![]()
|
|
||||||||
J. Biol. Chem., Vol. 278, Issue 3, 1904-1909, January 17, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the Department of Biochemistry, University of
Wisconsin-Madison, Madison, Wisconsin 53706
Received for publication, September 3, 2002, and in revised form, November 6, 2002
Tn5 transposase (Tnp), a 53.3-kDa protein,
enables the movement of transposon Tn5 by a conservative mechanism.
Within the context of a protein and DNA synaptic complex, a single Tnp
molecule catalyzes four sequential DNA breaking and joining reactions
at the end of a single transposon. The three amino acids of the DDE motif (Asp-97, Asp-188, and Glu-326), which are conserved among transposases and retroviral integrases, have been shown previously to
be absolutely required for all catalytic steps. To probe the effect of
active site geometry on the ability to form synaptic complexes and
perform catalysis, single mutations at each position of the DDE motif
were constructed. The aspartates were changed to glutamates, and the
glutamate was changed to an aspartate. These mutants were studied by
performing in vitro binding assays using short
oligonucleotide substrates simulating the natural substrates for the
synaptic complex formation and subsequent transposition steps. The
results indicate that the aspartate to glutamate mutations restrict
synaptic complex formation with substrates resembling the natural
transposon prior to transferred strand nicking. This suggests a
structural model in which the donor backbone DNA, prior to nicking,
occupies the same space that is invaded by the longer side chains
present in the aspartate to glutamate mutants. Additionally, catalytic assays support the previous proposal that the active site
coordinates two divalent metal ions.
Tn5 transposase
(Tnp)1 is the protein
responsible for the mobility of the Tn5 transposon (1). Movement of the
transposon occurs via a conservative "cut and paste" mechanism that
is mediated by Tnp and 19-bp inverted terminal repeats.
Transposition involves the complete excision of the transposon from
donor DNA followed by insertion into a new location (Fig. 1). The
excision and insertion involve four catalytic steps at the transposon
ends: transferred strand nicking, hairpin formation, hairpin
resolution, and strand transfer into target DNA (2). These reactions
occur within a protein-DNA complex, termed a synaptic complex,
consisting of two Tnp molecules and two end sequences (3, 4). Single
Tnp molecules bound to single end sequences are not catalytically competent, thus restricting the transposition reactions to
synaptic complexes (4, 5).
The naturally isolated Tn5 transposon transposes at a very low
frequency, most likely because frequent transposition would be
detrimental to the survival of the cell, constituting a selective disadvantage to a highly active transposon. The low level of
transposition can be attributed to both the low activity of the Tnp
protein and the suboptimal 19-bp end sequences. The low level of
protein activity has been increased by the introduction of two point
mutations, E54K and L372P (5, 6). This mutant is termed EK/LP and is the standard for this and other studies of Tn5 Tnp. The rate of transposition is further increased by replacing the naturally occurring
end sequences with a 19-bp site termed the mosaic end (ME) (7). The
combination of Tnp EK/LP and ME sequences has allowed the development
of an efficient series of in vitro assays used to study the
individual steps of the transposition process via gel shift (3) and
catalytic assays (2, 6, 8, 9).
Each Tnp molecule possesses a single active site, responsible for
carrying out all four catalytic steps, at a single 19-bp end (4, 10).
In the first and third steps, transferred strand nicking and hairpin
resolution, a water molecule acts as a nucleophile to hydrolyze a DNA
phosphate bond, whereas in the second and fourth reactions, hairpin
formation and strand transfer, the 3'-hydroxyl group of the transferred
strand acts as the nucleophile (Fig. 1).
The active site contains a triad of acidic residues (Asp-97, Asp-188,
and Glu-326) termed the DDE motif. This motif is believed to be conserved among all transposases and retroviral integrases. The
DDE residues serve to coordinate divalent metal ions that are required
for catalysis (11-14). A previous study has suggested that Asp-97 and
Glu-326 contribute to the coordination of one metal ion, whereas Asp-97
and Asp-188 coordinate a second ion (15). All three of the DDE residues
are required for all four catalytic steps of transposition (9).
