Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M303245200 on May 13, 2003

J. Biol. Chem., Vol. 278, Issue 30, 27575-27585, July 25, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/30/27575    most recent
M303245200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Torres, B.
Right arrow Articles by Díaz, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Torres, B.
Right arrow Articles by Díaz, E.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Regulation of the mhp Cluster Responsible for 3-(3-Hydroxyphenyl)propionic Acid Degradation in Escherichia coli*

Begoña Torres {ddagger}, Gracia Porras, José L. García and Eduardo Díaz §

From the Department of Molecular Microbiology, Centro de Investigaciones Biológicas, Consejo Superior de Investigaciones Científicas, 28040 Madrid, Spain

Received for publication, March 28, 2003 , and in revised form, May 9, 2003.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS AND DISCUSSION
 REFERENCES
 
The mhp gene cluster from Escherichia coli constitutes a model system to study bacterial degradation of 3-(3-hydroxyphenyl)propionic acid (3HPP). In this work the regulation of the inducible mhp catabolic genes has been studied by genetic and biochemical approaches. The Pr and Pa promoters, which control the expression of the divergently transcribed mhpR regulatory gene and mhp catabolic genes, respectively, show a peculiar arrangement leading to transcripts that are complementary at their 5'-ends. By using Pr-lacZ and Pa-lacZ translational fusions and gel retardation assays, we have shown that the mhpR gene product behaves as a 3HPP-dependent activator of the Pa promoter, being the expression from Pr constitutive and MhpR-independent. DNase I footprinting experiments and mutational analysis mapped an MhpR-protected region, centered at position –58 with respect to the Pa transcription start site, which is indispensable for MhpR binding and in vivo activation of the Pa promoter. Superimposed in the specific MhpR-mediated regulation of the Pa promoter, we have observed a strict catabolite repression control carried out by the cAMP receptor protein (CRP) that allows expression of the mhp catabolic genes when the preferred carbon source (glucose) is not available and 3HPP is present in the medium. Gel retardation assays revealed that the specific activator, MhpR, is essential for the binding of the second activator, CRP, to the Pa promoter. Such peculiar synergistic transcription activation has not yet been observed in other aromatic catabolic pathways, and the MhpR activator becomes the first member of the IclR family of transcriptional regulators that is indispensable for recruiting CRP to the target promoter.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS AND DISCUSSION
 REFERENCES
 
Phenylpropanoic and phenylpropenoic acids and their hydroxylated derivatives are widely distributed in the environment, arising from digestion of aromatic amino acids or as breakdown products of lignin or other plant-derived phenylpropanoids and flavonoids. The bacterial catabolism of these aromatic compounds plays a key role in recycling of such carbon sources in the ecosystem (1, 2). Commonly occurring hydroxycinnamates (caffeate, ferulate, coumarate, etc.) are catabolized via coenzyme A (CoA) derivatives and protocatechuate (2–4). On the other hand, aerobic degradation of phenylpropionic acid, 3-(3-hydroxyphenyl)propionic acid (3HPP)1 and 3-hydroxycinnamic acid usually involves an initial oxygenation step with formation of 2,3-dihydroxyphenylpropionate (2,3-dihydroxyphenylcinnamate) that is further degraded via a meta-cleavage hydrolytic pathway (5). These pathways have been described in different bacterial genera (Pseudomonas, Arthrobacter, Ralstonia, Acinetobacter, Comamonas, Escherichia, Rhodococcus) (5–13), but only a few reports about their genetic characterization have been published (11–15).

The 3HPP (and 3-hydroxycinnamic acid) degradation pathway from Escherichia coli is encoded by the mhp cluster located at min 8.0 of the genome, and it was the first HPP degradation pathway that was described both at the biochemical and genetic levels (5, 14, 16, 17). The 3HPP pathway is initiated by the MhpA monooxygenase that transforms 3HPP into 2,3-dihydroxyphenylpropionate, which is then converted to succinate, pyruvate, and acetyl-CoA through the action of a meta-cleavage hydrolytic route that involves a dioxygenase (MhpB), hydrolase (MhpC), hydratase (MhpD), aldolase (MhpE), and acetaldehyde dehydrogenase (MhpF) activity (5, 17) (Fig. 1). The mhp cluster is arranged as follows: (i) six catabolic genes encoding the initial monooxygenase (mhpA), the extradiol dioxygenase (mhpB), and the hydrolytic meta-cleavage enzymes (mhpCDFE); (ii) a gene (mhpT) that encodes a potential transporter; and (iii) a regulatory gene (mhpR) that is adjacent to the catabolic genes but transcribed in the opposite direction (Fig. 1) (14). A similar gene arrangement has been observed in Klebsiella pneumoniae (17). The mhp cluster of Comamonas testosteroni TA441 also resembles that of E. coli (11). However, the hpp and ohp clusters responsible for the partial catabolism of 3HPP and 2-hydroxyphenylpropionic acid in Rhodococcus globerulus PWD1 (13) and Rhodococcus sp. V49 (12), respectively, show a different gene organization and low sequence similarity with the mhp clusters of Gram-negative bacteria (17).



View larger version (41K):
[in this window]
[in a new window]
  		FIG. 1.
Schematic representation of the mhp cluster and nucleotide sequence of the mhpR-mhpA intergenic region. The mhpR regulatory gene and the Pr promoter are shown as thick black arrows. The mhpABCDFE catabolic genes, the mhpT transport gene, and the Pa catabolic promoter are represented as thick white arrows. + indicates transcriptional activation by the MhpR protein. 3HPP is transformed into succinic acid, pyruvic acid, and acetyl-CoA through a hydrolytic meta-cleavage pathway (MhpABCDEF proteins). Whereas the sequence from nucleotide 819 to nucleotide 1046 is derived from the mhp cluster (accession number Y09555 [GenBank] ), boldface nucleotides at the 3'-end are derived from the BamHI site of the in-frame lacZ fusion in plasmid pRAL (Fig. 2) (14). The translation initiation codon for the mhpR and mhpA genes is shown in lowercase letters. Amino acids are represented by the standard one-letter code abbreviation. Amino acids determined by N-terminal sequencing of MhpR are double underlined. The ribosome-binding site (RBS) is shown in italics. The transcription start sites in the Pa and Pr promoters are double-underlined, and the direction of transcription is indicated by bent arrows. The inferred –10 and –35 regions of each promoter are indicated. The MhpR binding motif (OR) is boxed, and the dyad symmetry is indicated by convergent arrows. The putative CRP-binding motif is shown by brackets. Whereas bent arrows with broken lines above the sequence define the Pa fragment (Pa-f), the bent arrows with broken lines below the sequence define the Pr fragment (Pr-f) used as probes.

