate determinations. Binding curves were plotted as competition
curves based on a one-site competition assumption.
Angiopoietin Pull-down Assay--
Fresh conditioned insect cell
medium (500 µl of supernatant of Sf9 cells expressing either
Myc-Ang-1 of Myc-Ang-2) were incubated with 20 pmol of sTie-2-Fc or 20 pmol of truncated sTie-2-Fc and 30 µl of protein-A-Sepharose in 1 ml
of TBS, 2% BSA for 1 h at room temperature. The Sepharose beads
were spun down and washed three times with TBS containing 0.1% Nonidet
P-40. The beads were boiled in sample buffer, and samples were loaded
on a 7.5% SDS-PAGE. Western blots were analyzed with an anti-Myc
antibody (anti-Myc 9E10, ATCC).
Immuncytochemical Analysis--
Cultured CHO cells and
Tie-2-expressing CHO cells (80,000/well) were seeded in a 24-well plate
(Greiner) and exposed to 5 µg/ml Myc-Ang-1 or Myc-Ang-2 for 5 min.
Cells were washed twice with PBS and fixed with cold methanol. Fixed
cells were washed twice with PBS and blocked with 250 µl of buffer
(PBS containing 1% fetal calf serum and 0.2% Tween) for 30 min. After
blocking, 250 µl of first antibody in blocking buffer was added for
1 h at room temperature. The anti-Myc antibody 9E10 (1 mg/ml;
ATCC) was used for the detection of Myc-Ang-1 and Myc-Ang-2. Likewise, the anti-Tie-2 antibody (clone AB33) (4 µg/ml; Upstate Biotechnology) was used for the detection of Tie-2. The cells were washed three times
for 10 min with PBS before the addition of the biotinylated anti-mouse
IgG antibody (DAKO, 1:500) for 30 min at room temperature. Cells were
washed three times and incubated with streptavidin-fluorescein isothiocyanate (1:50) or streptavidin-RPE (1:50) (DAKO) and
Hoechst dye (1:5000) for an additional 30 min.
Purification of myc-tagged Ang-1 and myc-tagged
Ang-2--
Full-length Ang-1 protein has not yet been generally
available so far due to inherent difficulties in purifying the
bioactive molecule. Instead, a modified variant, designated as Ang-1*,
in which the 73 amino-terminal amino acids of hAng-2 are fused to hAng-1 at residue 77, has been used in angiopoietin bioassays (6, 8, 9,
19). Thus, to map the angiopoietin binding sites in the Tie-2 receptor,
we first set up experiments aimed at purifying full-length bioactive
Ang-1 and Ang-2 as well as the different truncation mutants of sTie-2.
Expression of Myc-tagged human Ang-1 and Myc-tagged human Ang-2 in
insect cells (Sf9) using a baculovirus expression system
followed by ConA affinity purification and storage in the presence of
100 µg/ml BSA yielded functional Ang-1 and Ang-2 in purities up to
50% (Fig. 2A). Western blot analysis of Ang-1 and Ang-2 under non-reducing conditions showed that
Ang-1 is an oligomieric, most likely hexameric protein, whereas Ang-2
runs as a dimeric molecule (Fig. 2B). Both Myc-tagged
angiopoietins bind to Tie-2 with an affinity of 3 nM (data
not shown) as described previously (5, 6). Both Ang-1 and Ang-2 bind
uniformly to cultured endothelial cells and are rapidly internalized as
evidenced by the intracellular granular staining (Fig. 2,
C-E). Functional activity of the angiopoietins was tested
by Tie-2 phosphorylation in nonendothelial cells (see Fig. 6) as well
as in a three-dimensional spheroidal in gel angiogenesis assay (Ref. 14
and data not shown).
Truncated sTie-2-Fc for the Mapping of the Angiopoietin Binding
Sites--
The following amino-terminal truncation mutants of the
extracellular domain of Tie-2 were expressed as Fc fusion proteins: (i)
sTie-2-(1-199)-Fc consisting of the first Ig-like loop of Tie-2 (aa
1-199); (ii) sTie-2-(1-360)-Fc consisting of the first Ig-like loop
plus the EGF-like repeats (aa 1-360); (iii) sTie-2-(1-440)-Fc consisting of the first Ig-like loop plus the EGF-like repeats plus the
second Ig-like loop (aa 1-440) (Fig. 1). All fusion proteins could be
purified to greater than 95% purity (Fig. 2F).
Quantitative ELISA-based Mapping of the Angiopoietin Binding Sites
within the Tie-2 Receptor--
Angiopoietin binding was studied in a
competition ELISA-based assay in which binding of immobilized Ang-1 and
Ang-2 to the biotinylated full-length extracellular Tie-2 domain
(sTie-2-(1-730)-Fc) is inhibited by increasing concentrations of the
different amino-terminal truncation mutants of soluble Tie-2-Fc.