In this study point mutations were introduced at each of the DDE
residues in the EK/LP background, creating three separate single
mutants. These mutations consist of changing the two aspartates to
glutamates and the glutamate to an aspartate, yielding D97E, D188E, and
E326D. These alterations were chosen because they leave the
catalytically essential carboxyl groups in place at each of the three
positions, while slightly altering their spatial location within the
active site. By studying the ability of these mutants to form paired
ends complexes (PECs), the equivalent of synaptic complexes with short
oligonucleotide substrates, we were able to predict the spatial
position assumed by the nontransposon DNA adjacent to the transposon
end sequences, termed donor backbone (dbb), in synaptic complexes prior
to the first catalytic step of transposition, transferred strand
nicking. Additionally, use of these mutants in catalytic studies lends
support to the previous proposal that the DDE motif serves to
coordinate two divalent metal ions in the active site (15). To our
knowledge, no studies of similar chemically conservative mutations of
the DDE motif in other transposases or retroviral integrases have been
reported in the literature.
Cultures--
All bacterial cultures for cloning and
protein purification were grown in Luria broth (16). Ampicillin was
purchased from Sigma and added to agar or liquid media at 100 µg/ml. Restriction enzymes were purchased from New England Biolabs
and Promega. T4 DNA ligase was purchased from Promega. Pfu
polymerase was purchased from Stratagene. T4 DNA polynucleotide kinase
was purchased from New England Biolabs. Oligonucleotides were purchased
from Integrated DNA Technology. Sequencing was performed using the
PerkinElmer "Big Dye" kit with the aid of the University of
Wisconsin-Madison Biotechnology Center.
Site-directed Mutagenesis--
The plasmid pRZPET2, which
contains the hyperactive EK/LP Tn5 tnp gene (6), was
used as a template for site-directed mutagenesis using the single end
overlap procedure (17). PCR products bearing the desired mutations were
cloned into pRZPET2. D97E was cloned at the XbaI and
NotI sites, D188E was cloned at the NotI and
NheI sites, and E326D was cloned at the NheI and
Hind III sites. The constructs for protein expression were
created by swapping the mutated regions from the pRZPET2 derived
plasmids into the expression vector pGRTYB35, which encodes for the
EK/LP Tn5 Tnp as a carboxyl-terminal fusion to intein and chitin
binding domains as described previously (2). The pRZPET2 plasmids
containing the D97E, D188E, and E326D mutations were digested with
BglII, and the overhangs filled in with Pfu
followed by digestion with XbaI. The fragments containing the mutated tnp genes were cloned into the pGRTYB35
SmaI and XbaI sites to yield pWSR5021 (D97E),
pWSR5022 (D188E), and pWSR5018 (E326D). The presence of mutations was
confirmed by DNA sequencing.
Bacterial Strains--
Expression of Tnp mutant proteins for
purification was performed in Escherichia coli strain ER2566
(F Purification of Proteins and Preparation of DNA
Substrates--
Purification of Tnp EK/LP as well as mutant proteins
was performed using the IMPACT T7 system from New England Biolabs. The concentrations of proteins were determined following the method of
Bradford (18) using a BSA standard. Protein yields were between 1 and 2 mg of Tnp/liter of cells. The purity of the Tnp preparations was
determined by SDS-PAGE analysis and Coomassie staining. No bands other
than that for Tnp were observed. It has previously been shown that this
method of protein purification gives very little nuclease contamination
(2). Substrates for PEC and catalytic assays were prepared via
32P labeling of the 5'-ends of oligonucleotides with T4 DNA
polynucleotide kinase followed by annealing of appropriate
oligonucleotides (2, 3) and subsequent cleaning up using a Qiagen
nucleotide removal kit.
The following oligonucleotides were used for the unnicked PEC formation
and 3' nicking assays (ME shown in bold):
5'-CTCAGTTCGAGCTCCCAACACTGTCTCTTATACACATCTTGAGTGAGTGAGCATGCATGT-3' (nontransferred strand) and
5'-ACATGCATGCTCACTCACTCAAGATGTGTATAAGAGACAGTGTTGGGAGCTCGAACTGAG-3' (transferred strand).