 



View larger version (23K):
[in this window]
[in a new window]
  		FIG. 2.
Scheme of the subcloning of the mhp regulatory elements. A, schematic representation of the construction of the mhpR/Pa-lacZ, Pa-lacZ, and Pr-lacZ translational fusions. The mhpR and lacZ genes are indicated by black and hatched blocks, respectively. Thick and thin arrows show the promoters and the direction of transcription of the genes, respectively. The early T7 (T7) and the T4 (T) transcriptional terminators are indicated by black squares. The I and O termini of the hybrid mini-Tn5 transposons are represented by black circles. The replication (oriColE1 and oriR6K) and RP4-mediated mobilization functions (oriTRP4) are also indicated. {Delta}mhpR indicates a truncated mhpR gene. {Delta}mhpR-lacZ codes for an MhpR(100 amino acids)-LacZ(1016 amino acids) fusion protein. Apr and Kmr show the genes encoding ampicillin and kanamycin resistance, respectively. tnp*, gene devoid of NotI sites encoding Tn5 transposase. Relevant restriction sites shown are: B, BamHI; E, EcoRI; H, HindIII; N, NotI; S, Sau3AI; Sm, SmaI. S* indicates that the Sau3AI restriction site is not unique in the plasmid. B/S*, a ligation of compatible ends generated by BamHI/Sau3AI cleavage that cannot be recleaved by BamHI. HindIII (Klenow) indicates digestion by HindIII followed by filling in the protruding ends generated with the E. coli DNA polymerase I Klenow fragment. B, subcloning of the mhpR gene. The relevant elements and restriction sites are represented as in panel A. D, DraIII restriction enzyme. DraIII (Klenow) indicates digestion by DraIII followed by removal of the protruding ends generated with the E. coli DNA polymerase I Klenow fragment. The T1/T2 transcriptional terminators of the E. coli rrnB operon (t) are represented by a black square. Cmr, gene encoding chloramphenicol resistance. The origin of replication (oripSC101) of plasmid pBT18 is shown. 1 and 2, primers MhpR5'and LAC-57, respectively (for details see "Experimental Procedures").

 
Despite a putative regulatory gene that has been identified in all HPP catabolic clusters described so far, there are no reports on the regulation of such clusters, with the exception of the mhpR gene product from E. coli that was shown to be a transcriptional activator of the mhp catabolic genes (Fig. 1) (14). Amino acid sequence comparison analyses revealed that the MhpR protein from E. coli belongs to the IclR family of regulatory proteins (14, 17). Because other IclR-type regulators of aromatic catabolic pathways, i.e. PobR and PcaU of the 4-hydroxybenzoate and protocatechuate degradation in Acinetobacter sp. ADP1 (18, 19), PcaR of the protocatechuate degradation in Pseudomonas putida (20) and Agrobacterium tume-faciens (21), and CatR and PcaR of the catechol and protocatechuate degradation in R. opacus 1CP (22, 23), are controlling ortho-cleavage pathways, the MhpR protein of E. coli becomes the first IclR-type regulator that is controlling the expression of a meta-cleavage pathway for degradation of aromatic compounds. On the other hand, there are no reports on the promoters driving expression of the genes involved in catabolism of HPP. Therefore, the mhp pathway from E. coli constitutes an interesting model system to study regulatory features of the catabolism of HPP in bacteria.

In this work, we have used both genetic and biochemical approaches to study for the first time the transcriptional regulation of an HPP degradation pathway. Superimposed in the specific MhpR-dependent regulation of the mhp catabolic genes from E. coli, the cAMP receptor protein (CRP) acts as a mandatory activator that tightly adjusts the expression of the catabolic genes to the overall growth status of the cell. A peculiar synergistic transcription activation of the mhp genes by the specific MhpR activator and the CRP global regulator is described.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
 REFERENCES
 
Bacterial Strains, Plasmids, and Growth Conditions—The E. coli strains and plasmids used in this work are listed in Table I. Unless otherwise stated, bacteria were grown in Luria-Bertani (LB) medium (24) at 37 °C. Growth in M63 minimal medium (30) was achieved at 30 °C using the corresponding necessary nutritional supplements and 20 mM glycerol or 10 mM glucose as carbon source. When required, 1 mM 3HPP (Lancaster) was added to the M63 minimal medium. Where appropriate, antibiotics were added at the following concentrations: ampicillin (100 µg/ml), chloramphenicol (35 µg/ml), kanamycin (50 µg/ml), and rifampicin (50 µg/ml).


View this table:
[in this window]
[in a new window]
  		TABLE I
Bacteria and plasmids used in this study

 

DNA Manipulations and Sequencing—Plasmid DNA was prepared by the rapid alkaline lysis method (24). Transformation of E. coli was carried out using the RbCl method (24) or by electroporation (Gene Pulser; Bio-Rad). DNA manipulations and other molecular biology techniques were essentially as described (24). DNA fragments were purified using the Gene-Clean (BIO-101, Inc., Vista, CA). Oligonucleotides were synthesized on an Oligo-1000 M nucleotide synthesizer (Beckman Instruments, Inc.). Nucleotide sequences were determined directly from plasmids by using the dideoxy chain termination method (31). Standard protocols of the manufacturer (Applied Biosystems Inc.) were used for AmpliTaq FS DNA polymerase-initiated cycle sequencing reactions with fluorescently labeled dideoxynucleotide terminators. The sequencing reactions were analyzed using an ABI Prism 377 automated DNA sequencer (Applied Biosystems Inc.).

Construction of E. coli Strains Harboring Chromosomal Insertions of the Pa-lacZ and Pr-lacZ Translational Fusions—By means of RP4-mediated mobilization, plasmids pUTRAL, pUTAL, and pUTRL (Table I, Fig. 2A), which contain mini-Tn5Km hybrid transposons expressing mhpR/Pa-lacZ, Pa-lacZ, and Pr-lacZ fusions, respectively, were transferred from E. coli S17–1{lambda}pir into different rifampicin-resistant E. coli recipient strains, i.e. AFMC and AFSB, through biparental filter mating as described previously (25). Exconjugants containing the lacZ translational fusions stably inserted into the chromosome were selected for the transposon marker, kanamycin, on rifampicin-containing LB medium. The resulting strains, AFMCRAL, AFMCAL, AFMCRL, AFSBRAL, AFSBAL, and AFSBRL, and their relevant genotypes are indicated in Table I.

Production of the MhpR Activator—The mhpR gene was expressed from the Plac promoter in the high copy number pPAL plasmid (Table I) and from the Ptrc promoter in the low copy number pBT18 plasmid (Table I). To prepare crude extracts containing the MhpR protein, MhpR+ extracts, E. coli DH5{alpha} (pPAL) cells were grown in ampicillin-containing LB medium to an A600 of about 1. Cell cultures were then centrifuged (3,000 x g, 10 min at 20 °C), and cells were washed and resuspended in 0.05 volumes of 20 mM Tris-HCl buffer, pH 7.5, containing 10% glycerol, 2 mM {beta}-mercaptoethanol, and 50 mM KCl prior to disruption by passage through a French press (Aminco Corp.) operated at a pressure of 20,000 p.s.i. The cell debris was removed by centrifugation at 26,000 x g for 30 min at 4 °C. The clear supernatant fluid was decanted and used as crude cell extract. The MhpR– extracts from E. coli DH5{alpha} (pUC18) cells were prepared in a similar manner. Protein concentration was determined by the method of Bradford (32) using bovine serum albumin as standard.