Positive control experiments (inhibition of angiopoietin binding by
biotinylated full-length extracellular Tie-2-Fc with competing
nonbiotinylated full-length extracellular Tie-2-Fc) revealed the
sensitivity of the experimental approach: a concentration of 10 pmol of
competing soluble Tie-2-Fc was capable of inhibiting binding of
biotinylated sTie-2-Fc to Ang-1 and Ang-2 to less than 25%
(IC50 of Ang-1: 2.2 ± 1.1 pmol; IC50 of
Ang-2: 3.3 ± 1.1 pmol) (Fig. 3,
A and B). In turn, competition of sTie-2 binding
to Ang-1 and Ang-2 by soluble VEGF-R2 was used as a negative control,
demonstrating the specificity of the competition assay and showing that
even higher concentrations of sVEGF-R2 quenched sTie-2-Fc binding to
Ang-1 and Ang-2 by less than 20% (Fig. 3, A and
B). Analysis of the different truncation mutants of the
extracellular domain of Tie-2 in this assay revealed that sTie-2-(1-440)-Fc and sTie-2-(1-360)-Fc are similarly capable of
inhibiting binding of Ang-1 and Ang-2 to Tie-2. Surprisingly, sTie-2-(1-440)-Fc containing the second Ig-like domain was less effective in inhibiting Ang-1 binding than the shorter sTie-2-(1-360) variant, which lacked the second Ig-like domain (sTie-2-(1-440)-Fc: IC50 of Ang-1, 9.1 ± 1.3 pmol;
IC50 of Ang-2: 27.5 ± 1.4 pmol; sTie-2-(1-360)-Fc:
IC50 of Ang-1, 4.2 ± 1.3 pmol; IC50 of
Ang-2, 3.8 ± 1.2 pmol). Moreover, sTie-2-(1-440)-Fc was more
effective in inhibiting Ang-1 binding (to 30%) than Ang-2 (to 58%),
indicating that the second Ig-like domain in the Tie-2 receptor is
capable of modulating angiopoietin binding and may confer some
specificity of Ang-1 over Ang-2 binding. Lastly, increasing
concentrations of the shortest sTie-2-Fc form consisting just of the
amino-terminal Ig-like domain of Tie-2 (sTie-2-(1-199)-Fc) quenched
sTie-2-Fc binding to Ang-1 and Ang-2 to 65%, albeit not in a classical
sigmoidal inhibition curve, indicating that the first Ig-like domain is not sufficient to effectively bind Ang-1 and Ang-2.
Analysis of Angiopoietin Binding to Tie-2 by Immunoprecipitation
Analysis--
Based on the results of the ELISA-based angiopoietin
binding experiments, we further studied binding of Ang-1 and Ang-2 to the extracellular domain of Tie-2 in angiopoietin pull-down assays. These experiments were performed by incubating full-length
extracellular Tie-2-Fc as well as the different truncation mutants of
Tie-2-Fc with Myc-tagged Ang-1 and Myc-tagged Ang-2, which was followed by protein-A-Sepharose precipitation and anti-Myc Western blot analysis. Corresponding to and confirming the ELISA-based binding experiments, full-length extracellular sTie-2-Fc as well as
sTie-2-(1-440)-Fc and sTie-2-(1-360)-Fc were capable of binding and
pulling down Ang-1 and Ang-2. In contrast, the shortest sTie-2-Fc
fusion protein consisting just of the amino-terminal Tie-2 Ig-like
domain is not capable of precipitating Ang-1 and Ang-2 (Fig.
4, A and B). Taken
together, the results of the ELISA-based competition experiments and
the pull-down experiments indicate: (i) the first Ig-like loop together
with the EGF-like repeats of Tie-2 are sufficient for strong Ang-1 and
Ang-2 binding, (ii) the second Ig-like loop of Tie-2- may confer some
specificity for Ang-1 over Ang-2 binding, and (iii) the first Ig-like
loop of Tie-2 alone is not sufficient to bind the angiopoietins.
To further corroborate these findings, we generated additional
truncated sTie-2-Fc mutants that lacked varying amino-terminal parts of
the Tie-2 receptor (Fig. 1): (i) sTie-2-(211-360)-Fc, consisting of
the EGF-like repeats; (ii) sTie-2-(211-730)-Fc, being composed of the
entire extracellular domain of Tie-2 just lacking the first Ig-like
domain; and (iii) sTie-2-(341-730)-Fc, consisting of the
carboxyl-terminal extracellular domains of Tie-2 lacking the first
Ig-like loop as well as the EGF-like repeats. The first set of
experiments had indicated that the EGF-like repeats might be involved
in angiopoietin binding, suggesting that sTie-2-(211-360)-Fc and
sTie-2-(211-730)-Fc might be capable of binding Ang-1 and Ang-2.
Surprisingly, none of the additional Tie-2 truncation mutants, sTie-2-(211-360)-Fc, sTie-2-(211-730)-Fc, and sTie-2-(341-730)-Fc, were able to bind Ang-1 or Ang-2 in precipitation experiments (Fig.
5) as well as in the ELISA-based
competition assays (data not shown). Collectively, the data show that
neither the first Ig-like domain alone nor the EGF-like repeats are
sufficient to bind Ang-1 and Ang-2 but that both domains together
(sTie-2-(1-360)-Fc) are necessary and sufficient to bind Ang-1 and
Ang-2.
Ang-1 and Ang-2 Binding Properties of Tie-2 Isolated from
Endothelioma Cells Established from Wild-type Mouse Embryos and Embryos
Expressing Mutated Tie-2 Protein--
Mice with a targeted insertion
of a neomycin expression cassette in exon 2 of the Tie-2 gene die on
embryonic day 10.5 as a consequence of severe vascular defects (4). We
have generated several endothelioma cell lines from these mutant
embryos and their corresponding heterozygous and wild-type littermates
by PymT-mediated immortalization (16, 17). As expected,
cells from wild-type mice express full-length Tie-2 receptor (166 kDa, Fig. 6A). Surprisingly,
endothelioma cells from homozygous Tie-2 mutant embryos expressed a
truncated Tie-2 receptor with an apparent molecular mass of 133 kDa. Correspondingly, both full-length Tie-2 as well as the truncated
Tie-2 molecule were detectable in endothelial cells isolated from
heterozygous embryos (Fig. 6A). Based on these observations,
we cloned the cDNA coding for the truncated murine Tie-2 receptor
in mutant endothelioma cells (mTie-2
To study the signal transduction properties of full-length mTie-2
receptor and the mutant mTie-2 receptor (mTie-2-(
The experiment with WT and mutant Tie-2 suggested either that
the mutant mTie-2-( The present study was aimed at mapping the binding sites of Ang-1
and Ang-2 in the extracellular domain of the Tie-2 receptor. The
experiments revealed that binding of both angiopoietins involves the
first Ig-like domain in combination with the EGF-like repeats. Neither
domain alone is capable of effectively binding the angiopoietins. Despite the fact that the definition of specific binding motifs requires further experimentation including the mutational analysis of
individual candidate amino acids, the essentially identical binding
properties of both angiopoietins in all experimental settings strongly
suggest that Ang-1 and Ang-2 bind to the same site in the Tie-2
receptor. However, it is difficult to mechanistically explain how Ang-1
can act agonistically and Ang-2 can act antagonistically if both
molecules compete for the same binding site in the Tie-2 protein. One
would expect that both molecules should elicit the same conformational
changes in the Tie-2 receptor, leading to tyrosine autophosphorylation
and subsequent signal transduction if they have identical binding
properties. However, confirming previous reports (5, 6), our
experiments have also shown that full-length Ang-1 is presented as
oligomeric protein, whereas Ang-2 is synthesized as a dimeric molecule.
Thus, different oligomeric states of Ang-1 and Ang-2 may cluster Tie-2
in a different manner despite sharing of the same binding sites.
Accordingly, different presentations of the angiopoietins may well
contribute to regulating differential responses of the Tie-2 receptor
upon binding.
Recent experiments have shown that Ang-1 and Ang-2 may not just exert
opposing functions on the Tie-2 receptor, but additionally, that in
certain conditions, Ang-2 is also able to activate the Tie-2 receptor.
This conclusion is supported by the observation that long term Tie-2
stimulation with Ang-2 leads to Tie-2 phosphorylation in endothelial
cells (13) and is correspondingly capable of inducing sprouting
angiogenesis in 24-48 h experiments (14). Likewise, the complex
phenotype of Ang-2-deficient mice with defects in retinal angiogenesis
and vascular regression as well as in the lymphatic vasculature cannot
exclusively be explained by opposing functions of Ang-1 and Ang-2 (15).
If indeed the angiopoietins are capable of exerting opposing functions
as well as being able to both act agonistically in different contextual
frameworks, it is unlikely that differential presentation and binding
of the ligands is responsible for mediating different biological
effects. Instead, it appears more likely that differential activities
are controlled at the level of the target cell, e.g. blood
vessel endothelial cells versus lymphatic endothelial cells.
This is also supported by the observation that Tie-2-transfected
nonendothelial cells elicit the same Tie-2 activation and
phosphorylation response upon stimulation with Ang-1 as well as Ang-2.
Endothelial cell-specific proteins shown to interact with Tie-2 include
Tie-1 (4, 20) and the vascular endothelial receptor phosphotyrosine
phosphatase (VE-PTP) (21). Tie-1 and VE-PTP are attractive
candidate molecules to serve as modulators of the angiopoietin/Tie-2
signaling. Alternatively, another hitherto unidentified Ang-2 receptor
may be responsible for the agonistic or antagonistic functions of Ang-1
and Ang-2.
Contextuality of ligand presentation to the Tie-2 receptor is likely
another important factor that regulates the differential interaction of
the angiopoietins with their Tie-2 receptor. Ang-1 is primarily
produced by pericytes and other nonendothelial cells (5, 10) and acts
consitutively on endothelial cells in a paracrine manner (5, 10). In
turn, Ang-2 is primarily produced upon stimulation by endothelial cells
and, thus, acts as an autocrine vascular regulator (6, 23, 24). Ang-2
expression is down-regulated in the quiescent vasculature and is
strongly induced upon endothelial cell activation (22-24). Endothelial
Ang-2 expression has been reported during vascular remodeling and
pathological angiogenesis, including tumor angiogenesis (25). The
autocrine mode of action of Ang-2 and the induction upon endothelial
cell activation are controlled by the unique properties of the Ang-2
promoter.4 More importantly,
the effects of Ang-2 on endothelial cell Tie-2 activation are
strongly regulated by contextual cues and
vary significantly if Ang-2 is acting in a paracrine or
autocrine manner.5
In line with the finding that the first Ig-like domain in concert with
the EGF-like repeats is necessary for Tie-2 binding of Ang-1 and Ang-2,
we made the surprising observation that loss of the first 104 amino
acids to the first Ig-like domain completely disrupts angiopoietin
binding and Tie-2-mediated signal transduction in vitro and
in vivo. Careful analysis of mice with a targeted mutation
of exon 2 of the Tie-2 gene revealed that the Tie-2 receptor gene in
these mice is not completely inactivated but that endothelial cells
derived from mutant embryos express an amino-terminally truncated
133-kDa Tie-2 receptor that lacks 104 amino acids of the first Ig-like
domain. This receptor is signaling-deficient, as evidenced by the early
embryonic lethal phenotype of mice homozygously expressing this
truncated Tie-2 receptor. However, the binding and activation
properties of the mutant receptor have not been studied. Our
experiments showed that the mutant mTie-2-( Taken together, our results indicate (i) that the first Ig-like loop in
combination with the EGF-like repeats is necessary and sufficient for
proper binding of both Ang-1 and Ang-2 to Tie-2, (ii) that the first
104 amino acids of the first Ig-like domain are necessary but not
sufficient for binding of Ang-1 and Ang-2, (iii) that the second
Ig-like domain in the Tie-2 receptor may confer some differential
binding activity of Ang-1 versus Ang-2, and (iv) that the
identical binding properties of Ang-1 and Ang-2 in all experiments
strongly suggest that both molecules share the same binding site in the
first 360 extracellular amino acids of Tie-2 (although the elucidation
of individual binding motifs is required to conclusively substantiate
identical binding properties). Collectively, our data support the
concept that differential target cell properties and differential
presentation of the angiopoietins to the target cells are responsible
for the differential contextually regulated effects of the
angiopoietins rather than inherent differences in ligand binding to the receptor.
We thank Silvia König and Silvia Hennig
for expert technical assistance. C. W., T. K., and U. D. also
gratefully acknowledge the generous support by the late Werner Risau.
*
This work was supported by grants from the Deutsche
Forschungsgemeinschaft (Grants Fi879/1-2 (to U. F.), DFG De506/3-1 (to U. D.), and Au83/5-1 (to H. G. A.)).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
Present address: Ares Serono, Geneva, Switzerland.
**
Present address: Max-Planck-Institute for Vascular Biology,
Münster, Germany.
§§
Dept. of Vascular Biology and Angiogenesis Research, Tumor
Biology Ctr., Breisacher Str. 117, D-79106 Freiburg, Germany.
Tel.: 49-761-206-1500; Fax: 49-761-206-1505; E-mail:
augustin@angiogenese.de.
Published, JBC Papers in Press, November 9, 2002, DOI 10.1074/jbc.M208550200
2
U. Fiedler, unpublished data.
3
G. Siemeister, unpublished data.
4
A. Hegen, H. G. Augustin, and U. Fiedler,
manuscript in preparation.
5
M. Scharpfenecker, U. Fiedler, and H. G. Augustin, manuscript in preparation.
The abbreviations used are:
EGF, epidermal growth factor;
VEGF, vascular EGF;
sVEGF, soluble VEGF;
Ang, angiopoietin;
CHO, Chinese hamster ovary cells;
PBS, phosphate-buffered
saline;
TBS, Tris-buffered saline;
BSA, bovine serum albumin;
ELISA, enzyme-linked immunosorbent assay;
aa, amino acids;
WT, wild-type;
RT, reverse transcriptase.
Angiopoietin-1 and Angiopoietin-2 Share the Same Binding Domains
in the Tie-2 Receptor Involving the First Ig-like Loop and the
Epidermal Growth Factor-like Repeats*
,
,
,
,

,
, and
§§
Department of Vascular Biology and
Angiogenesis Research, Tumor Biology Center, 79106 Freiburg, Germany
and the § Max-Planck-Institute for Physiological and
Clinical Research, D-61231 Bad Nauheim, Germany
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

View larger version (38K):
[in a new window]
Fig. 1.
Domain structure of the Tie-2 receptor and
schematic diagram of the soluble Tie-2-Fc truncation mutants in these
studies. The extracellular domain of Tie-2 consists of an
amino-terminal Ig-like domain followed by EGF-like repeats, a second
Ig-like domain, and fibronectin type III domains. Fc fusion proteins
were generated by replacing the transmembrane and kinase domain of
Tie-2 by human Fc (constant part of IgG1). Different portions of the
extracellular domain of Tie-2 were fused to Fc (the numbers
denote the amino acids of the extracellular Tie-2 domain of each of the
constructs). See "Experimental Procedures" for details of
construction.
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
mice with a retrovirus
coding for the Polyoma virus middle T-antigen as described previously (16, 17). The cells were characterized by fluorescence-activated cell
sorter analysis and express the endothelial markers PECAM-1, ICAM-2,
CD34, endoglin, MECA-32, and Flk-1. Endotheliomas were grown in
Dulbecco's modified Eagle's Medium, high glucose supplemented with
10% fetal calf serum, 3 mM L-glutamin, 5 µM
-mercaptoethanol, 1 mM sodium pyruvate,
1% non-essential amino acids, and penicillin and streptomycin.
-MEM with ribonucleosides and
deoxyribonucleosides (Invitrogen) supplemented with 10% fetal calf serum. For selection of clones, 10 µg/ml blasticidine S was added. Insect cells (Sf9) were cultured in Ex-Cell 400 with
L-glutamine (JHR Bioscience) without further supplements.
E2. Sequencing with
an automated sequencer (ABI 373) revealed that the actual size of the
PCR fragment from the Tie-2 mutant cell lines is 1330 bps and that the
sequences coded for by exactly the second exon (312 bps, corresponding
to 104 aa) are missing.
E2, a fragment harboring the Tie-2 deletion
was isolated from pCRII mTie-2
E2 by digesting with BglII, filling in with Klenow fragment to produce a blunt
end, and recutting with SpeI. This fragment was ligated into
pJFE14 mTie-2 that had been linearized with XbaI,
blunt-ended as above, and recut with SpeI. pEF6 mTie-2
E2
was assembled by three-fragment ligation of an
EcoRI/SpeI fragment derived from pCRII mTie-2
E2, a SpeI/BsrGI fragment from pEF6 mTie-2,
and a pEF6 vector fragment derived from pEF6 mTie-2 by cutting with
EcoRI and BsrGI.
-D-manno-pyranoside, 0.5 M methyl-
-D-gluco-pyranoside. The
angiopoietin-containing fractions were pooled and dialyzed against 50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 10%
glycerol. Before freezing of the proteins, 100 µg/ml BSA was added
for stabilization. Functional angiopoietin protein preparations had a
purity of up to 50%. Further purification led to aggregation and
inactivation upon repeated freeze-thaw cycles.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

View larger version (40K):
[in a new window]
Fig. 2.
Properties of recombinant
Ang-1 and Ang-2 as well as soluble Tie-2-Fc truncation mutants.
A, silver-stained SDS-PAGE of Myc-tagged full-length Ang-1
and Ang-2. The angiopoietins were expressed in Sf9 cells and
purified by ConA affinity chromatography. Bioactive recombinant Ang-1
and Ang-2 (purity up to 50%) can be stored frozen in the presence of
100 µg/ml BSA. B, anti-Myc Western blot of Ang-1 and Ang-2
run under reducing (left) and non-reducing conditions.
Monomeric Myc-Ang-1 and Myc-Ang-2 runs with an apparent molecular size
of 65 kDa. In contrast, non-reducing gels showed Ang-2 as a dimeric
molecule and Ang-1 as an oligomeric, most likely hexameric molecule.
DTT, dithiothreitol. As shown in C-E, human
umbilical vein endothelial cells were incubated with PBS
(C), Myc-Ang-1 (D), and Myc-Ang-2 (E).
Angiopoietin binding was detected by anti-Myc immunocytochemistry. As
shown in F, a silver stain of purified baculovirus produced
truncated soluble Tie-2 molecules run on a 7.5% SDS-PAGE under
reducing conditions. Full-length soluble Tie-2-Fc extracellular domain
(1-730)-Fc, as well as the truncated mutants (1-440)-Fc, (1-360)-Fc,
and (1-199)-Fc, could be purified to >90%.

View larger version (27K):
[in a new window]
Fig. 3.
Binding of Ang-1 and Ang-2 to differently
truncated soluble Tie-2 extracellular domains. Purified Myc-Ang-1
(A) and Myc-Ang-2 (B) (2 µg of each) were
immobilized on 96-well plates. Binding of biotinylated full-length
soluble Tie-2-Fc (aa 1-730) (0.3 pmol/well) was competed with
increasing amounts of the different truncated sTie-2-Fc molecules.
Binding of biotinylated sTie-2-Fc was quantified colorimetrically using
a streptavidine-alkaline phosphatase conjugate and
p-nitrophenyl phosphate as substrate. Competition for
angiopoietin binding between biotinylated sTie-2-Fc and the
unbiotinylated truncated sTie-2-Fc molecules is expressed as relative
binding to the immobilized angiopoietin setting the absorbance value of
uncompeted full-length extracellular sTie-2-Fc to 100%. Experiments
were performed at least twice with duplicate determinations.

View larger version (40K):
[in a new window]
Fig. 4.
Co-precipitation of Myc-Ang-1 and
Myc-Ang-2 with the different sTie-2-Fc truncation
mutants. The different truncated sTie-2-Fc molecules were
incubated with myc-Ang-1 (A) and Myc-Ang-2 (B),
precipitated with protein-A-Sepharose, and probed with an anti-Myc
antibody following Western blotting after 7.5% SDS-PAGE.
input, positive control of input Ang-1 (A) and
Ang-2 (B); unbound, supernatant following
immunoprecipitation; precipitated, sTie-2-Fc co-precipitated
Myc-Ang-1 (A) and Myc-Ang-2 (B); no
Ang-1, no Ang-2, and no sTie-2, negative
control immunoprecipitations omitting Ang-1, Ang-2, or sTie-2-fc. The
sTie-2- (1-730)-Fc, (1-440)-Fc, and (1-360)-Fc are similarly capable
of co-precipitating Ang-1 and Ang-2, whereas sTie-2- (1-199)-Fc binds
neither Ang-1 nor Ang-2. All experiments were performed at least
twice.

View larger version (47K):
[in a new window]
Fig. 5.
Co-precipitation of Myc-Ang-1 and Myc-Ang-2
with sTie-2-(1-730)-Fc, sTie-2-(211-360)-Fc, sTie-2-(211-730)-Fc,
and sTie-2-(341-730)-Fc. The different truncated sTie-2-Fc
molecules were incubated with Myc-Ang-1 (A) and Myc-Ang-2
(B), precipitated with protein-A-Sepharose, and probed with
an anti-Myc antibody following Western blotting after 7.5% SDS-PAGE.
input, positive control of input Ang-1 (A) and
Ang-2 (B); unbound, supernatant following
immunoprecipitation; precipitated, sTie-2 co-precipitated
Myc-Ang-1 (A) and Myc-Ang-2 (B); no
Ang-1, no Ang-2, and no sTie-2, negative
control immunoprecipitations omitting Ang-1, Ang-2, or sTie-2-Fc. None
of the additional truncated sTie-2-Fc molecules are capable of binding
Ang-1 and Ang-2. All experiments were performed at least twice.
/
). Sequence
analysis revealed that the mutant mTie-2 receptor is produced as a
transmembrane receptor with a complete intracellular domain containing
a signal sequence but lacking the first 104 amino acids of the
extracellular domain corresponding to parts of the first Ig-like loop.
Based on these findings, we propose that the entire exon 2 including
the neomycin expression cassette is removed in the Tie-2 mutant mice by
aberrant splicing from the primary Tie-2 transcript produced from the
targeted allele leading to an in-frame fusion of exons 1 and 3.

View larger version (29K):
[in a new window]
Fig. 6.
Detection of mutant Tie-2 protein in
endotheliomas derived from mouse embryos with a targeted mutation of
Tie-2. As shown in A, Polyoma middle T immortalized
endothelioma cells were generated from mouse embryos homozygous for a
targeted insertion into exon 2 of the Tie-2 gene (cell lines 9, 25, 32, and 43); heterozygously Tie-2-targeted mouse embryos (cell line 27);
and wild-type mouse embryos (cell line 38). Cell lysates were separated
by 7.5% SDS-PAGE, blotted, and probed with an anti-Tie-2 antibody.
Wild-type endothelioma cells express full-length 166-kDa Tie-2. In
contrast, all homozygous Tie-2 mutant endothelioma cells express a
smaller Tie-2 band with an apparent molecular size of around 133 kDa.
Heterozygous mutant endothelioma cells express the wild-type 166-kDa
band as well as the mutant 133-kDa band. As shown in B, CHO
cells were transfected with either a plasmid coding for full-length
mTie-2 (lanes 1-3) or a plasmid that codes for the mutant
murine Tie-2-(
aa 1-103) (lanes 4-6). Cells were
starved for 12 h and stimulated with 5 µg/ml Myc-Ang-1 or
Myc-Ang-2 for 15 min. Cell lysates were immunoprecipitated with an
anti-Tie-2 antibody, separated by SDS-PAGE, blotted, and probed with an
anti-P-tyrosine antibody (upper panel) and reprobed with an
anti-Tie-2 antibody. Both Ang-1 and Ang-2 are capable of inducing Tie-2
phosphorylation. In contrast, the mutant Tie-2 lacking aa 1-103 is not
capable of becoming phosphorylated upon Ang-1 or Ang-2
stimulation.
aa1-103)), we
stably overexpressed both molecules in CHO cells and stimulated the
cells with Ang-1 and Ang-2. Stimulation of full-length Tie-2-expressing CHO cells results in rapid autophosphorylation upon Ang-1 as well as
Ang-2 addition (Fig. 6B). In contrast, mTie-2-(
aa1-103)
does not become phosphorylated upon Ang-1 or Ang-2 stimulation (Fig. 6B). Corresponding experiments with wild-type and
mTie-2-(
aa1-103)-expressing endothelioma cells showed that Ang-1
is capable of inducing Tie-2 phosphorylation in WT endothelioma but not
in mutant endothelioma cells (data not shown).
aa1-103) receptor lacking parts of the first
Ig-like domain is not able to bind Ang-1 and Ang-2 or that mutant Tie-2
can bind the angiopoietins but cannot undergo the conformational change
that leads to autophosphorylation. To address these alternative
possibilities, we studied the binding of Myc-Ang-1 and Myc-Ang-2 by CHO
cells expressing either full-length Tie-2 or the mutant mTie-2-(
aa1-103) and traced binding by cytochemical detection using anti-Myc
antibodies. These experiments showed that full-length Tie-2-expressing
CHO cells bind Ang-1 as well Ang-2, whereas mTie-2-(
aa1-103)-expressing cells are not capable of binding Ang-1 and Ang-2
(Fig. 7). Collectively, these experiments show that the first 104 amino acids of the first Ig-like domain of the
Tie-2 receptor are critically required for binding of Ang-1 and Ang-2
to the Tie-2 receptor in vivo.

View larger version (90K):
[in a new window]
Fig. 7.
Myc-Ang-1 and Myc-Ang-2 binding to
Tie-2-expressing CHO cells. CHO cells were transfected with
control vector (upper panel), full-length mTie-2
(middle panel), or a plasmid that codes for the mutant
murine Tie-2-(
aa 1-103) (lower panel). Pooled clones
were subjected to Tie-2 immunostaining (left panel) using
RPE as fluorescent dye. Aliquots of the same cells were also exposed to
Myc-Ang-1 (middle panel) or Myc-Ang-2 (right
panel) for 5 min, after which they were fixed, and Ang-1 and Ang-2
was visualized by immunostaining with an anti-Myc antibody and
fluorescein isothiocyanate. Tie-2-transfected CHO cells bind Ang-1 as
well as Ang-2. In contrast, CHO cells expressing the mutant mTie-2
receptor lacking aa 1-103 are not capable of binding Ang-1 and
Ang-2.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
aa 1-103) receptor is
not capable of binding Ang-1 and Ang-2 and has consequently no signal
transducing capacity.
![]()
ACKNOWLEDGEMENTS
![]()
FOOTNOTES
Present address: Artemis Pharmaceuticals, Tübingen, Germany.

Present address: Novartis, Basel, Switzerland.
![]()
ABBREVIATIONS
![]()
REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1.
Gale, N. W.,
and Yancopoulos, G. D.
(1999)
Genes Dev.
13,
1055-1066 2.
Carmeliet, P.
(2000)
Nat. Med.
4,
389-395
3.
Holash, J.,
Maisonpierre, P. C.,
Compton, D.,
Boland, P.,
Alexander, C. R.,
Zagzag, D.,
Yancopoulos, G. D.,
and Wiegand, S. J.
(1999)
Science
284,
1994-1998 4.
Sato, T. N.,
Qin, Y.,
Kozak, C. A.,
and Audus, K. L.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
9355-9358 5.
Davis, S.,
Aldrich, T. H.,
Jones, P. F.,
Acheson, A.,
Compton, D. L.,
Jain, V.,
Ryan, T. E.,
Bruno, J.,
Radziejewski, C.,
Maisonpierre, P.,
and Yancopoulos, G. D.
(1996)
Cell
8,
1161-1169
6.
Maisonpierre, P. C.,
Suri, C.,
Jones, P. F.,
Bartunkova, S.,
Wiegand, S. J.,
Radziejewski, C.,
Compton, D.,
McClain, J.,
Aldrich, T. H.,
Papadopoulos, N.,
Daly, T. J.,
Davis, S.,
Sato, T. N.,
and Yancopoulos, G. D.
(1997)
Science
277,
55-60 7.
Valenzuela, D. M.,
Griffiths, J. A.,
Rojas, J.,
Aldrich, T. H.,
Jones, P. F.,
Zhou, H.,
McClain, J.,
Copeland, N. G.,
Gilbert, D. J.,
Jenkins, N. A.,
Huang, T.,
Papadopoulos, N.,
Maisonpierre, P. C.,
Davis, S.,
and Yancopoulos, G. D.
(1999)
Proc. Natl. Acad. Sci. U. S. A.
96,
1904-1909 8.
Papapetropoulos, A.,
Garcia-Cardena, G.,
Dengler, T. J.,
Maisonpierre, P. C.,
Yancopoulos, G. D.,
and Sessa, W. C.
(1999)
Lab. Invest.
79,
213-223[Medline]
[Order article via Infotrieve]
9.
Koblizek, T. I.,
Weiss, C.,
Yancopoulos, G. D.,
Deutsch, U.,
and Risau, W.
(1998)
Curr. Biol.
8,
529-532[CrossRef][Medline]
[Order article via Infotrieve]
10.
Suri, C.,
Jones, P. F.,
Patan, S.,
Bartunkova, S.,
Maisonpierre, P. C.,
Davis, S.,
Sato, T. N.,
and Yancopoulos, G. D.
(1996)
Cell
87,
1171-1180[CrossRef][Medline]
[Order article via Infotrieve]
11.
Lobov, I. V.,
Brooks, P. C.,
and Lang, R. A.
(2002)
Proc. Natl. Acad. Sci. U. S. A.
99,
11205-11210 12.
Goede, V.,
Schmidt, T.,
Kimmina, S.,
Kozian, D.,
and Augustin, H. G.
(1998)
Lab. Invest.
78,
1385-1394[Medline]
[Order article via Infotrieve]
13.
Teichert-Kuliszewska, K.,
Maisonpierre, P. C.,
Jones, N.,
Campbell, A. I. M.,
Master, Z.,
Bendeck, M. P.,
Alitalo, K.,
Dumont, D. J.,
Yancopoulos, G. D.,
and Stewart, D. J.
(2001)
Cardiovasc. Res.
49,
659-670 14.
Korff, T.,
Kimmina, S.,
Martiny-Baron, G.,
and Augustin, H. G
(2001)
FASEB J.
15,
447-457 15.
Gale, N. W.,
Thurston, G,
Heckett, S. F.,
Renard, R.,
Wang, Q.,
McClain, J.,
Martin, C.,
Witte, C.,
Witte, M. H.,
Jackson, D.,
Suri, C.,
Campochiaro, P. A.,
Wiegand, S. J.,
and Yancopoulos, G. D.
(2002)
Dev. Cell
3,
411-423[CrossRef][Medline]
[Order article via Infotrieve]
16.
Montesano, R.,
Pepper, M. S.,
Mohle-Steinlein, U.,
Risau, W.,
Wagner, E. F.,
and Orci, L.
(1990)
Cell
62,
435-445[CrossRef][Medline]
[Order article via Infotrieve]
17.
Reiss, Y.,
Hoch, G.,
Deutsch, U.,
and Engelhardt, B.
(1998)
Eur. J. Immunol.
28,
3086-3099[CrossRef][Medline]
[Order article via Infotrieve]
18.
Takebe, Y.,
Seiki, M.,
Fujisawa, J.,
Hoy, P.,
Yokota, K.,
Arai, K.,
Yoshida, M.,
and Arai, N.
(1988)
Mol. Cell. Biol.
8,
466-472 19.
Thurston, G.,
Suri, C.,
Smith, K.,
McClain, J.,
Sato, T. N.,
Yancopoulos, G. D.,
and McDonald, D. M.
(1999)
Science
286,
2511-2514 20.
Marron, M. B.,
Hughes, D. P.,
Edge, M. D.,
Forder, C. L.,
and Brindle, N. P.
(2000)
J. Biol. Chem.
275,
39741-39746 21.
Fachinger, G.,
Deutsch, U.,
and Risau, W.
(1999)
Oncogene
18,
5948-5953[CrossRef][Medline]
[Order article via Infotrieve]
22.
Mandriota, S. J.,
and Pepper, M. S.
(1998)
Circ. Res.
83,
852-859[Medline]
[Order article via Infotrieve]
23.
Oh, H.,
Takagi, H.,
Suzuma, K.,
Otani, A.,
Matsumura, M.,
and Honda, Y.
(1999)
J. Biol. Chem.
274,
15732-15739 24.
Huang, Y.-Q., Li, J.-J., Hu, L.,
Lee, M.,
and Karpatkin, S.
(2002)
Blood
99,
1645-1650
25.
Stratmann, A.,
Risau, W.,
and Plate, K. H.
(1998)
Am. J. Path.
153,
1459-1466
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
R. Becker, M. C. Lenter, T. Vollkommer, A. M. Boos, D. Pfaff, H. G. Augustin, and S. Christian Tumor stroma marker endosialin (Tem1) is a binding partner of metastasis-related protein Mac-2 BP/90K FASEB J, August 1, 2008; 22(8): 3059 - 3067. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. L. Kim, I.-S. Shin, J.-M. Kim, J.-H. Choi, J. Byun, E.-S. Jeon, W. Suh, and D.-K. Kim Interaction between Tie receptors modulates angiogenic activity of angiopoietin2 in endothelial progenitor cells Cardiovasc Res, December 1, 2006; 72(3): 394 - 402. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Pfaff, U. Fiedler, and H. G. Augustin Emerging roles of the Angiopoietin-Tie and the ephrin-Eph systems as regulators of cell trafficking J. Leukoc. Biol., October 1, 2006; 80(4): 719 - 726. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Harfouche and S. N. A. Hussain Signaling and regulation of endothelial cell survival by angiopoietin-2 Am J Physiol Heart Circ Physiol, October 1, 2006; 291(4): H1635 - H1645. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. R. Macdonald, P. Progias, B. Ciani, S. Patel, U. Mayer, M. O. Steinmetz, and R. A. Kammerer Structure of the Extracellular Domain of Tie Receptor Tyrosine Kinases and Localization of the Angiopoietin-binding Epitope J. Biol. Chem., September 22, 2006; 281(38): 28408 - 28414. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. M. Kim, K. E. Kim, G. Y. Koh, Y.-S. Ho, and K.-J. Lee Hydrogen peroxide produced by angiopoietin-1 mediates angiogenesis. Cancer Res., June 15, 2006; 66(12): 6167 - 6174. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. P.J. Brindle, P. Saharinen, and K. Alitalo Signaling and Functions of Angiopoietin-1 in Vascular Protection Circ. Res., April 28, 2006; 98(8): 1014 - 1023. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. C. Weber, H. Cai, M. Ehrbar, H. Kubota, G. Martiny-Baron, W. Weber, V. Djonov, E. Weber, A. S. Mallik, M. Fussenegger, et al. Effects of Protein and Gene Transfer of the Angiopoietin-1 Fibrinogen-like Receptor-binding Domain on Endothelial and Vessel Organization J. Biol. Chem., June 10, 2005; 280(23): 22445 - 22453. [Abstract] [Full Text] [PDF] |
||||