For prenicked PEC formation and hairpin formation assays, the
nontransferred strand was as shown above, and the transferred strand
oligonucleotide was replaced by the following two oligonucleotides: 5'-TGTTGGCAGCTCGAACTGAG-3' (donor backbone compliment) and
5'-ACATGCATGCTCACTCACTCAAGATGTGTATAAGAGACAG-3' (ME and
transposon DNA compliment).
The following oligonucleotide was used for hairpin PEC formation and
hairpin resolution assays:
5'-CACGTGTTGACATGTGTATAAGAGACAGCTGTCTCTTATACACATGTCAA (hairpin loop underlined).
The following oligonucleotide, annealed to the 40-base oligonucleotide
listed above as the transferred strand of the prenicked substrate,
constitutes the precleaved substrate used for PEC formation and strand
transfer assays:
5'-CTGTCTCTTATACACATGTTGAGTGAGTGAGCATGCATGT-3'.
In Vitro Catalytic Reactions--
All catalytic reactions were
performed in 10-µl reaction volumes containing 235 nM
Tnp, 0.1 M potassium glutamate, 25 mM HEPES, pH
7.5, 50 µg/ml bovine serum albumin, 1 mM
Sample Preparation for Denaturing Gel Electrophoresis--
Each
sample underwent phenol/chloroform extraction to remove transposase.
The DNA was then ethanol-precipitated, dried, and resuspended in 1×
formamide dye. After samples were boiled for 3 min, 5 µl of
each sample was loaded onto a prewarmed 15% denaturing polyacrylamide
gel and electrophoresed at 28 W constant power (2). The gel was then
dried and visualized with a PhosphorImager. Radiolabeled DNA was
quantitated using ImageQuant software from Amersham Biosciences.
Catalytic activity is presented as the percentage of total counts per
lane running at the positions expected for reaction products. All
values represent the average of three independent reactions.
PEC Formation Assays--
PEC assays were performed in 10-µl
reaction volumes containing 235 nM Tnp, 0.1 M
potassium glutamate, 25 mM HEPES, pH 7.5, 50 µg/ml bovine
serum albumin, 1 mM Three single mutants were constructed in the EK/LP background, a
hyperactive version of Tnp containing mutations E54K and L372P. These
mutations were made at the catalytically critical DDE motif residues.
The substitution mutations (D97E, D188E, and E326D) are chemically
conservative, differing by only one carbon atom in the length of the
side chain. Using these mutants, which have slightly perturbed active
site geometry, we were able to probe the spatial requirements for
formation of paired ends complexes and catalytic activity in Tn5
transposition. The ability of each of the three active site mutants to
form PECs with oligonucleotides simulating the natural substrate at all
steps of transposition and to catalyze the three reactions comprising
cleavage of the transposon from donor backbone (dbb) DNA was
tested in vitro.
It is possible to examine the individual steps of the transposition
process in isolation by approximating the naturally occurring DNA
substrates at different stages of the transposition mechanism using
short radiolabeled oligonucleotides containing the 19-bp ME sequence,
which is recognized by Tnp and defines the end of the transposon.
Incubation of DNA substrates with Tnp in the absence of divalent metal
ions, required for catalytic activity, allows the formation of PECs
containing two DNA molecules and two Tnp molecules (3). These PECs are
analogous to the synaptic complexes that are the context of
transposition. The PECs can be distinguished from free DNA by the
decreased mobility of complexes in native polyacrylamide
electrophoresis. Because coordination of divalent metal ions is
required for catalytic activity, PEC assembly represents the ability of
Tnp to form the nucleoprotein complexes within which the transposition
reactions occur but not the reactions themselves. Incubation of Tnp
with the same radiolabeled oligonucleotides in the presence of divalent
metal ions results in Tnp-mediated processing of substrate DNA.
Denaturing polyacrylamide electrophoresis of the products allows an
analysis of the catalytic reactions (2).