N-terminal Amino Acid Sequence Determination—The amino-terminal sequence of MhpR was determined by Edman degradation with a 477A automated protein sequencer (Applied Biosystem Inc.). A crude extract of E. coli DH5{alpha} (pRL) cells was loaded in a SDS-polyacrylamide gel, and the MhpR(100 amino acids)-LacZ(1016 amino acids) fusion protein encoded by plasmid pRL was directly electroblotted from the gel onto a polyvinylidene difluoride membrane as previously described (33).

Truncation of the MhpR Binding Motif—To delete one half-site of the MhpR binding motif (operator region, termed OR), plasmid pPAR (Table I) was linearized with the DraIII restriction enzyme and then treated with T4 DNA polymerase. The resulting plasmid, pPAR{Delta}op, was sequenced, and it was shown to harbor the Pa{Delta}op promoter that contains a modified OR region lacking one of its half-sites (9-bp deletion) (Fig. 7A).



View larger version (26K):
[in this window]
[in a new window]
  		FIG. 7.
Characterization of the MhpR-binding site. A, scheme of the construction of plasmids harboring the Pa mutant promoter that contains a truncated OR (Pa{Delta}op). The relevant elements and restriction sites of the plasmids are indicated as in Fig. 2. OR of Pa is shown by convergent arrows. DraIII/T4 DNA polymerase, digestion with the DraIII restriction enzyme followed by treatment with T4 DNA polymerase. The resulting truncated OR in Pa{Delta}op is indicated by an arrow. P, PstI. P*, the PstI restriction site is not unique in the plasmid. B, {beta}-galactosidase ({beta}-Gal) activity of E. coli AFMC cells harboring plasmids pRAL (mhpR/Pa-lacZ) or pRAL{Delta}op (mhpR/Pa{Delta}op-lacZ) grown in LB medium at an A600 of 0.8 in the absence (filled blocks) or presence (empty blocks) of 1 mM 3HPP. C, binding affinity of MhpR to the Pa and Pa{Delta}op promoters. Cell extracts and gel retardation analyses were performed as indicated under "Experimental Procedures." The probe DNAs used, Pa and Pa{Delta}op, were PCR-amplified from plasmids pRAL and pRAL{Delta}op, respectively, as described under "Experimental Procedures." Lanes 2–5, retardation assays containing 100, 150, 200, and 400 ng of total protein, respectively, of MhpR+ extracts obtained from cells bearing plasmid pPAL. Lanes 1 correspond to assays containing 400 ng of total protein of MhpR– extracts obtained from cells bearing the control plasmid pUC18. The probe DNA and the DNA-MhpR complexes are indicated by arrows.

 

Synthesis of DNA Fragments Used as Probes—The target DNA fragments used as probes were generated by PCR using plasmid pRAL (Table I, Fig. 2) as template. To prepare the Pa-Pr fragment (274 bp), primers PP6 (5'-CCGTCTGCTCATTGTTCTG-3', which encodes amino acids 2 to 8 of MhpR and hybridizes with the coding strand of the mhpR gene between nucleotides 831–849 of the mhp gene cluster (Fig. 1) (14)), and LAC-57 (5'-CGATTAAGTTGGGTAACGCCAGGG-3', which hybridizes at 57 nucleotides downstream of the lacZ translational start codon), were used. To prepare the Pa fragment (134 bp), primers PP6 and PA3'(5'-GATTTTTTATTGTGCGCTCAG-3', which hybridizes to the mhpA coding strand at the transcription start region of Pa, see Fig. 1), were used. To obtain the Pr fragment (156 bp), we have used the PR5'(5'-GCGCACAATAAAAAATCATTTAC-3', which hybridizes to the mhpR coding strand at the transcription start region of Pr, see Fig. 1) and LAC-57 primers. The mhpR-Pa fragment (590 bp) was PCR-amplified by using the PP4 (5'-GGTCTTGTTCCGGGCAAAAGGC-3', which hybridizes 438 nucleotides downstream of the ATG start codon of mhpR) and PA3' primers. Finally, to prepare the Pa{Delta}op fragment (125 bp) we have used the PP6 and PA3' primers and the pRAL{Delta}op plasmid (Table I) as template.

Mapping Transcription Start Sites—E. coli DH5{alpha} (pRL) and DH5{alpha} (pRAL) cells were grown in LB medium in the presence of 1 mM 3HPP until the cultures reached an A600 of about 1.0. Total RNA was isolated using the RNA/DNA Midi kit (Qiagen) according to the instructions of the supplier. Primer extension reactions were carried out with the avian myeloblastosis virus reverse transcriptase as described previously (26), using primers LAC-57 and PP6. To determine the length of the primer extension products, sequencing reactions of pRL and pRAL were carried out with the same primers, i.e. LAC-57 and PP6, by using the T7 sequencing kit and [{alpha}-32P]dATP (Amersham Biosciences) as indicated by the supplier. Products were analyzed on 6% polyacrylamide-urea gels. The gels were dried onto Whatman 3MM paper and exposed to Hyperfilm MP (Amersham Biosciences). To confirm the start site(s) of the Pr promoter, total RNAs were used in a reverse transcription-PCR experiment. Whereas primers PP4 and PaTATA (5'-CGCTCAGTATAGGAAGGGTG-3', which hybridizes 9 nucleotides downstream of the major transcription start site of Pr, see Fig. 1) amplified a 578-bp fragment, primers PP4 and Pr10 (5'-TTGTTAAAAACATGTAAATG-3', which hybridizes 3 nucleotides upstream of the major transcription start site of Pr, see Fig. 1) did not amplify any fragment, which confirms the transcription start site(s) of Pr deduced from primer-extension analyses.

Gel Retardation Assays—DNA fragments used as probes were labeled at their 5'-end with phage T4 polynucleotide kinase and [{gamma}-32P]ATP (3000 Ci/mmol) (Amersham Biosciences). The DNA probes were purified by the QIAquick nucleotide removal kit (Quiagen). The reaction mixtures contained 20 mM Tris-HCl, pH 7.5, 10% glycerol, 2 mM {beta}-mercaptoethanol, 50 mM KCl, 0.1 nM DNA probe, 50 µg/ml bovine serum albumin, 50 µg/ml salmon sperm (competitor) DNA, and cell extract or purified CRP (kindly provided by A. Kolb) in a 20-µl final volume. After incubation for 30 min at 30 °C, mixtures were fractionated by electrophoresis in 4% polyacrylamide gels buffered with 0.5x TBE (45 mM Tris borate, 1 mM EDTA). The gels were dried onto Whatman 3MM paper and exposed to Hyperfilm MP (Amersham Biosciences).

DNase I Footprinting Assays—The Pa-Pr DNA fragment to be used as probe was singly 5'-end-labeled at the Pa non-coding strand by using a labeled primer during the PCR amplification reaction. The LAC-57 primer (50 pmol) was 5'-end-labeled with [{gamma}-32P]ATP (3000 Ci/mmol) using T4 polynucleotide kinase. To perform the PCR reaction, 5 pmol of labeled and 7.5 pmol of unlabeled primers were used. The 5'-end-labeled PCR product was purified using the High Pure PCR product purification kit from Roche Applied Science. For DNase I footprinting assays, the reaction mixture contained 20 mM Tris-HCl, pH 7.5, 10% glycerol, 2 mM {beta}-mercaptoethanol, 50 mM KCl, 10 mM EDTA, 1 nM DNA probe, 50 mg/ml bovine serum albumin, and cell extract in a 25-µl final volume. This mixture was incubated for 20 min at 30 °C, after which 0.15 units of DNaseI (Amersham Biosciences) (prepared in 10 mM CaCl2, 50 mM MgCl2, 125 mM KCl, and 10 mM Tris-HCl, pH 7.5) was added and the incubation continued at 37 °C for 30 s. The reaction was stopped by the addition of 180 µl of a solution containing 0.4 M sodium acetate, 2.5 mM EDTA, 50 µg of tRNA/ml, and 5 µg of salmon DNA/ml. After phenol-chloroform extraction, DNA fragments were precipitated with ethanol absolute, washed with 70% ethanol, dried, and directly resuspended in 5 ml of 90% (v/v) formamide-loading gel buffer (10 mM Tris-HCl, pH 8.0, 20 mM EDTA, pH 8.0, 0.05% (w/v) bromphenol blue, 0.05% (w/v) xylene cyanol). Samples were then denatured at 95 °C for 2 min and fractionated in a 8% polyacrylamide-urea gel. A+G Maxam and Gilbert reactions (34) were carried out with the same fragments and loaded in the gels along with the footprinting samples. The gels were dried onto Whatman 3MM paper and exposed to Hyperfilm MP.

{beta}-Galactosidase Assays—{beta}-Galactosidase activities were measured with permeabilized cells as described by Miller (30).


   RESULTS AND DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS AND DISCUSSION
REFERENCES
 
In vivo Characterization of the Pa and Pr Promoters and Their Specific Regulation—As mentioned above, the mhpR regulatory gene is transcribed in the opposite direction to that of the mhpABCDFE catabolic genes involved in 3HPP degradation in E. coli (Fig. 1). Therefore, the intergenic mhpR-mhpA region should contain the Pr and Pa promoters driving expression of the mhp regulatory and catabolic genes, respectively. Whereas the ATG translational start codon of the first catabolic gene (mhpA) has been identified, two potential start codons of the regulatory mhpR gene were proposed (14). To define precisely the intergenic mhpR-mhpA region, we have determined the N-terminal amino acid sequence of MhpR as indicated under "Experimental Procedures." Because the N-terminal sequence of MhpR was shown to be MQNNEQT, the mhp intergenic region spans from nucleotide 850 (ATG of mhpR) to nucleotide 1043 (ATG of mhpA) within the reported sequence of the mhp cluster, and MhpR (277 amino acids) becomes 4 amino acids shorter than previously proposed (14) (Fig. 1).

To study the Pa and Pr promoters of the mhp cluster, a 0.5-kb DNA fragment containing the intergenic mhpR-mhpA region was PCR-isolated and ligated, at both orientations, to the lacZ reporter gene of the promoter-probe vector pSJ3 (Table I), generating the translational fusion plasmids, pAL (Pa-lacZ) and pRL (Pr-lacZ) (Fig. 2A). Moreover, to analyze the role of the mhpR regulatory gene on the Pa and Pr promoters, we have engineered plasmid pRAL (mhpR/Pa-lacZ), which harbors the mhpR gene under control of its own promoter in cis, to the Pa-lacZ reporter fusion in a pSJ3 derivative (Fig. 2A), and pPAL (Plac-mhpR), which encodes the mhpR gene under control of the heterologous Plac promoter (Fig. 2B). To avoid the high copy number of the pSJ3 derivatives and, thus, to analyze faithfully the mhp regulatory system, the Pa-lacZ, Pr-lacZ, and mhpR/Pa-lacZ fusions were subcloned as NotI-DNA cassettes within mini-Tn5 vectors, giving rise to plasmids pUTAL, pUTRL, and pUTRAL, respectively (Fig. 2A), which were used to deliver by transposition the corresponding translational fusions into the chromosome of E. coli AFMC (Table I). The presence of a strong T7 phage transcriptional terminator downstream of the lacZ fusions and the orientation of such fusions within the mini-Tn5 elements (Fig. 2A) prevented read-through transcription from nearby promoters after insertion into the chromosome of the resulting E. coli strains, AFMCAL (Pa-lacZ), AFMCRL (Pr-lacZ), and AFMCRAL (mhpR/Pa-lacZ) (Table I).

The {beta}-galactosidase assays of permeabilized E. coli AFMCRAL cells grown in glycerol-containing minimal medium in the presence or in the absence of 3HPP revealed that Pa activation was only observed in the presence of 3HPP (Fig. 3A). To check the influence of the MhpR protein on the expression of the reporter Pa-lacZ and Pr-lacZ fusions, plasmid pPAL (Plac-mhpR) was introduced in E. coli AFMCAL and AFMCRL strains, and {beta}-galactosidase assays of permeabilized cells grown in glycerol-containing minimal medium in the presence or in the absence of 3HPP were carried out. Whereas expression of the Pa-lacZ fusion required the presence of the mhpR gene and the 3HPP inducer (Fig. 3B), the Pr-lacZ fusion was expressed constitutively both in the presence and in the absence of MhpR and 3HPP (Fig. 3, C and D). These data taken together indicate that MhpR is a 3HPP-dependent activator of the Pa promoter, being the expression of the mhpR gene constitutive and MhpR-independent. In this sense, MhpR shows a distinct regulatory feature when compared with other IclR-type regulators of aromatic catabolic pathways, e.g. PcaR from P. putida and PobR and PcaU from Acinetobacter sp. ADP1, all of which act as transcriptional activators of the cognate catabolic genes, but they behave as repressors of their own expression (35–37). Moreover, it is known that some IclR-type regulators, such as PcaU, act on the same promoter both as transcriptional activators, in the presence of the cognate inducer, and repressors, in the absence of the inducer molecule (38). However, this dual regulatory role was not observed with the MhpR activator and the Pa promoter because no {beta}-galactosidase activity was observed in E. coli AFMCAL cells that lack the mhpR gene (data not shown).



View larger version (23K):
[in this window]
[in a new window]
  		FIG. 3.
{beta}-Galactosidase activity of E. coli cells harboring Pa-lacZ and Pr-lacZ translational fusions. E. coli AFMCRAL (A), AFMCAL (pPAL)(B), AFMCRL (C), and AFMCRL (pPAL)(D) were grown in glycerol-containing minimal medium in the presence (filled symbols) or absence (empty symbols) of 1 mM 3HPP. Values for {beta}-galactosidase ({beta}-Gal) activity (in Miller units) were determined along the growth curve as indicated under "Experimental Procedures." Results of one experiment are shown, and values were reproducible in three separate experiments.

 

To determine the transcription initiation sites in the Pa and Pr promoters, primer extension analyses were performed with total RNA isolated from E. coli DH5{alpha} cells containing plasmids pRAL and pRL (Fig. 4). The transcription initiation site in the Pa promoter was mapped 91 nucleotides upstream of the ATG translation initiation codon of the mhpA gene, showing putative –10 (TATACT) and –35 (TTGTAG) boxes typical of {sigma}70-dependent promoters (Fig. 1). A major transcription initiation site was located in the Pr promoter 107 nucleotides upstream of the ATG translation initiation codon of the mhpR gene (Fig. 1). Although a second transcription initiation site in Pr could be located four nucleotides downstream of the major initiation site (Fig. 4), we cannot rule out that such a start site could correspond to the 5'-end of a processed transcript that is initiated at the major transcription start site. Two putative –10 boxes (AATGAT, TGTAAA) and the absence of consensus –35 regions characterize the Pr promoter (Fig. 1). Interestingly, the Pr and Pa promoters in the mhp cluster originate two mRNA transcripts whose first 10 nucleotides are complementary, a peculiar arrangement that has not been described yet in other aromatic catabolic clusters and that could imply a new regulatory mechanism that requires further study.



View larger version (62K):
[in this window]
[in a new window]
  		FIG. 4.
Identification of the transcription start sites in the Pa and Pr promoters. Total RNA was isolated from E. coli DH5{alpha} cells bearing the lacZ translational fusion plasmids pRAL (Pa-lacZ) (A) and pRL (Pr-lacZ) (B), as described under "Experimental Procedures." The sizes of the extended products (lanes Pa and Pr) were determined by comparison with the DNA sequencing ladder (lanes A, C, G, T)ofthe Pa and Pr promoter regions. Primer extension and sequencing reactions were performed with primers LAC-57 (A) and PP6 (B) as described under "Experimental Procedures." An expanded view is shown of the nucleotide sequence surrounding the transcription initiation site(s) (asterisks) in the non-coding strands.

 

Binding of MhpR to the Pa and Pr Promoters—To demonstrate the interaction of the MhpR regulatory protein with the intergenic mhpR-mhpA region, cell-free extracts from E. coli DH5{alpha} (pPAL) were subjected to gel retardation assays using as probe a 274-bp fragment carrying the mhp intergenic region (Pa-Pr probe). Whereas extracts containing MhpR were able to retard the migration of the Pa-Pr probe in a protein concentration-dependent manner, control extracts prepared from E. coli DH5{alpha} (pUC18) cells did not (Fig. 5A), which suggests a specific binding of the MhpR protein to the Pa-Pr probe even in the absence of the 3HPP inducer. To determine whether MhpR binds to the Pa and Pr promoters or, on the contrary, binds to only one of these two promoters, gel retardation assays were carried out using the 120-bp Pa probe (contains the Pa promoter) and the 157-bp Pr probe (contains the Pr promoter) (Fig. 1). Whereas the pattern of retardation of the Pa probe at different concentrations of the MhpR protein (Fig. 5B) was similar to that observed with the Pa-Pr probe (Fig. 5A), no shifted band was observed with the Pr probe even when up to 1 µg of MhpR+ extract was added to the retardation assay (Fig. 5C). These data reveal that the target site for MhpR binding is the Pa rather than the Pr promoter. Moreover, because the binding of MhpR to the Pa-Pr and Pa probes appears to be similar, the interaction of the regulatory protein with its target DNA does not require the Pr promoter region. These data taken together are in agreement with the lacZ-reporter fusion experiments reported above showing that MhpR activates transcription from Pa but does not cause any significant effect on the Pr promoter.



View larger version (33K):
[in this window]
[in a new window]
  		FIG. 5.
Gel retardation analyses of MhpR binding to the mhpR-mhpA intergenic region. Cell extracts and gel retardation analyses were performed as indicated under "Experimental Procedures." The probe DNAs used, Pa-Pr (A and D), Pa (B), and Pr (C), were PCR-amplified from plasmid pRAL as described under "Experimental Procedures." A and B, lanes 2–5 show retardation assays containing 100, 150, 200, and 400 ng of total protein, respectively, of MhpR+ extracts obtained from cells bearing plasmid pPAL. A and B, lanes 1 correspond to assays containing 400 ng of total protein of MhpR– extracts obtained from cells bearing the control plasmid pUC18. C, lanes 1 and 2 show retardation assays containing 1 µg of total protein obtained from cells bearing plasmid pUC18 (MhpR–) and pPAL (MhpR+), respectively. D, gel retardation assays containing 200 ng of total protein of MhpR+ extracts in the absence (lane 1) or the presence of increasing concentrations of 3HPP: 0.1 mM (lane 2), 0.5 mM (lane 3), and 1.0 mM (lane 4). The DNA probes and the DNA-MhpR complexes are indicated by arrows.

 

Gel retardation assays were also carried out in the presence of different concentrations of the 3HPP inducer molecule at a concentration of MhpR that did not retard completely the migration of the Pa-Pr probe. As shown in Fig. 5D, increasing concentrations of 3HPP improved retardation of the DNA probe, which indicates that although 3HPP is not indispensable for binding of MhpR to the mhp intergenic region in vitro, this inducer molecule facilitates such interaction. Binding of an activator to the target DNA regardless of the presence or absence of the inducer has been also observed with other regulatory proteins of the IclR family (38) as well as with members of other families of regulatory proteins involved in catabolism of aromatic compounds (39, 40). In all these cases, binding of the inducer to the regulatory protein will modify the interaction of such regulators with the RNA polymerase leading to transcriptional activation at the corresponding promoter (40). Further work needs to be carried out to understand the molecular basis of the 3HPP-mediated induction of the Pa promoter.

Characterization of the MhpR-binding Site—To identify the MhpR-binding site (operator) within the Pa promoter region, DNase I footprinting experiments were performed using the Pa-Pr probe and increasing concentrations of MhpR. As shown in Fig. 6, the MhpR activator protected an OR region centered at position –58 with respect to the transcription start site in Pa promoter (Fig. 1). The OR sequence corresponds to a 17-bp imperfect palindromic motif, GGTGCACCTGGTGCACA, with its pseudo-dyad axis through the central T base (underlined) that defines two 8-bp half-sites. Analyses of the putative mhp clusters from E. coli O157:H7 (41) and K. pneumoniae (data base of unfinished microbial genomes at the NCBI server: www.ncbi.nlm.nih.gov/cgi-bin/Entrez/genom_table_cgi), as well as the mhp cluster from C. testosteroni (11), revealed the existence within the presumed Pa promoters of a 17-bp palindromic region (TGTGCACCTGGTGCACA, the central T is an A in C. testosteroni). This region is almost identical to OR of Pa from E. coli K-12 but carrying a T instead of a G as the first nucleotide of the left half-site and, thus, constituting a perfect palindromic repeat. Therefore, all these data strongly suggest that OR is essential for Pa activity. As observed in Fig. 6, increasing concentrations of total protein present in the extracts caused DNaseI protection in the –35 region of the Pa promoter, which may reflect binding of the RNA polymerase to such a region.



View larger version (63K):
[in this window]
[in a new window]
  		FIG. 6.
DNase I footprinting analyses of the interaction of MhpR with the Pa promoter region. The DNase I footprinting experiments were carried out using the Pa-Pr probe labeled at the 5'-end of the non-coding strand of Pa as indicated under "Experimental Procedures." Lanes 1 and 3–6 show footprinting assays containing 0, 10, 20, 50, and 100 ng of total protein of MhpR+ extracts, respectively. Lane 2 corresponds to a footprinting assay with 100 ng of total protein of MhpR– extracts. Lane AG shows the A+G Maxam and Gilbert sequencing reaction. Protected region (OR) is indicated by brackets, and an expanded view of the nucleotide sequence surrounding such region is shown. The nucleotide sequence of OR is marked by a thick line. The –35 region of the Pa promoter is also indicated.

 

To confirm the critical role of OR in the MhpR-dependent activation of the Pa promoter, a modified OR that lacks one of its half-sites was engineered in a mutant Pa promoter (Pa{Delta}op) in plasmid pPAR{Delta}op (Fig. 7A). Plasmid pPAR{Delta}op was then used to substitute the wild-type Pa promoter in plasmid pRAL by Pa{Delta}op, giving rise to plasmid pRAL{Delta}op (Fig. 7A). The MhpR-dependent activation of the Pa-lacZ and Pa{Delta}op-lacZ fusions was checked in vivo by assaying {beta}-galactosidase activity in E. coli AFMC cells harboring plasmids pRAL and pRAL{Delta}op, respectively. As shown in Fig. 7B, the activation of the Pa{Delta}op-lacZ fusion showed a 10-fold reduction compared with that observed with the wild-type Pa-lacZ fusion, thus indicating that deletion of one half-site in OR causes a significant reduction in the MhpR-dependent Pa activity. The effect of the half-site deletion of OR on binding of MhpR to the Pa promoter was also analyzed by using the wild-type Pa and the mutant Pa{Delta}op fragments as probes in gel retardation assays. Whereas increasing concentrations of MhpR caused retardation of the Pa probe, the Pa{Delta}op probe remained unshifted even at the highest amount of MhpR tested (Fig. 7C). Therefore, these data taken together indicate that the 17-bp palindromic OR is the binding site of the MhpR regulator to activate the Pa promoter.

Other activators of aromatic catabolic pathways that belong to the IclR family, such as PobR and PcaU from Acinetobacter sp. ADP1 and PcaR from P. putida, also recognize 17-bp palindromic operator regions with its pseudo-dyad axis through a central base and whose consensus sequence (TGTTCGATAATCGCACA) (19) resembles that of OR from E. coli and its homologs from K. pneumoniae and C. testosteroni (identical nucleotides are underlined). However, whereas in E. coli, and most probably in K. pneumoniae, the MhpR-binding site is located 50 nucleotides upstream of the transcriptional start site of the corresponding promoter, in Acinetobacter sp. ADP1 the PobR- and PcaU-binding sites are located 72 nucleotides upstream of the transcription start sites of the pobA and pcaI genes, respectively (19), and in P. putida the two adjacent PcaR-binding sites are located 4 nucleotides upstream of the pcaI transcriptional start site (36). The different locations of the operators within the respective regulatory regions have been shown to reflect significant differences in the mechanism of transcriptional activation by the cognate regulatory proteins (36, 38).

CRP Mediates a Superimposed Level of Regulation on the Pa Promoter—It is known that some aromatic catabolic pathways in E. coli, such as the paa, hca, hpa, and mao-encoded pathways responsible for the catabolism of phenylacetate, phenylpropionate, 4-hydroxyphenylacetate, and 2-phenylethylamine, respectively, are repressed by the presence of glucose in the culture medium (26, 27, 42–45). To check whether the mhp cluster is also under catabolite repression control, E. coli AFMCRAL cells were grown in glycerol- or glucose-containing minimal medium in the presence of 3HPP. Whereas permeabilized cells showed {beta}-galactosidase activity when grown in glycerol and 3HPP, no activity was observed when the cells were grown in glucose and 3HPP (Fig. 8A), thus suggesting a repression effect on Pa activity by glucose. To analyze whether the glucose effect was carried out directly on the Pa promoter or, on the contrary, it was because of a repression of the mhpR-encoded transcriptional activator, we tested the expression of the Pr-lacZ fusion in E. coli AFMCRL cells. The {beta}-galactosidase levels in E. coli AFMCRL cells grown in glycerol were only 1.6-fold higher than those of cells growing in glucose as carbon source (data not shown), suggesting that the glucose effect on mhp expression is carried out mainly at the level of the Pa promoter. This observation was confirmed by assaying the Pa-lacZ expression in E. coli AFMCAL cells containing plasmid pBT18 (Fig. 2B), which expresses the mhpR gene under the control of Ptrc, a promoter that is not repressed by glucose. Whereas permeabilized E. coli AFMCAL (pBT18) cells grown in glycerol and 3HPP showed {beta}-galactosidase activity, no significant activity was detected when cells were grown in glucose and 3HPP (Fig. 8B). These data taken together reveal that mhp catabolite repression control is accomplished mainly through the Pa promoter.



View larger version (26K):
[in this window]
[in a new window]
  		FIG. 8.
Effect of CRP on expression and binding to the Pa and Pr promoters. A and B, in vivo CRP effect on Pa and Pr promoter activity in isogenic E. coli AFMC (CRP+) (empty blocks) and AFSB (CRP–) (filled blocks) cells. E. coli AFMCRAL and AFSBRAL (mhpR/Pa-lacZ) (A) and E. coli AFMCAL and AFSBAL harboring pBT18 (Pa-lacZ; Ptrc-mhpR) (B) were grown in glycerol- or glucose-containing minimal medium in the presence of 1 mM 3HPP until the cultures reached an A600 of 0.8. Values for {beta}-galactosidase activity in permeabilized cells are shown (in Miller units). Results of one experiment are shown; values were reproducible in three separate experiments. C, CRP binding to the mhpR-mhpA intergenic region. Gel retardation analyses were performed as indicated under "Experimental Procedures" but adding 200 µM cAMP to the reaction mixture and to the electrophoresis buffer. The probe DNAs used (Pa-Pr, mhpR-Pa, and Pr) were PCR-amplified from plasmid pRAL as described under "Experimental Procedures." – and + indicate the absence and presence, respectively, of 250 nM purified CRP and 1 µg of total protein of MhpR+ extracts. The unbound probe DNAs, the probe/MhpR complexes, and probe/MhpR/cAMP-CRP complexes are indicated by arrows.

 

Because the glucose repression effect is usually mediated by the CRP-cAMP complex in enteric bacteria (46, 47), we checked whether CRP was necessary for mhp expression. To accomplish this, the mhpR/Pa-lacZ, Pa-lacZ, and Pr-lacZ translational fusions were integrated into the chromosome of an isogenic CRP– strain, E. coli AFSB. When E. coli AFSBRAL and E. coli AFSBAL (pBT18) CRP– strains (Table I) were grown either in glycerol- or glucose-containing minimal medium in the presence of 3HPP, no {beta}-galactosidase activity was observed (Fig. 8, A and B). On the contrary, CRP– E. coli AFSBRL cells (Table I) growing in glycerol-containing medium showed {beta}-galactosidase levels that were only 1.6-fold lower than that of CRP+ E. coli AFMCRL cells growing in the same medium (data not shown). Therefore, these data reveal that whereas activity of the Pr promoter is not strictly dependent on CRP, this global regulator is essential for Pa activity and accounts for the repressor effect of glucose on the expression of the mhp catabolic genes. The CRP-dependent regulation level of the 3HPP catabolic pathway of E. coli is, then, superimposed to the specific MhpR-dependent regulation; it allows the expression of the mhp catabolic genes when the preferred carbon source (glucose) is not available and 3HPP is present in the medium. A similar dependence on the CRP-cAMP complex was described in E. coli for the expression of the hpa and paa clusters involved in 4-hydroxyphenylacetate and phenylacetate degradation pathways, respectively (27, 44). A possible explanation for this tight CRP-mediated regulation may be because aromatic compounds can enter the cell by passive diffusion; therefore, the repression of an uptake mechanism (inducer exclusion) used as an additional control to prevent leakage in the activity of standard CRP-dependent promoters, such as Plac (48), cannot be applied to regulate aromatic catabolic pathways.

To confirm the in vivo experiments reported above, gel retardation assays were performed with purified CRP in the presence of cAMP and the Pa-Pr fragment as probe. Interestingly, CRP was not able to bind to the Pa-Pr probe unless MhpR was also present in the retardation assay, thus generating a ternary DNA-CRP-MhpR complex (Fig. 8C). A similar pattern of band shifting was observed when the DNA probe used was the mhpR-Pa fragment that contains the Pa promoter but lacks the Pr promoter region (Fig. 8C). On the contrary, when using the Pr probe that contains the Pr promoter but lacks the Pa region, no binding of MhpR and/or CRP was observed (Fig. 8C). Binding of the CRP-cAMP complex to the Pa promoter but not to the Pr promoter is, therefore, in agreement with the genetic experiments showing a CRP-dependent activation of Pa. Sequence analysis of the Pa promoter revealed the existence of a potential CRP-binding site (TTCTGCATATTAATTGACATTT) centered at position –95.5 relative to the transcription start point of Pa (Fig. 1). However, the left half-site of such a binding motif poorly matches with the consensus sequence (AANTGTGANNTNNNTCACANTT) for CRP-binding (47), which could explain the lack of interaction of CRP with the Pa promoter and the observation that MhpR is strictly necessary for binding of CRP to its target DNA. Such co-dependence upon two transcription activators, that is, the fact that MhpR is essential for the binding of the second activator (CRP), is a mechanism widely used in eukaryotes, but few examples have been reported in prokaryotes (49). MhpR becomes the first regulator of the IclR family that is reported to be indispensable for recruiting CRP to the cognate promoter, and no example of such co-dependence has yet been observed for other regulators of aromatic catabolic pathways. The A-tract located between the putative CRP-binding site and the MhpR-binding site (OR) (Fig. 1) may act as an UP element (50) facilitating the interaction of the RNA polymerase {alpha}C-terminal domain with the promoter and CRP, according to a class I mechanism of CRP-dependent activation (51). Future efforts will be directed to understanding the synergy between CRP and MhpR and the molecular mechanisms governing the transcriptional activation of the Pa promoter.

The synergistic transcription activation by the CRP-cAMP complex and the MhpR activator allows us to classify the Pa promoter of the mhp cluster as a class III CRP-dependent promoter (51). The Pg promoter of the hpa cluster for 3,4-dihydroxyphenylacetic acid degradation and the Pa and Pz promoters of the paa cluster for phenylacetic acid degradation in E. coli can also be considered class III CRP-dependent promoters because they require both CRP and the integration host factor protein as transcriptional activators (27, 44). However, all these promoters show different architectures, and whereas the Pa promoter of the mhp cluster requires a pathway-specific activator (MhpR), promoters from the hpa and paa clusters are controlled by the cognate pathway-specific HpaR and PaaX repressors, respectively (27, 42, 44). This suggests that the molecular mechanisms of transcriptional regulation of the aromatic catabolic clusters in E. coli are highly diverse, and they constitute a useful model system to unravel complex regulatory circuits that involve specific and overimposed levels of regulation.


   FOOTNOTES
 
* This work was supported by European Union Contract QLK3-2000-00170 and by Grants BMC2000-0125-CO4-02 and GEN2001-4698-C05-02 from the Comisión Interministerial de Ciencia y Tecnología. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

{ddagger} Present address: Dept. of Molecular and Cell Biology, Centro Nacional de Biotecnología, Consejo Superior de Investigaciones Científicas, 28049 Madrid, Spain. Back

§ To whom correspondence should be addressed: Dept. of Molecular Microbiology, Centro de Investigaciones Biológicas, Consejo Superior de Investigaciones Científicas, Ramiro Maeztu, 9, 28040 Madrid, Spain. Tel.: 34-91-8373112; Fax: 34-91-5625791; E-mail: ediaz{at}cib.csic.es.

1 The abbreviations used are: 3HPP, 3-(3-hydroxyphenyl)propionic acid; CRP, cAMP receptor protein; OR, operator region; LB, Luria Bertani; Km, kanamycin. Back


   ACKNOWLEDGMENTS
 
We thank A. Kolb for the kind gift of purified CRP. We gratefully acknowledge the help of A. Díaz for the construction of plasmid pPAL and that of B. Galán and O. Ahrazem with Figure 4. We thank E. Aporta for oligonucleotide synthesis, J. Varela for N-terminal amino acid sequencing, A. Díaz and S. Carbajo for DNA sequencing, and E. Cano, M. Carrasco, and F. Morante for technical assistance. We acknowledge M. Carmona, A. Prieto, and B. Galán for critical reading of the manuscript.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS AND DISCUSSION
 REFERENCES
 

  1. Masai, E., Harada, K., Peng, X., Kitayama, H., Katayama, Y., and Fukuda, M. (2002) Appl. Environ. Microbiol. 68, 4416–4424[Abstract/Free Full Text]
  2. Smith, M. A., Weaver, V. B., Young, D. M., and Ornston, L. N. (2003) Appl. Environ. Microbiol. 69, 524–532[Abstract/Free Full Text]
  3. Priefert, H., Rabenhorst, J., and Steinbüchel, A. (2001) Appl. Microbiol. Biotechnol. 56, 296–314[CrossRef][Medline] [Order article via Infotrieve]
  4. Venturi, V., Zennaro, F., Degrassi, G., Okeke, B. C., and Bruschi, C. V. (1998) Microbiology 144, 965–973[Abstract/Free Full Text]
  5. Burlingame, R., and Chapman, P. J. (1983) J. Bacteriol. 155, 424–426[Abstract/Free Full Text]
  6. Andreoni, V., and Bestetti, G. (1986) Appl. Environ. Microbiol. 52, 930–934[Abstract/Free Full Text]
  7. Coulson, C. B., and Evans, W. C. (1959) Chem. Ind. 17, 543–544
  8. Dagley, S., Chapman, P. J., and Gibson, D. T. (1965) Biochem. J. 97, 643–650[Medline] [Order article via Infotrieve]
  9. Levy, C. C. (1967) J. Biol. Chem. 242, 747–753[Abstract/Free Full Text]
  10. Strickland, S., and Massey, V. (1973) J. Biol. Chem. 248, 2944–2952[Abstract/Free Full Text]
  11. Arai, H., Yamamoto, T., Ohishi, T., Shimizu, T., Nakata, T., and Kudo, T. (1999) Microbiology 145, 2813–2820[Abstract/Free Full Text]
  12. Powell, J. A. C., and Archer, J. A. C. (1998) Antonie van Leeuwenhoek 74, 175–188[CrossRef][Medline] [Order article via Infotrieve]
  13. Barnes, M. R., Duetz, W. A., and Williams, P. A. (1997) J. Bacteriol. 179, 6145–6153[Abstract/Free Full Text]
  14. Ferrández, A., García, J. L., and Díaz, E. (1997) J. Bacteriol. 179, 2573–2581[Abstract/Free Full Text]
  15. Díaz, E., Ferrández, A., and García, J. L. (1998) J. Bacteriol. 180, 2915–2923[Abstract/Free Full Text]
  16. Burlingame, R. P., Wyman, L., and Chapman, P. J. (1986) J. Bacteriol. 168, 55–64[Abstract/Free Full Text]
  17. Díaz, E., Ferrández, A., Prieto, M. A., and García, J. L. (2001) Microbiol. Mol. Biol. Rev. 65, 523–569[Abstract/Free Full Text]
  18. DiMarco, A. A., Averhoff, B., and Ornston, L. N. (1993) J. Bacteriol. 175, 4499–4506[Abstract/Free Full Text]
  19. Gerischer, U., Segura, A., and Ornston, L. N. (1998) J. Bacteriol. 180, 1512–1524[Abstract/Free Full Text]
  20. Romero-Steiner, S., Parales, R. E., Harwood, C. S., and Houghton, J. E. (1994) J. Bacteriol. 176, 5771–5779[Abstract/Free Full Text]
  21. Parke, D. (1997) FEMS Microbiol. Lett. 146, 3–12
  22. Eulberg, D., and Schlömann, M. (1998) Antonie van Leeuwenhoek 74, 71–82[CrossRef][Medline] [Order article via Infotrieve]
  23. Eulberg, D., Lakner, S., Golovleva, L. A., and Schlömann, M. (1998) J. Bacteriol. 180, 1072–1081[Abstract/Free Full Text]
  24. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  25. de Lorenzo, V., and Timmis, K. N. (1994) Methods Enzymol. 235, 386–405[Medline] [Order article via Infotrieve]
  26. Prieto, M. A., and García, J. L. (1997) Biochem. Biophys. Res. Commun. 232, 759–765[CrossRef][Medline] [Order article via Infotrieve]
  27. Ferrández, A., García, J. L., and Díaz, E. (2000) J. Biol. Chem. 275, 12214–12222[Abstract/Free Full Text]
  28. Ferrández, A., Miñambres, B., García, B., Olivera, E. R., Luengo, J. M., García, J. L., and Díaz, E. (1998) J. Biol. Chem. 273, 25974–25986[Abstract/Free Full Text]
  29. Pérez-Martín, J., and de Lorenzo, V. (1996) Gene 172, 81–86[CrossRef][Medline] [Order article via Infotrieve]
  30. Miller, J. H. (1972) Experiments in Molecular Genetics, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  31. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. U. S. A. 74, 5463–5467[Abstract/Free Full Text]
  32. Bradford, M. M. (1976) Anal. Biochem. 72, 248–254[CrossRef][Medline] [Order article via Infotrieve]
  33. Speicher, D. W. (1994) Methods 6, 262–273[CrossRef]
  34. Maxam, A, and Gilbert, W. (1980) Methods Enzymol. 65, 499–560[Medline] [Order article via Infotrieve]
  35. DiMarco, A. A., and Ornston, L. N. (1994) J. Bacteriol. 176, 4277–4284[Abstract/Free Full Text]
  36. Guo, Z., and Houghton, J. E. (1999) Mol. Microbiol. 32, 253–263[CrossRef][Medline] [Order article via Infotrieve]
  37. Trautwein, G., and Gerischer, U. (2001) J. Bacteriol. 183, 873–881[Abstract/Free Full Text]
  38. Popp, R., Kohl, T., Patz, P., Trautwein, G., and Gerischer, U. (2002) J. Bacteriol. 184, 1988–1997[Abstract/Free Full Text]
  39. McFall, S. M., Chugani, S. A., and Chakrabarty, A. M. (1998) Gene 223, 257–267[CrossRef][Medline] [Order article via Infotrieve]
  40. Díaz, E., and Prieto, M. A. (2000) Curr. Opin. Biotechnol. 11, 467–475[CrossRef][Medline] [Order article via Infotrieve]
  41. Perna, N. T., Plunkett, G., III, Burland, V., Mau, B., Glasner, J. D., Rose, D. J., Mayhew, G. F., Evans, P. S., Gregor, J., Kirkpatrick, H. A., Pósfai, G., Hackett, J., Klink, S., Boutin, A., Shao, Y., Miller, L., Grotbeck, E. J., Davis, N. W., Lim, A., Dimalanta, E. T., Potamousis, K. D., Apodaca, J., Anantharaman, T. S., Lin, J., Yen, G., Schwartz, D. C., Welch, R. A., and Blattner, F. R. (2001) Nature 409, 529–533[CrossRef][Medline] [Order article via Infotrieve]
  42. Roper, D. I., Fawcett, T., and Cooper, R. A. (1993) Mol. Gen. Genet. 237, 241–250[Medline] [Order article via Infotrieve]
  43. Yamashita, M., Azakami, H., Yokoro, N., Roh, J.-H., