Originally published In Press as doi:10.1074/jbc.M302510200 on April 17, 2003
J. Biol. Chem., Vol. 278, Issue 30, 27439-27448, July 25, 2003
Kinetic Mechanism of Non-muscle Myosin IIB
FUNCTIONAL ADAPTATIONS FOR TENSION GENERATION AND MAINTENANCE*
Fei Wang
,
Mihály Kovács
,
Aihua Hu,
John Limouze,
Estelle V. Harvey and
James R. Sellers
From the
Laboratory of Molecular Cardiology, NHLBI, National Institutes of Health,
Bethesda, Maryland 20892-1762
Received for publication, March 11, 2003
, and in revised form, April 14, 2003.
 |
ABSTRACT
|
|---|
Besides driving contraction of various types of muscle tissue, conventional
(class II) myosins serve essential cellular functions and are ubiquitously
expressed in eukaryotic cells. Three different isoforms in the human myosin
complement have been identified as non-muscle class II myosins. Here we report
the kinetic characterization of a human non-muscle myosin IIB subfragment-1
construct produced in the baculovirus expression system. Transient kinetic
data show that most steps of the actomyosin ATPase cycle are slowed down
compared with other class II myosins. The ADP affinity of subfragment-1 is
unusually high even in the presence of actin filaments, and the rate of ADP
release is close to the steady-state ATPase rate. Thus, non-muscle myosin IIB
subfragment-1 spends a significantly higher proportion of its kinetic cycle
strongly attached to actin than do the muscle myosins. This feature is even
more pronounced at slightly elevated ADP levels, and it may be important in
carrying out the cellular functions of this isoform working in small
filamentous assemblies.
 |
INTRODUCTION
|
|---|
Myosins are a superfamily of actin-dependent molecular motors that can be
subdivided into at least 18 classes based on sequence
(1,
2). The "founding
members" of this superfamily, the conventional filament-forming myosins
that participate in muscle contraction and cytokinesis, are now classified as
class II, including three whose products are typically found in the
cytoskeleton and are not directly involved in muscle contraction. These three
myosins are commonly called non-muscle myosins IIA, IIB, and IIC
(NMIIA,1 NMIIB, and
NMIIC, respectively). Like their muscle myosin counterparts, these proteins
are hexameric with two enzymatically active heads that interact with actin and
ATP and a long tail formed by the dimerization of a coiled coil-forming
sequence. Each of the two heads is associated with a pair of low molecular
mass calmodulin-like light chains. NMIIC was recently found upon publication
of the human genome, and little is known about its structure, function, or
cellular localization (2). In
contrast, the NMIIA and NMIIB proteins have been well studied
(35).
The expression of these isoforms is regulated in a cell- and tissue-specific
manner (6,
7). For example, neuronal
tissues are markedly enriched in NMIIB
(8), whereas platelets contain
only NMIIA (9).
Immunofluorescent localization studies have shown that, in some cells, there
is little overlap in the distribution of NMIIA and NMIIB, whereas in other
cells, there is considerable overlap
(9,
10). Both appear to be
components of the contractile ring formed during cell division. Enzymatically,
NMIIB is one of the slowest myosins in terms of its actin-activated MgATPase
activity and the rate at which it translocates actin filaments in
vitro (5,
11).
We show that NMIIB subfragment-1 (S1) has generally slower kinetics at most
steps than those reported for other myosin II isoforms. The most striking
differences in the kinetics of NMIIB compared with that of muscle myosin
isoforms are that it has the highest ADP affinity reported so far, which is,
surprisingly, further elevated by actin, and that its ADP release kinetics is
only about three times faster than the steady-state actin-activated MgATPase
rate. This implies that the strongly actin-bound states can constitute a
rather significant proportion of myosin molecules during steady-state ATP
hydrolysis and that physiological changes in ADP concentration can profoundly
affect the mechanical performance of this myosin and thus have consequences in
exerting its cellular function.
 |
EXPERIMENTAL PROCEDURES
|
|---|
Cloning, Expression, and Purification of the NMIIB S1
Protein cDNA for human NMIIB was truncated at amino acid 843 to
create an S1-like fragment and subcloned into baculovirus transfer vector
pVL1392 (Invitrogen). Nucleotides (GACTACAAGGACGACGATGATAAG) encoding a FLAG
epitope (DYKDDDDK) followed by a stop codon were appended to the C terminus of
NMIIB S1 to aid purification. The complete nucleotide sequence of the
resulting vector was confirmed by double-stranded DNA sequencing. The NMIIB
gene can be alternatively spliced at both loops 1 and 2 in the motor domain to
create longer loops (12). We
have expressed a version that contains the unspliced (non-inserted) version at
each loop. The myosin heavy chain fragment was coexpressed with essential and
regulatory light chains (5).
The expressed NMIIB S1 protein was purified as previously described
(13).
Actin from rabbit skeletal muscle was prepared
(14) and pyrene-labeled as
described (15). Mant-ATP and
mant-ADP were purchased from Molecular Probes, Inc. (Eugene, OR). Other
reagents were from Sigma.
Steady-state Actin-activated ATPase
MeasurementsSteady-state ATPase activities were measured by an
NADH-coupled assay at 25 °C in buffer containing 10 mM MOPS (pH
7.0), 2 mM MgCl2, 0.15 mM EGTA, 1
mM ATP, 40 units/ml lactate dehydrogenase, 200 units/ml pyruvate
kinase, 1 mM phosphoenolpyruvate, and 200 µM NADH.
Changes in A340 (
= 6220
M1 cm1)
were followed in a Beckman DU640 spectrophotometer.
Stopped-flow ExperimentsUnless stated otherwise, all
stopped-flow measurements were done in an SF-2001 stopped-flow apparatus
(KinTek Corp., Austin, TX) at 25 °C in buffer comprising 25 mM
MOPS (pH 7.0), 5 mM MgCl2, 100 mM KCl, and
0.1 mM EGTA. Tryptophan fluorescence was excited at 295 nm, and
emission was selected with a band-pass filter having a peak in transmittance
at 347 nm. Pyrene-labeled actin was excited at 365 nm, and the emitted light
was selected using a 400-nm long-pass cutoff filter. Mant-ATP and mant-ADP
were excited via energy transfer from tryptophan (295 nm excitation), and the
emitted light was selected using a 400-nm long-pass cutoff filter.
Concentrations stated throughout this study refer to cuvette concentrations
unless otherwise indicated.
The kinetics of Pi release from NMIIB S1 or acto-NMIIB S1 was
followed using a mutant bacterial phosphate-binding protein covalently labeled
with N-[2-(1-maleimidyl)ethyl]-7-(diethylamino)coumarin 3-carboxamide
(MDCC-PBP) (16). The
fluorophore was excited at 436 nm (6-nm bandwidth), and the emitted light was
selected through a 450-nm long-pass cutoff filter. Experiments were done in
sequential mixing mode in the SF-2001 stopped-flow apparatus at 25 °C in
buffer comprising 4 mM MOPS (pH 7.1), 2 mM
MgCl2, and KCl at different concentrations (0, 50 or 100
mM). All syringes contained 3 µM MDCC-PBP. All
solutions were preincubated with a "phosphate mop" consisting of
0.02 units/ml purine-nucleoside phosphorylase and 0.1 mM
7-methylguanosine to remove Pi contamination. Actin filaments were
stabilized by addition of an equimolar amount of phalloidin (Calbiochem),
which also abolished the background signal arising from breakdown of ATP by
actin.
Quenched-flow ExperimentsChemical quench measurements were
performed using an RQF-3 quenched-flow apparatus (KinTek Corp.). Samples (15
µl) of S1 or acto-S1 were mixed with an equal volume of ATP containing
[
-32P]ATP. After aging in the delay line, reactions were
stopped by mixing with a solution containing 22% trichloroacetic acid and 1
mM KH2PO4 (to approximately one-third of the
total volume). Pi was extracted from the samples immediately by
adding 250 µl of 5% ammonium molybdate, 650 µl of 0.6 M
H2SO4, 0.3% silicotungstic acid, 0.6 mM
potassium Pi, and 1 ml of a 1:1 mixture of isobutyl alcohol and
toluene. After vortexing for 30 s and a 1-min incubation at room temperature,
0.5 ml of the organic phase was mixed with scintillation mixture and counted.
Total radioactivity in the samples was determined by direct counting of the
[
-32P]ATP solution. Measurements were carried out at 25
°C in buffer comprising 8 mM MOPS (pH 7.1), 1 mM
MgCl2, and 0.1 mM EGTA. In the absence of actin,
addition of 100 mM KCl was required for stability of NMIIB S1. When
necessary, ADP contamination was removed from NMIIB S1 samples by incubation
with 0.01/ml apyrase (Sigma) at 25 °C for 30 min. Column-purified ATP was
used in the experiments to minimize ADP contamination
(17).
Data Analysis and ModelingFitting of the experimental
traces was performed using the KinTek software, SigmaPlot 2001, and Origin 6.0
(Microcal Software). Kinetic simulations were performed with Gepasi Version
3.21 (Pedro Mendes, Virginia Bioinformatics Institute). Means ± S.D.
reported for the kinetic constants are those of three to four separate rounds
of experiment.
 |
RESULTS
|
|---|
Preparation and Steady-state Characterization of NMIIB S1An
NMIIB S1 heavy chain fragment containing 843 amino acids from its amino
terminus was coexpressed along with regulatory and essential light chains in
the baculovirus system. The resulting NMIIB S1 was purified from Sf9 cell
extracts using FLAG affinity chromatography. More than 10 mg of protein could
be prepared from
4 x 109 cells. The expressed S1 had a
basal MgATPase activity of 0.007 ± 0.001
s1 in the absence of actin. MgATPase activities
of S1 at various actin concentrations were fitted to the Michaelis-Menten
equation, giving Vmax = 0.13 ± 0.01
s1 and KATPase
59
µM at 25 °C (Fig.
1). This is one of the lowest Vmax values
recorded for any myosin.

View larger version (9K):
[in this window]
[in a new window]
|
FIG. 1. Steady-state actin-activated MgATPase activity of NMIIB S1. The
MgATPase activities of NMIIB S1 in the absence of actin and of actin alone
were subtracted from the experimentally measured rates and plotted. The curve
is a fit to a hyperbolic Michaelis-Menten equation with
Vmax = 0.13 ± 0.01 s1
and KATPase = 59 ± 3 µM.
|
|
We used a kinetic model of the acto-NMIIB S1 ATPase cycle similar to those
used in recent studies of other myosins
(18,
19). Throughout this work, the
numbering of kinetic steps refers to Scheme
1.
In this model, the actin-associated pathway of ATP binding, hydrolysis, and
product release is shown in the upper line (AM stands for actomyosin), whereas
the lower line represents the same events when myosin (M) is dissociated from
actin (A). The main flux pathway of the reaction is highlighted in boldface.
The equilibrium constants throughout this work are expressed as viewed in a
direction processing to the right in Scheme
1, and those between actin-associated and actin-dissociated states
going in the dissociation direction. Similarly, rate constants have positive
indices in these directions. ATP binding was modeled as a two-step reaction
consisting of a second-order collision step (K1 or
K1') and a subsequent isomerization
(K2 or K2') that becomes
rate-limiting at high ATP concentrations. Although ADP binding (and
dissociation) has been shown to consist of similar events
(20), we consider it as a
single step (K5 or K5') for
simplicity because the substeps were not resolved in the course of this study.
The same holds for the ATP hydrolysis step (K3 or
K3') that has been resolved to a conformational
transition and the actual chemical step
(21), with phosphate release
(K4 or K4') probably being
similar to it in this respect.
Actin BindingAs shown for other myosins
(22), binding of NMIIB S1 or
NMIIB S1·ADP to pyrene-labeled actin decreases pyrene fluorescence
(Schemes 2 and
Scheme 3), where A* represents
the high fluorescence state of actin. The time course of the decrease in
pyrene fluorescence upon rapidly mixing with NMIIB S1 in a stopped-flow
spectrofluorometer could be fitted to a single exponential equation to yield a
pseudo first-order rate constant, kobs
(Fig. 2A,
inset). The dependence of kobs on actin
concentration was linear, and its slope gave an apparent second-order rate
constant (k6) of 0.36 ± 0.04
µM1 s1
(Fig. 2A). This is
slower by a factor of 3 compared with that observed for smooth muscle myosin
(23) and slower by a factor of
>10 compared with those observed for most other classes of myosin
(1). Similarly, the binding of
NMIIB S1·ADP to actin could be measured
(Fig. 2B), where an
apparent second-order rate constant
(k10) of 0.26 ± 0.11
µM1 s1
was obtained. These results are summarized in
Table I.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 2. Kinetics of NMIIB S1 binding to pyrene-labeled actin filaments.
A, dependence of kobs on actin concentration. The
solid line is a linear fit of the data set that gave an apparent
second-order rate constant (k6) of 0.36
± 0.04 µM1
s1. Inset, an averaged time course of
pyrene fluorescence quenching after mixing 1 µM pyrene-labeled
actin with 0.1 µM NMIIB S1. Typically, at least three transients
were averaged for fitting to a single exponential function (solid line,
kobs = 0.30 s1 in the trace
shown). B, dependence of the observed binding rate constant on actin
concentration in the presence of ADP. The solid line is a linear fit
of the data set resulting in an apparent second-order rate constant
(k10) of 0.30
µM1 s1
in the example shown. Inset, an averaged time course of fluorescence
quenching after mixing 1 µM pyrene-labeled actin with 0.1
µM NMIIB-S1 and 2.5 µM ADP, yielding
kobs = 0.34 s1. AU,
arbitrary units.
|
|
View this table:
[in this window]
[in a new window]
|
TABLE I Kinetic parameters of the acto-NMIIB-S1 ATPase cycle
All experiments were done at 25 °C. Equilibrium constants are expressed
as viewed to the right side or downwards in
Scheme 1. Reported S.E. values
are those of three to four different rounds of experiments.
|
|
The actin affinity of NMIIB S1 (K6) can be determined
by measuring the amplitude change in pyrene fluorescence occurring upon the
ATP-induced dissociation of NMIIB S1·pyrene-labeled actin as a function
of NMIIB S1 concentration
(22). In these experiments,
concentrations before mixing are given because these are relevant in terms of
calculation of the equilibrium parameters. The fluorescence amplitude was
measured on mixing 5 µM ATP with a pre-mix of 15 nM
pyrene-labeled actin and various concentrations of NMIIB S1. Fitting the data
to a quadratic binding equation revealed a dissociation constant
(K6) of 3.2 ± 0.3 nM
(Fig. 3A)
(24). Using the same method,
the affinity of NMIIB S1·ADP for actin was also measured, giving
K10 = 1.2 ± 0.4 nM
(Fig. 3B). Hyperbolic
fittings of these same data sets gave K6 = 10
nM and K10 = 11 nM. Because the
dissociation constants are rather low compared with the actin and S1
concentrations used, the determined parameters are likely to represent upper
limits for K6 and K10. Nevertheless,
the results clearly reveal that ADP does not dramatically affect the affinity
of NMIIB S1 for actin (Table
I). From the equilibrium dissociation constant and the on-rate
constant, dissociation rate constants of 0.0012
s1 (k6) and 0.0003
s1 (k10) could be calculated
(Table I).

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 3. Equilibrium binding of NMIIB S1 and NMIIB S1·ADP to
pyrene-labeled actin filaments. A, various concentrations of
NMIIB S1 were mixed with 15 nM pyrene-labeled actin and allowed to
reach equilibrium prior to mixing with 5 µM ATP in the
stopped-flow apparatus (premixing concentrations are indicated in these
experiments). The amplitude of the pyrene fluorescence increase was measured
and plotted as a function of NMIIB S1 concentration. The solid line
is a quadratic fit, yielding K6 = 3.2 ± 0.3
nM. B, shown are the results of a similar experiment,
except that acto-NMIIB S1 and 5 µM ADP were mixed with 50
µM ATP. The fitted data gave a value of 1.2 ± 0.4
nM for K10. AU, arbitrary units.
|
|
ATP-induced Dissociation of Acto-NMIIB
S1Scheme 4 shows
that the fluorescence of pyrene-labeled actin can also be used to monitor the
kinetics of the formation of the weak actin-binding states of myosin upon ATP
binding.
Rapidly mixing MgATP with pyrene-labeled acto-NMIIB S1 causes an increase
in fluorescence levels approaching that of pyrene-labeled actin alone. The
time courses of the mixing experiments followed single exponential kinetics,
and a plot of the observed rate constant of increase versus MgATP
concentration was hyperbolic (Fig.
4A). In the ATP concentration range examined (up to 2.5
mM), the observed rate constant saturated at >150
s1 with a half-maximum above 400 µM
ATP. The apparent second-order association rate constant for MgATP binding to
pyrene-labeled acto-NMIIB S1
(K1'k2') obtained from the
initial slope of the plot at low ATP concentrations was 0.40 ± 0.11
µM1 s1
(average of two experiments) (Fig.
4B).

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 4. ATP-induced dissociation of acto-NMIIB S1 and binding of mant-ATP to
acto-NMIIB S1. A, dependence of kobs on ATP
concentration when mixing 0.04 µM pyrene-acto-NMIIB S1 with ATP.
The solid line is a fit to a hyperbola with a maximal rate of 171
s1. The concentration of ATP at the half-maximal
rate was 439 µM in the example shown. Inset, an
averaged time course of the pyrene fluorescence increase after mixing 0.04
µM pyrene-labeled acto-NMIIB S1 with 50 µM ATP
(kobs = 16.8 s1 in the
example shown). B, kobs versus ATP concentration
at low concentrations of ATP. The deduced second-order rate constant
(K1'k2') was 0.32
µM1 s1
in the example shown. C, dependence of kobs of
mant-ATP binding to 0.05 µM acto-NMIIB S1 on mant-ATP
concentration. The deduced second-order rate constant
(K1'k2') was 0.24
µM1 s1
in the example shown. Inset, mant fluorescence increase upon mixing
0.05 µM acto-NMIIB S1 with 1 µM mant-ATP. The
solid line shows the best single exponential fit, which gave an
observed rate constant of 0.28 s1. AU,
arbitrary units.
|
|
The fluorescent nucleotide mant-ATP increased its fluorescence upon binding
to acto-NMIIB S1 (Fig.
4C), as has been shown to occur for other myosins. The
fluorescence increase observed when mant-ATP was mixed with acto-NMIIB S1
could be fitted to a single exponential equation to determine the observed
rate constant. A plot of kobs versus mant-ATP
concentration is linear and gives an apparent second-order rate constant of
0.24 ± 0.02 µM1
s1, which is in reasonable agreement with the
value for K1'k2' measured
above for the population of the weakly bound states.
ATP BindingThe binding of ATP to myosin in the absence of
actin was followed in two ways. In the first case, the change in tryptophan
fluorescence that occurs in NMIIB S1 upon mixing with ATP, similar to several
other myosin isoforms (20,
25,
26), was monitored. In the
second case, the fluorescence increase in mant-ATP upon binding to myosin was
measured. This reaction was modeled according to
Scheme 5.
NMIIB S1 showed a 810% increase in tryptophan fluorescence upon
mixing with ATP that could be fitted to a single exponential
(Fig. 5A,
inset). The observed rate constant increased hyperbolically with ATP
concentration and saturated at a rate of 16.5 ± 0.2
s1 with a half-saturation at 17.5
µM ATP (Fig.
5A). Thus, at high ATP concentrations, the rate of
fluorescence enhancement was limited by the ATP hydrolysis step, and its
maximal rate reports the rate of ATP hydrolysis
(Scheme 1,
k+3 +
k3). At low ATP concentrations, the
observed rate was limited by the ATP binding process; therefore, it was
linearly dependent upon ATP concentration up to 5 µM ATP, and
the slope gave an apparent second-order rate constant
(K1k2) of 0.72 ± 0.04
µM1 s1
(Fig. 5B). Using
mant-ATP as a substrate, a similar association rate constant (0.65 ±
0.06 µM1 s1) was
obtained (Fig.
5C).

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 5. ATP and mant-ATP binding to NMIIB S1. A, dependence of
kobs of tryptophan fluorescence increase on ATP
concentration. The solid line is a hyperbolic fit to the data,
yielding a maximal observed rate constant of 16.5 ± 0.2
s1 (corresponding to the rate constants of the
hydrolysis step, k3 +
k3) and a concentration of ATP at
half-maximal saturation of the rate at 17.5 µM ATP.
Inset, an averaged time course of the tryptophan fluorescence
increase upon mixing 0.2 µM NMIIB S1 with 4 µM
ATP. The solid line is a single exponential fit with
kobs = 1.5 s1. B,
kobs versus low ATP concentrations. The deduced
second-order rate constant (K1k2) was
0.72 µM1
s1 in the example shown. C, dependence
of kobs of mant-ATP binding to NMIIB S1 on mant-ATP
concentration. The deduced second-order rate constant
(K1k2) was 0.64
µM1 s1 in the
example shown. Inset, averaged time course of the mant fluorescence
increase upon mixing 0.1 µM NMIIB S1 with 1 µM
mant-ATP. The solid line is a single exponential fit with
kobs = 0.75 s1. AU,
arbitrary units.
|
|
ATP HydrolysisThe kinetics of ATP hydrolysis by NMIIB S1
and acto-NMIIB S1 was measured by chemical quench experiments. Similar to
other myosins examined, an initial burst in Pi production was
observed upon mixing NMIIB S1 or acto-NMIIB S1 with excess ATP
(Fig. 6A), indicating
that ATP hydrolysis occurs before the rate-limiting step of the process. The
burst phase was exponential with kobs = 19.8 ± 1.0
s1 in the absence of actin. The
kobs of the burst was identical when NMIIB S1 was mixed
with 50 and 100 µM ATP, indicating that it is not limited by the
nucleotide binding process. Its value is in good agreement with the results of
the stopped-flow experiments monitoring the enhancement of tryptophan
fluorescence (see above), where the rate saturated at 16.5
s1. In the presence of actin, the
kobs of the burst was 11.0 ± 0.6
s1 at 50 µM ATP
(Fig. 6A). The lower
value may result from nucleotide binding being still rate-limiting at this ATP
concentration, because the ATP on-rate of acto-NMIIB S1 is significantly
slower than that of NMIIB S1 (see above.) The burst was followed by a linear
steady-state phase of ATP hydrolysis, where the extent of rate enhancement
caused by 20 µM actin was similar to the results of the
steady-state ATPase measurements (data not shown).
The amplitude of the initial Pi burst
(nPi/nNMIIB S1) can be used
to calculate the equilibrium constant of the hydrolysis step
(K3). This amplitude was unusually low in both the absence
and presence of actin (0.42 ± 0.03 and 0.44 ± 0.05,
respectively), indicating that the hydrolysis step is more reversible in NMIIB
S1 than in any other myosin isoform examined. Because the accuracy of these
results depends on protein concentration measurements and is also affected by
the amount of nonfunctional myosin heads in the preparation, we performed
single turnover ATP hydrolysis experiments that provide an independent measure
of K3. In these experiments, the fraction of ATP
hydrolyzed during the initial process limited by nucleotide binding gives the
burst amplitude. Although reactions did not take place under pseudo
first-order conditions (NMIIB S1 was at only
23-fold molar excess
over ATP), double exponential fits gave reasonable amplitude data for the
burst and slow phases (Fig.
6B). The burst amplitudes (between 0.41 and 0.56) were in
good agreement with the results of the multiple turnover experiments
described. The equilibrium constant of the hydrolysis step calculated using
the averages of the burst amplitudes obtained by different methods
(K3 = A/(1 A), where A
is the burst amplitude) was 0.9 ± 0.3 in the absence and 0.9 ±
0.1 in the presence of 20 µM actin. The ATP hydrolysis step is
fairly reversible in all myosins investigated (e.g. K3 = 9
in skeletal muscle myosin) (1),
but this is the lowest K3 value ever reported. Myosin I
isoforms from Acanthamoeba have similarly low K3
values (
1.5) (27).
Because the observed ATP hydrolysis step has been shown to be composed of a
conformational transition in the protein and of the actual chemical step
(21,
28), a change in any of these
steps can result in the low K3 value reported here.
ADP Binding and DissociationThe binding of mant-ADP to
NMIIB S1 was also monitored by fluorescence
(Fig. 7A,
inset). The kobs was linearly dependent on
mant-ADP concentration over the range tested
(Fig. 7A). The slope
gave a second-order rate constant (k5)
of 0.81 ± 0.23 µM1
s1. The ordinate intercepts reflect the
dissociation rate constant (k5), which was determined to
be 0.58 ± 0.13 s1. A similar linear
dependence of kobs on mant-ADP concentration was observed
when the nucleotide was mixed with acto-NMIIB S1
(Fig. 7B). Here, the
apparent second-order rate constant
(k5') was determined to be 2.41
± 0.13 µM1
s1. The ordinate intercept gives
k5' = 0.35 ± 0.03
s1. This value for the ADP release from
acto-NMIIB S1 is surprisingly low. Most myosin II class molecules, when bound
to actin, have an ADP release rate that is much higher than the steady-state
actin-activated MgATPase rate
(1), but the rate of ADP
release from acto-NMIIB S1 is only about two to three times higher than the
steady-state ATPase rate. Therefore, a different means to determine its value
was used. The decrease in fluorescence upon dissociation of mant-ADP from
either NMIIB S1 (Fig.
8A) or acto-NMIIB S1
(Fig. 8B) upon mixing
with excess ATP was measured to yield independent values of
k5 and k5'. Fitting the
transients to single exponentials gave rates of 0.48 ± 0.11 and 0.38
± 0.09 s1 for the dissociation of mant-ATP
from NMIIB S1 alone and acto-NMIIB S1, respectively, in good agreement with
the values determined in Fig.
7 from the ordinate intercepts.

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 7. Mant-ADP binding to NMIIB-S1 and acto-NMIIB-S1. A,
dependence of kobs of mant-ADP binding to NMIIB S1 on
mant-ADP concentration. The deduced second-order rate constant
(k5) was 0.97
µM1 s1 with a
y intercept (k5) of 0.44
s1 in the example shown. Inset, averaged
time course of the mant-ADP fluorescence increase upon mixing 0.2
µM NMIIB S1 with 2 µM mant-ADP. The solid
line is the best single exponential fit with kobs =
1.97 s1. B, dependence of
kobs of mant-ADP binding to acto-NMIIB S1 on mant-ADP
concentration. The deduced second-order rate constant
(k5') was 2.32
µM1 s1
with a y intercept (k5') of 0.40
s1 in the example shown. Inset, averaged
time course of the mant-ADP fluorescence increase upon mixing 0.2
µM acto-NMIIB S1 with 2 µM mant-ADP. The solid
line is the best single exponential fit with kobs =
4.6 s1. AU, arbitrary units.
|
|

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 8. Mant-ADP dissociation from NMIIB S1 and acto-NMIIB S1. A,
averaged time course of the mant-ADP fluorescence decrease as mant-ADP was
displaced from NMIIB S1 after mixing 0.2 µM NMIIB S1 plus 2
µM mant-ADP with 200 µM ATP. The solid
line is the best single exponential fit, which gave an observed rate
constant (k5) of 0.45 s1 in
the example shown. B, averaged time course of the mant-ADP
fluorescence decrease as mant-ADP was displaced from acto-NMIIB S1 after
mixing 0.1 µM acto-NMIIB S1 plus 0.5 µM mant-ADP
with 200 µM ATP. The solid line is the best single
exponential fit, which gave an observed rate constant
(k5') of 0.40 s1.
AU, arbitrary units.
|
|
The affinity of acto-NMIIB S1 for ADP was measured by premixing 0.04
µM pyrene-labeled acto-NMIIB S1 with various concentrations of
ADP in one syringe of the stopped-flow apparatus and then rapidly mixing with
100 µM ATP (premixing concentrations)
(Fig. 9A,
inset). The resulting transients were fitted to a single exponential
in the absence of ADP and to double exponentials in the presence of ADP. The
rate constant of the fast phase was
40 s1
and corresponded to ATP-induced dissociation of acto-NMIIB S1 in the absence
of nucleotide (see above). The relative amplitude of this phase reflected the
portion of acto-NMIIB S1 free of bound nucleotide. The rate constant of the
slow phase was 0.34 s1 and was limited by ADP
dissociation, which must precede ATP binding. The relative amplitude of this
slow phase represented the fraction of acto-NMIIB S1 molecules that were bound
to ADP. A plot of the relative amplitude of the slow phase (i.e.
Aslow/(Afast + Aslow))
versus ADP concentration was fitted to a quadratic equation to give a
dissociation constant (K5') of 110 ± 30
nM (Fig.
9B), in good agreement with the
K5' value calculated from the on- and off-rate
constants (Table I). This
reflects a very high affinity of NMIIB S1 for ADP in the presence of
actin.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 9. ADP affinity for acto-NMIIB S1. A, 0.04 µM
pyrene-acto-NMIIB-S1 was preinculated with various concentrations of ADP and
mixed with 100 µM ATP (pre-mixing concentrations). Shown is the
ADP dependence of the relative amplitude of the slow phase of the double
exponential fit (i.e. 100% x
Aslow/(Afast +
Aslow)). The data were fitted to a quadratic equation,
yielding a value of 0.11 ± 0.03 µM for
K5' in the example shown. Inset, averaged
time courses of the pyrene fluorescence increase upon mixing 0.04
µM pyrene-labeled acto-NMIIB S1 plus ADP (at the concentrations
indicated) with 100 µM ATP (premixing concentrations). Each
trace was fitted to a double exponential equation. B, amplitudes of
the fluorescence increase upon binding of various concentrations of acto-NMIIB
S1 to 0.2 µM mant-ADP. The data were fitted to a quadratic
binding equation, yielding K5' = 0.017 ±
0.013 µM. Inset, averaged time courses of the mant-ADP
fluorescence increase upon mixing 0.2 µM mant-ADP with
acto-NMIIB S1 at the concentrations indicated (post-mixing concentrations are
indicated). The traces were fitted to single exponentials to determine their
amplitudes. AU, arbitrary units.
|
|
To confirm the high ADP affinity of acto-NMIIB S1, varying concentrations
of stoichiometric acto-NMIIB S1 complexes were mixed with a constant
concentration of 0.2 µM mant-ADP
(Fig. 9B,
inset). The dependence of the amplitude of the increase in mant-ADP
fluorescence on acto-NMIIB S1 concentration
(Fig. 9B) was
analyzed similarly to the pyrene transients described above (except that here
the post-mixing concentrations are relevant) and yielded a value of 17
± 13 nM for K5'. This value is
lower by an order of magnitude even than those obtained by the other methods,
and it contains a considerable error because of the tight binding.
Nevertheless, this measurement also confirms that
K5' is unusually low.
Phosphate ReleasePi release was monitored using
MDCC-PBP (16). When NMIIB S1
was mixed with ATP under single turnover conditions (2 µM
protein and 1.5 µM ATP), the fluorescence increase could be
fitted to a single exponential with kobs = 0.007 ±
0.001 s1 (trace not shown). This value is
identical to the basal steady-state ATPase rate of NMIIB S1 and shows that
phosphate release is rate-limiting in the absence of actin filaments.
Nucleotide binding and hydrolysis are much faster processes even at the low
ATP and protein concentrations used (see above).
To measure the kinetics of Pi release from the weakly
actin-bound states of NMIIB S1, we performed double mixing stopped-flow
experiments in which NMIIB S1 (0.72 µM) was premixed with
ATP (0.51.5 µM) under single turnover conditions,
incubated for 10 s in a delay line to allow sufficient time for ATP binding
and hydrolysis, and then mixed with actin filaments at various concentrations
with concomitant triggering of the record of the MDCC-PBP fluorescence signal.
Single exponential transients with observed rate constants in the order of
0.0100.015 s1 were obtained throughout the
actin concentration range examined (1060 µM)
(e.g. the one in Fig.
10). These values are lower than the steady-state actin-activated
ATPase rates at the corresponding actin concentrations (cf.
Fig. 1). The difference could
be due to the fact that the steady-state assays were performed under very low
ionic strength conditions (no KCl present), whereas in the stopped-flow
experiments described here, at least 50 mM KCl had to be added to
stabilize NMIIB S1 in a solution without actin or nucleotide. (There was no
significant difference between the Pi release transients at 50 and
100 mM KCl.) To test this possibility, we measured the steady-state
actin-activated ATPase activity of NMIIB S1 in 100 mM KCl. The
amount of activation appeared to be very weak under these conditions (an
unchanged basal steady-state rate of 0.007 s1
increased to only
0.018 s1 at 100
µM actin, with no observable sign of saturation), giving
steady-state rates consistent with the above findings. Thus, at least under
the ionic strength conditions examined, phosphate release appeared to be
rate-limiting even in the presence of actin.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 10. Pi release kinetics measured by stopped-flow monitoring
MDCC-PBP fluorescence. The single turnover trace shown () was
obtained upon mixing 0.7 µM NMIIB S1 with 0.5 µM
ATP, incubating for 10 s in a delay line to allow binding and hydrolysis to
occur, and then mixing with 25 µM actin. The fluorescence
increase was fitted to a single exponential with an observed rate constant of
0.013 s1. The time course of the reaction when 30
µM ATP was used is also shown ( ). No initial burst was
observed before the onset of the steady-state period. Inset, same
reactions recorded and plotted on a logarithmic time base, where the absence
of any fast phase is apparent. The amplitude of the fluorescence change in the
single turnover record is in good agreement with the 58-fold
fluorescence increase reported for MDCC-PBP upon Pi binding
(16,
19). AU, arbitrary
units.
|
|
When double mixing experiments were carried out at 30 µM ATP,
no rapid burst in Pi release was observed before the onset of the
linear steady-state period of the reaction
(Fig. 10), which is a further
indication of phosphate release being rate-limiting in the cycle. Taking the
amplitude of the single turnover transients to establish the correspondence
between the extent of MDCC-PBP fluorescence change and the amount of
Pi liberated, the initial slopes of the records calculated
(e.g. 0.011 s1 at 25 µM
actin) were in good agreement with the observed rate constants of the single
turnover reaction (0.013 s1)
(Fig. 10).
 |
DISCUSSION
|
|---|
The detailed kinetic properties of human NMIIB S1 were investigated in this
study to unravel the functional adaptations this conventional myosin has
undergone to exert its cellular function. Compared with its paralogs found in
different types of muscle tissue, NMIIB S1 shows generally slower kinetics
with significantly different ratios of the rate constants at certain steps of
the enzymatic cycle that determine the proportions of the individual ATPase
intermediates and probably also influence its mechanical properties. One
striking feature of NMIIB S1 is the extent of thermodynamic coupling between
the binding of actin and nucleotide. The relation of the actin and ADP binding
equilibria can be deduced from the part of
Scheme 1 containing the
processes related to K5', K6,
K5, and K10. In the absence of any
external free energy influx or consumption, the product of the equilibrium
constants viewed along one direction of the cyclic path must be 1; and thus,
the ratio K5'/K5 should equal
K10/K6. In all of the myosin II
isoforms investigated, actin binding causes a reduction in the affinity for
ADP and vice versa, i.e. the above ratios are higher than unity,
although the extent of the effect varies considerably between different
myosins (Table II). In the case
of NMIIB S1, this ratio is between 0.2
(K5'/K5) and 0.4
(K10/K6). The difference between the
ratios calculated from the different pairs of parameters may originate from
kinetic differences that are often caused by the presence of either the mant
group on the nucleotide or the pyrenyl group on actin
(29) and the uncertainties
caused by tight actin binding. The values obtained from ADP dissociation
constants (K5'/K5) can be
regarded as more relevant because these parameters were determined in several
different types of experiment. This implies that binding of either actin or
ADP has an enhancing effect on the binding of the other ligand, which is a
unique feature among class II myosins.
View this table:
[in this window]
[in a new window]
|
TABLE II Acceleration of ADP release by actin and thermodynamic coupling between
actin and ADP binding in different myosin isoforms
Numbering of steps refers to Scheme
1. ND, not determined.
|
|
The results obtained with the high duty ratio myosins V and VI showed a
high discrepancy between the values of
K5'/K5 and
K10/K6
(18,
19), which was not detected
with other myosins investigated (Table
II). This difference was attributed to an undetected isomerization
of the actomyosin·ADP state similar to that proposed to occur in
brush-border myosin I (30) and
smooth muscle myosin (23).
Nonetheless, in myosins V and VI, actin slightly reduces ADP affinity, similar
to smooth muscle and Dictyostelium myosins
(18,
19,
23,
31).
Generally, a profound effect of actin is to increase the release rate of
both ADP and phosphate. ADP release is accelerated by actin by factors of 250
in skeletal, 130 in cardiac, and 12 in smooth muscle myosins
(Table II)
(1). The distribution of the
ATPase intermediates is largely determined by the relative values of the
individual rate constants. In "fast" motors such as skeletal and
cardiac muscle myosins, ADP release is much faster than the steady-state
ATPase rate; therefore, the actomyosin·ADP species will be present only
in low abundance during steady-state ATP hydrolysis, and the duty ratio
(i.e. the fraction of time spent in strong actin-binding states) will
be low. In contrast, in high duty ratio motors such as myosins V and VI, ADP
release becomes rate-limiting, resulting in high proportions of the strong
actin-binding actomyosin·ADP (and actomyosin) states. We measured the
rate of ADP release from acto-NMIIB S1 (k5') to be
0.35 s1, which is even somewhat slower than
that from NMIIB S1 alone. This value is only about three times higher than the
maximal steady-state actin-activated ATPase rate (0.13
s1). Thus, it appears that two steps with similar
rate constants contribute to rate limitation of the overall process. In our
Pi release experiments carried out at a higher ionic strength
(50100 mM) compared with the steady-state measurements, no
rapid phase of Pi release was detected, unlike in experiments with
skeletal muscle myosin at very low ionic strength
(32) or with myosin V
(18) and myosin VI
(19) at 50 mM KCl.
Our results show that, in NMIIB S1, Pi release is indeed
rate-limiting under these conditions. If we consider the release of
Pi as a two-step process consisting of the binding of
myosin·ADP·Pi to actin (K9) and
the actual Pi dissociation step (K4'; see
Scheme 1) and assume that
myosin·ADP·Pi and
actomyosin·ADP·Pi are in rapid equilibrium
(k9 » k4'), then the
actual observed rate of Pi release will increase hyperbolically
with actin concentration to plateau at k4' (if
Pi dissociation is fairly irreversible), and the actin
concentration at the half-maximal rate will reflect K9.
The observed Pi release rates of NMIIB S1 did not show any sign of
saturation up to 60 µM actin, which implies that the actin
affinity of the myosin·ADP·Pi complex is very low
(K9 > 50 µM) at this ionic strength.
Similar to NMIIB S1, the observed rate of Pi release from myosin V
did not show saturation up to
40 µM actin
(18), whereas the
K9 values were determined to be 3040
µM in myosin VI (50 mM KCl)
(19) and 20 µM
in skeletal muscle myosin (low ionic strength)
(32). Thus, although no direct
measurement of k4' was possible under these
conditions, we can conclude that, at physiologically relevant ionic strengths,
Pi release is rate-limiting in the acto-NMIIB S1 ATPase cycle
because of the high value of K9.
We performed kinetic simulations of the enzymatic cycle with the rate
constants determined experimentally. In these simulations, we set the maximal
rate of Pi release (k4') to 0.13
s1 (taken from the maximal actin-activated ATPase rate) and
K9 to 59 µM assuming that it is reflected in
the steady-state KATPase value. The distribution of the S1
molecules between the strongly and weakly actin-bound (or dissociated) states
appeared to be determined by the relative magnitude of the phosphate and ADP
release rate constants. At saturating ATP and actin concentrations, a
k4' of 0.13 s1 and a
k5' of 0.35 s1 resulted
in
23% of the myosin heads being in the strongly bound
actomyosin·ADP state. The actomyosin state was not significantly
populated under these conditions because of the fast and tight binding of ATP.
This shows that NMIIB S1 may well be an "intermediate duty ratio"
motor with characteristics part way between those of skeletal or smooth muscle
myosin (duty ratio of
4%)
(33) and the high duty ratio
motors myosins V and VI (reported duty ratios of 70 and 8090%,
respectively) (18,
19), where the ADP release
step is rate-limiting. In NMIIB S1, actomyosin·ADP·Pi
remains the predominant intermediate at high actin concentrations. The time
course of Pi release does not show an initial burst phase during
the onset of the steady state (as it does in cases when Pi release
is not rate-limiting (cf. Ref.
19)). Interestingly, the
steady-state rate of Pi release is significantly (
30%) lower
under these conditions than could be expected from the degree of saturation of
the K9 equilibrium and the maximal rate of Pi
release (k4'). This is apparently due to the ADP
release rate constant (k5') being close in value to
k4' because a marked elevation of
k5' abolishes this effect. We also investigated the
effect of ADP concentration on the distribution of the steady-state ATPase
intermediates. The physiological ADP concentration in the cytosol of smooth
muscle cells ranges from 40 to 150 µM
(34,
35).
Fig. 11 shows that, in this
range, the ADP concentration has a significant effect on the abundance of the
actomyosin·ADP state and hence the duty ratio of the acto-NMIIB ATPase
cycle, which can go up to 40% at 100 µM ADP.
The pre-steady-state kinetics presented in this study are totally
consistent with those from previous steady-state ATPase and in vitro
motility experiments (5,
11). The rate of ADP release
from actomyosin·ADP is the slowest yet measured for any myosin; and
because it is thought to be the kinetic step that regulates the rate of actin
filament sliding, it is not surprising that NMIIB heavy meromyosin moves actin
at the slow rate of
0.05 µm/s at 25 °C
(36).
NMIIB is one of three non-muscle myosin II isoforms to be part of the
mammalian genome (2). By the
term "non-muscle," we imply only that the expression of these
myosins is not limited to one or more types of muscle cells. Indeed,
non-muscle myosins have been shown to be components of skeletal muscle cells
and are expressed in some smooth muscle tissues in significant amounts
(37,
38). One recent study using
smooth muscle myosin knockout mice even suggests an important role for
non-muscle myosins in tension maintenance in smooth muscle
(39). Upon prolonged
activation, smooth muscle from mutant mice showed a practically unaltered slow
phase force generation, with the absence of the fast peak that can be assigned
to recruitment of smooth muscle myosin. Furthermore, the magnitude of phase 2
force generation corresponded to the expression level of non-muscle myosin
heavy chains. Thus, a pronounced role of non-muscle myosin II in tension
generation and maintenance was shown, in line with its proposed role in
maintaining cortical tension in other cell types. The very low steady-state
enzymatic activity of non-muscle myosins confers the obvious advantage of
energetic economy within the cell.
Structural results on non-muscle myosin II filaments provide clues to how
the slow ADP release and hence elevated duty ratio of NMIIB can be
functionally important. These filaments have been shown to be much shorter
than those of skeletal or smooth muscle myosin II. Based on electron
micrographs of in vitro assembled non-muscle myosin II filaments, a
model of the bipolar myosin minifilament consisting of
14 myosin
molecules at either end was proposed
(40). Consistent with this
model are the dimensions of minifilaments observed in fibroblasts
(41). Considering the small
number of heads in the appropriate orientation in an individual filament, the
non-muscle myosin heads may need to have considerably higher time-averaged
association with actin compared with muscle myosin filaments to maintain
contact between individual actin filaments and to generate sufficient
tension.
The differences in the localization and function of the different
non-muscle myosin II isoforms are not well resolved. Whether the different
isoforms can assemble into cofilaments in vivo is still a question.
However, the hitherto unique enzymatic properties of NMIIB shed light on how
the essential cellular functions in cytokinesis, cell locomotion, and tension
generation and maintenance are carried out by these isoforms.
 |
FOOTNOTES
|
|---|
* The costs of publication of this article were defrayed in part by the
payment of page charges. This article must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section 1734
solely to indicate this fact. 
Both authors contributed equally to this work. 
To whom correspondence should be addressed: Lab. of Molecular Cardiology,
NHLBI, NIH, Bldg. 10, Rm. 8N202, Bethesda, MD 20892-1762. Tel.: 301-496-6887;
Fax: 301-402-1542; E-mail:
sellersj{at}nhlbi.nih.gov.
1 The abbreviations used are: NMIIA, NMIIB, and NMIIC, non-muscle myosins
IIA, IIB, and IIC, respectively; S1, subfragment-1; mant-,
N-methylanthraniloyl-; MOPS, 4-morpholinepropanesulfonic acid;
MDCC-PBP, N-[2-(1-maleimidyl)ethyl]-7-(diethylamino)coumarin
3-carboxamide-labeled A197C point mutant bacterial phosphate-binding
protein. 
 |
ACKNOWLEDGMENTS
|
|---|
We thank Drs. Earl Homsher and Robert Adelstein for helpful comments on the
manuscript, Yue Zhang for excellent technical assistance, and Dr. Howard White
for the generous gift of MDCC-PBP.
 |
REFERENCES
|
|---|
- Sellers, J. R. (1999) Myosins,
2nd Ed., Oxford University Press, Oxford
- Berg, J. S., Powell, B. C., and Cheney, R. E. (2001)
Mol. Biol. Cell 12,
780794[Abstract/Free Full Text]
- Umemoto, S., and Sellers, J. R. (1990) J.
Biol. Chem. 265,
1486414869[Abstract/Free Full Text]
- Wang, F., Harvey, E. V., Conti, M. A., Wei, D., and Sellers, J. R.
(2000) Biochemistry
39,
55555560[CrossRef][Medline]
[Order article via Infotrieve]
- Pato, M. D., Sellers, J. R., Preston, Y. A., Harvey, E. V., and
Adelstein, R. S. (1996) J. Biol. Chem.
271,
26892695[Abstract/Free Full Text]
- Kawamoto, S., and Adelstein, R. S. (1991)
J. Cell Biol. 112,
915924[Abstract/Free Full Text]
- Buxton, D. B., Golomb, E., and Adelstein, R. S. (2003)
J. Biol. Chem. 278,
1544915455[Abstract/Free Full Text]
- Rochlin, M. W., Itoh, K., Adelstein, R. S., and Bridgman, P. C.
(1995) J. Cell Sci.
108,
36613670[Abstract]
- Maupin, P., Phillips, C. L., Adelstein, R. S., and Pollard, T. D.
(1994) J. Cell Sci.
107,
30773090[Abstract]
- Kelley, C. A., Sellers, J. R., Gard, D. L., Bui, D., Adelstein, R.
S., and Baines, I. C. (1996) J. Cell
Biol. 134,
675687[Abstract/Free Full Text]
- Cremo, C. R., Wang, F., Facemyer, K., and Sellers, J. R.
(2001) J. Biol. Chem.
276,
4146541472[Abstract/Free Full Text]
- Takahashi, M., Kawamoto, S., and Adelstein, R. S.
(1992) J. Biol. Chem.
267,
1786417871[Abstract/Free Full Text]
- Hu, A., Wang, F., and Sellers, J. R. (2002)
J. Biol. Chem. 277,
4651246517[Abstract/Free Full Text]
- Spudich, J. A., and Watt, S. (1971) J.
Biol. Chem. 246,
48664871[Abstract/Free Full Text]
- Cooper, J. A., Walker, S. B., and Pollard, T. D.
(1983) J. Muscle Res. Cell Motil.
4,
253262[CrossRef][Medline]
[Order article via Infotrieve]
- Brune, M., Hunter, J. L., Corrie, J. E. T., and Webb, M. R.
(1994) Biochemistry
33,
82628271[CrossRef][Medline]
[Order article via Infotrieve]
- Wang, F., Chen, L., Arcucci, O., Harvey, E. V., Bowers, B., Xu, Y.,
Hammer, J. A., III, and Sellers, J. R. (2000) J. Biol.
Chem. 275,
43294335[Abstract/Free Full Text]
- De La Cruz, E. M., Wells, A. L., Rosenfeld, S. S., Ostap, E. M.,
and Sweeney, H. L. (1999) Proc. Natl. Acad. Sci. U. S.
A. 96,
1372613731[Abstract/Free Full Text]
- De La Cruz, E. M., Ostap, E. M., and Sweeney, H. L.
(2001) J. Biol. Chem.
276,
3237332381[Abstract/Free Full Text]
- Bagshaw, C. R., Eccleston, J. F., Eckstein, F., Goody, R. S.,
Gutfreund, H., and Trentham, D. R. (1974) Biochem.
J. 141,
351364[Medline]
[Order article via Infotrieve]
- Malnasi-Csizmadia, A., Pearson, D. S., Kovacs, M., Woolley, R. J.,
Geeves, M. A., and Bagshaw, C. R. (2001)
Biochemistry 40,
1272712737[CrossRef][Medline]
[Order article via Infotrieve]
- Kurzawa, S. E., and Geeves, M. A. (1996) J.
Muscle Res. Cell Motil. 17,
669676[CrossRef][Medline]
[Order article via Infotrieve]
- Cremo, C. R., and Geeves, M. A. (1998)
Biochemistry 37,
19691978[CrossRef][Medline]
[Order article via Infotrieve]
- Geeves, M. A., and Jeffries, T. E. (1988)
Biochem. J 256,
4146[Medline]