Unnicked Substrate--
An unnicked substrate analogous to
naturally occurring Tn5 DNA, containing both transposon DNA with an
embedded ME sequence and dbb DNA, was used to investigate PEC formation
and transferred strand nicking. This 60-bp substrate was radiolabeled
with 32P at the 5'-end of the transferred strand. PEC
formation was investigated by incubating the unnicked substrate with
Tnp and determining the percentage of DNA shifted on a native gel
because of decreased PEC mobility (Fig.
2). Two of the mutants, D97E and D188E, show a marked decrease in the
ability to form PECs with the unnicked substrate. Without replacing the
chemical group at either position, a carboxyl, the change from
aspartate to glutamate in both mutants has the effect of increasing the
length of the respective amino acid side chains by one additional
carbon atom. This extends the carboxyl group by about 1.5 angstroms. Both of these mutants show a severalfold decrease in the
ability to bind the unnicked substrate. D97E forms PECs with the
unnicked substrate 30% as efficiently as EK/LP, whereas D188E forms
PEC only 22% as well. The opposite change in mutant E326D, which
withdraws the carboxyl group by one carbon atom by replacing the
glutamate with an aspartate, shows no decrease in PEC formation ability
and actually seems to increase preference for the unnicked substrate,
forming PECs 170% as efficiently as EK/LP (Table
I).
The activity of the first catalytic step of transposition, transferred
strand nicking, was investigated by incubating the unnicked substrate
with Tnp and Mn2+. Introduction of a nick by Tnp produces a
labeled 40-mer. Those nicked molecules that undergo hairpin formation
result in a labeled 80-mer. Finally, those hairpins that are resolved
produce a labeled 40-mer (Fig. 3).
Therefore, the amount of DNA that undergoes transferred strand nicking
can be determined by quantitating the percentage of total DNA that
migrates on a denaturing gel at both the 40-mer and 80-mer positions.
The D97E mutant shows no ability to nick the substrate, whereas both
D188E and E326D show decreased nicking, performing the reaction 9 and
34% as efficiently as EK/LP (Table II).
It should be noted that a substantial part of the D188E decreased nicking ability is likely because of its impaired ability to form PECs
with the unnicked substrate.
Prenicked Substrate--
The same assays were performed with a
prenicked substrate that simulates the substrate for the second
catalytic step of the mechanism, hairpin formation. The prenicked
substrate differs from the unnicked substrate only in that the
transferred strand is replaced by two oligonucleotides, to simulate the
transferred strand nick, and that the DNA is radiolabeled at the 5'-end
of the nontransferred strand rather than the transferred
strand (Fig. 4). All three of the mutants
were able to form PECs with high efficiency (Table I). The introduction
of a nick appears to greatly relax constrains on PEC formation. In
catalytic assays, those molecules that are processed into hairpins
produce a labeled 20-mer, which when quantitated via denaturing
polyacrylamide electrophoresis accounts for all hairpin formation. None
of the three mutant proteins facilitates efficient hairpin formation.
E326D carries out this reaction best, with activity reduced to 37% of
EK/LP, followed by D188E with 18%, and finally D97E with 8% (Table
II).
Preformed Hairpin Substrate--
The same assays were performed
with preformed hairpin substrate. A 50-mer self-complementary DNA
molecule, radiolabeled at the 5'-end, was used as the preformed hairpin
substrate (Fig. 4). All three mutants show excellent ability to form
PECs with the preformed hairpin (Table I). In catalytic assays,
resolution of the hairpin releases a labeled 28-mer, which when
quantitated accounts for all hairpin resolution. D188E and E326D show a
severalfold decrease in hairpin resolution activity, 32 and 27% of
EK/LP, whereas D97E is completely defective at this step (Table
II).
Precleaved Substrate--
The final substrate used in this study
was a precleaved molecule that simulates the substrate used for the
final step of transposition, strand transfer. This 40-bp substrate,
containing transposon DNA and ME sequence but no dbb DNA, was labeled
at the 5'-end of both strands (Fig. 4). All three mutants formed PECs
with high efficiency (Table I). None of these mutant proteins was able
to promote transposition in a qualitative in vivo assay
(data not shown).
The DDE motif (residues 97, 188, 326) has been shown
by crystallographic studies to coordinate the divalent metal ions
necessary for the catalytic action of Tn5 Tnp (4, 15). It has also been
shown that all three residues are required for every catalytic step of
transposition. Replacing any of them with an alanine (9) or switching
them to their amide equivalents, aspartate to asparagine and glutamate
to glutamine (data not shown), destroys all activity. Although the DDE
residues are required for catalysis, they are not required for PEC
formation. None of the alanine or amide substitutions substantially
depresses PEC formation. In this study we analyzed the effects of
substituting glutamate for Asp-97 and Asp-188, while changing Glu-326
to an aspartate. The only difference between aspartate and glutamate is
an additional carbon in the glutamate side chain. This should amount to
an ~1.5-angstrom difference in the position of the catalytically
important carboxyl group in any of the three single mutants. D97E and
D188E should result in a slightly deeper insertion of the carboxyl into
the active site at the altered residue, whereas in the case of E326D
the carboxyl should be withdrawn by a similar amount. The obvious consequence of these changes is to increase crowding in the D97E and
D188E mutants, while providing more space in the E326D mutant.
Crystallographic studies reveal the position of DNA substrate in the
active site. However, all existing structural data depicts Tnp
complexed with precut transposon DNA or with DNA containing only one
base of dbb DNA. Consequently, we have no knowledge about the position
of dbb DNA in synaptic complexes. By allowing a comparison of how these
mutations perturb PEC formation, these experiments suggest the position
of dbb DNA in synaptic complexes prior to transferred strand nicking.
Both of the mutations that increase side chain length of the altered
residue, D97E and D188E, dramatically impair PEC formation with the
60-bp unnicked substrate, which resembles the natural substrate for
synaptic complex formation, and for the first catalytic step,
transferred strand nicking. Not surprisingly, the E326D mutant, in
which the side chain is withdrawn from the active site, forms PECs
proficiently. This suggests that the interference with PEC
formation by D97E and D188E is a result of increased crowding. This
observation makes it appear likely that unnicked dbb DNA is positioned
such that it experiences steric interference from the mutationally
extended side chains present in these two proteins.
Other possible explanations, such as a general decrease in ability to
interact with DNA, seem unlikely in light of the undiminished ability
of these mutants to bind prenicked, hairpin, and precleaved substrates.
Both D97E and D188E bind prenicked and hairpin substrates at high
levels. The prenicked substrate has the same number and sequence of
base pairs as the unnicked substrate. The only difference between these
two substrates is the introduction of a transferred strand nick by
annealing two oligonucleotides to the nontransferred strand instead of
one. The introduction of the nick should have the effect of making the
DNA more flexible. Increased flexibility, which could allow the dbb to
avoid steric conflict introduced by either of the mutated side chains,
is consistent with the observation that PEC formation is unimpaired
with the prenicked substrate for all three of the mutants. The
unhampered ability of all three mutants to form PECs with the hairpin
and precleaved substrates, which have no dbb DNA, is also consistent
with the suggestion that it is steric interactions between the dbb and
the mutated residues at positions 97 and 188 that impair PEC formation
with the unnicked substrate.
The possibility that the mutated 97 and 188 residues clash sterically
with dbb DNA suggests a model in which the dbb DNA of the unnicked
substrate normally occupies space that is invaded by the extended side
chains in D97E and D188E. Fig. 5 depicts the active site with the three DDE mutations overlaid on a Tn5 crystal
structure (15). This graphically shows the differences in side chain
length between the unaltered DDE residues and those in the mutant
proteins. The figure shows the mutated side chains in specific
orientations, whereas in reality they can rotate and potentially occupy
space differently than depicted. Consequently, all of the possible
orientations may be responsible for the observed interference with dbb
DNA. Because there is only a limited amount of space that the mutated
side chains can occupy, the possibilities for the location of dbb DNA
are also constrained to the space that can be occupied by the longer
glutamate side chains but not the shorter aspartate side chains at
positions 97 and 188. This indicates that dbb DNA lies directly
adjacent to the active site prior to transferred strand nicking.
Tn5 Transposase Active Site Mutations Suggest Position of Donor
Backbone DNA in Synaptic Complex*
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

View larger version (12K):
[in a new window]
Fig. 1.
A, conservative "cut and paste"
transposition. Tnp monomers bind to each DNA end sequence and then
associate to form the synaptic complex. Within this complex Tnp
catalyzes the three steps that cleave the transposon out of donor
backbone DNA: transferred strand nicking, hairpin formation, and
hairpin resolution. The excised transposon then undergoes target
capture followed by the catalytic strand transfer step, leading to the
covalent linkage of the 3'-ends of the transposon to target DNA in a
staggered fashion. B, three-step cleavage mechanism. Tnp
activates a water molecule that attacks the 3'-end of the transferred
strand. The exposed hydroxyl then acts as a nucleophile to attack the
5'-phosphate of the nontransferred strand to form a hairpin. Tnp then
uses another water molecule to resolve the hairpin, resulting in
blunt-end cleavage.
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

fhuA2 [Ion] ompT
lacZ::T7 gene1 gal sulA11
(mcrC-mrr)114::IS10 R(mcr-73::miniTn10-TetS)2
R(zgb-210::Tn10)(TetS)
endA1 [dcm]) (New England Biolabs). All plasmid
propagation utilized DH5
(endA1 hsdR17(rk
mk+)
glnV44 thi-1 recA1 gyrA (Nalr)
relA1
(lacIZYA-argF)U169 deoR [
80
dlac
(lacZ)M15]) as a host strain.
-mercaptoethanol, 1 mM MnCl2, and 75 µg/ml
tRNA. DNA substrates were added to a concentration of 25 nM. Reactions were incubated at 37 °C for 1 h prior
to denaturing gel electrophoresis.
-mercaptoethanol, and 75 µg/ml
tRNA. DNA substrates were added to a concentration of 25 nM. Reactions were incubated at 37 °C for 1 h prior
to addition of glycerol loading dye. Samples were electrophoresed in an
8% native polyacrylamide gel at 300 V and otherwise handled as
described previously (3) prior to drying and visualization with a
PhosphorImager. Radiolabeled DNA was quantitated using ImageQuant
software. PEC formation is presented as the percentage of total counts
per lane shifted as a result of decreased PEC mobility. All values
represent the average of three independent reactions.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

View larger version (44K):
[in a new window]
Fig. 2.
PEC formation assay with unnicked
substrate. The efficiency of each mutant to form PECs with short
radiolabeled oligonucleotides was determined by gel shift assays.
Incubation of Tnp with unnicked DNA substrate results in the formation
of PECs that have decreased mobility in a native polyacrylamide gel.
The diagram (top) graphically depicts the complexes
that are formed, and an example is shown (bottom) of the
shifts produced by the three DDE mutants, EK/LP, and a no-protein
negative control (
) as visualized on a native gel.
PEC formation with DDE mutants

View larger version (61K):
[in a new window]
Fig. 3.
Transferred strand nicking assay. The
ability of each mutant to catalyze the first step of transposition,
transferred strand nicking, was assayed by incubating Tnp with unnicked
DNA substrates in the presence of Mn+2. Nicking produces a
labeled 40-mer, whereas the following two steps, hairpin formation and
resolution, produce a labeled 80-mer and 40-mer, respectively. Adding
the amount of substrate that migrates as 40 and 80 mers on a denaturing
polyacrylamide gel accounts for all of the substrate that underwent
transferred strand nicking. The diagram (top)
graphically depicts the labeled oligonucleotides that are present at
each reaction step, and an example is shown (bottom) of the
reaction with the DDE mutants, EK/LP, and a no-protein negative control
(
) as visualized on a denaturing gel.
Catalytic reactions with DDE mutants

View larger version (7K):
[in a new window]
Fig. 4.
PEC formation with prenicked, hairpin, and
precleaved substrates, catalytic hairpin formation, and hairpin
resolution assays. Diagrams graphically depict the formation of
PECs with prenicked, hairpin, and precleaved DNA substrates, the
radiolabeled products produced during the catalytic hairpin formation,
and hairpin resolution assays.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

View larger version (56K):
[in a new window]
Fig. 5.
Tn5 active site mutations. A
previous Tn5 crystal structure (15) is depicted with the D97E, D188E,
and E326D mutations superimposed in red over the naturally
occurring residues in green. Tnp is depicted in
blue, DNA from the 19-bp terminal repeat is shown as
gray bases and purple ribbons, and
Mn2+ ions as dark blue spheres. The glutamate
mutations at positions 97 and 188 impair PEC formation with unnicked
substrate. All three mutations impair transferred strand nicking,
hairpin formation, and hairpin resolution, with D97E showing the most
severe inhibition in all three cases.
A relative wealth of structural information is available for Tn5.
Recent crystallographic evidence indicates that the DDE residues
coordinate two divalent metal ions to the active site (15). The results
of the catalytic reactions performed as a part of this study support
this two metal model. Although all three mutations to the DDE motif
retain the carboxyl that is critical for metal ion coordination, it is
reasonable to expect that slightly altering their spatial positions in
the active site would decrease the efficiency with which they perform
this function, which is what was observed. None of the mutants is as
catalytically competent as EK/LP at the nicking, hairpin formation, or
hairpin resolution steps, suggesting that the ions are appropriately
coordinated for these reactions less frequently in the mutant proteins.
According to the two-metal model, Asp-97 is involved in the
coordination of both metal ions, whereas Asp-188 and Glu-326, each
assisting Asp-97 with a different ion, are responsible for only one. If this model is correct and Asp-97 is required for the coordination of
two metal ions, it is likely that any change that perturbs its function
would be more detrimental to catalytic activity than a similar change
to one of the residues that is involved only in coordination of one
metal ion. Of the three catalytic steps tested, D97E shows no activity
at the nicking and hairpin resolution steps and a level of hairpin
formation activity that is drastically reduced from EK/LP and
significantly lower than that of either of the other two mutants. Both
of the other mutations show activity, although reduced from EK/LP, at
the nicking, hairpin formation, and hairpin resolution steps. The
elimination of function at the nicking and hairpin resolution steps and
the relatively more severe reduction of function at the hairpin
formation step caused by the D97E mutation supports the model of an
active site that coordinates two divalent metal ions.
| |
ACKNOWLEDGEMENT |
|---|
We thank Carol Pfeffer for help in preparing the manuscript.
| |
FOOTNOTES |
|---|
* This research work was supported by National Institutes of Health Grant GM 50692.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
To whom correspondence should be addressed. Tel.: 608-262-3608;
E-mail: reznikoff@biochem.wisc.edu.
Published, JBC Papers in Press, November 6, 2002, DOI 10.1074/jbc.M208968200
| |
ABBREVIATIONS |
|---|
The abbreviations used are: Tnp, transposase; EK/LP, mutations E54K and L372P; ME, mosaic end; PEC, paired ends complex; dbb, donor backbone.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Reznikoff, W. S., Bhasin, A., Davies, D. R., Goryshin, I. Y., Mahnke, L. A., Naumann, T., Rayment, I., Steiniger-White, M., and Twining, S. S. (1999) Biochem. Biophys. Res. Commun. 266, 729-734[CrossRef][Medline] [Order article via Infotrieve] |
| 2. |
Bhasin, A.,
Goryshin, I. Y.,
and Reznikoff, W. S.
(1999)
J. Biol. Chem.
274,
37021-37029 |
| 3. | Bhasin, A., Goryshin, I. Y., Steiniger-White, M., York, D., and Reznikoff, W. S. (2000) J. Mol. Biol. 302, 49-63[CrossRef][Medline] [Order article via Infotrieve] |
| 4. |
Davies, D. R.,
Goryshin, I. Y.,
Reznikoff, W. S.,
and Rayment, I.
(2000)
Science
289,
77-85 |
| 5. |
Naumann, T. A.,
and Reznikoff, W. S.
(2000)
Proc. Natl. Acad. Sci. U. S. A.
97,
8944-8949 |
| 6. |
Goryshin, I. Y.,
and Reznikoff, W. S.
(1998)
J. Biol. Chem.
273,
7367-7374 |
| 7. | Zhou, M., Bhasin, A., and Reznikoff, W. S. (1998) J. Mol. Biol. 276, 913-925[CrossRef][Medline] [Order article via Infotrieve] |
| 8. |
Ason, B.,
and Reznikoff, W. S.
(2002)
J. Biol. Chem.
277,
11284-11291 |
| 9. |
Naumann, T. A.,
and Reznikoff, W. S.
(2002)
J. Biol. Chem.
277,
17623-17629 |
| 10. |
Davies, D. R.,
Braam, L. M.,
Reznikoff, W. S.,
and Rayment, I.
(1999)
J. Biol. Chem.
274,
11904-11913 |
| 11. | Bujacz, G., Jaskolski, M., Alexandratos, J., Wlodawer, A., Merkel, G., Katz, R. A., and Skalka, A. M. (1996) Structure 4, 89-96[Medline] [Order article via Infotrieve] |
| 12. |
Bujacz, G.,
Alexandratos, J.,
Wlodawer, A.,
Merkel, G.,
Andrake, M.,
Katz, R. A.,
and Skalka, A. M.
(1997)
J. Biol. Chem.
272,
18161-18168 |
| 13. |
Goldgur, Y.,
Dyda, F.,
Hickman, A. B.,
Jenkins, T. M.,
Craigie, R.,
and Davies, D. R.
(1998)
Proc. Natl. Acad. Sci. U. S. A.
95,
9150-9154 |
| 14. | Allingham, J. S., Pribil, P. A., and Haniford, D. B. (1999) J. Mol. Biol. 289, 1195-1206[CrossRef][Medline] [Order article via Infotrieve] |
| 15. | Lovell, S., Goryshin, I. Y., Reznikoff, W. R., and Rayment, I. (2002) Nat. Struct. Biol. 9, 278-281[CrossRef][Medline] [Order article via Infotrieve] |
| 16. | Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual , p. Appendix A.1, Cold Spring Harbor Press, Cold Spring Harbor, NY. |
| 17. | Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K., and Pease, L. R. (1989) Gene 77, 61-68[CrossRef][Medline] [Order article via Infotrieve] |
| 18. | Bradford, M. M. (1976) Anal. Biochem. 72, 248-254[CrossRef][Medline] [Order article via Infotrieve] |
This article has been cited by other articles:
![]() |
S. Vaezeslami, R. Sterling, and W. S. Reznikoff Site-Directed Mutagenesis Studies of Tn5 Transposase Residues Involved in Synaptic Complex Formation J. Bacteriol., October 15, 2007; 189(20): 7436 - 7441. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Suganuma, P. Pelczar, J. F. Spetz, B. Hohn, R. Yanagimachi, and S. Moisyadi Tn5 Transposase-Mediated Mouse Transgenesis Biol Reprod, December 1, 2005; 73(6): 1157 - 1163. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Baumberger and D. C. Baulcombe Arabidopsis ARGONAUTE1 is an RNA Slicer that selectively recruits microRNAs and short interfering RNAs PNAS, August 16, 2005; 102(33): 11928 - 11933. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Buchner, A. E. Robertson, D. J. Poynter, S. S. Denniston, and A. C. Karls Piv Site-Specific Invertase Requires a DEDD Motif Analogous to the Catalytic Center of the RuvC Holliday Junction Resolvases J. Bacteriol., May 15, 2005; 187(10): 3431 - 3437. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. S. Reznikoff, S. R. Bordenstein, and J. Apodaca Comparative Sequence Analysis of IS50/Tn5 Transposase J. Bacteriol., December 15, 2004; 186(24): 8240 - 8247. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |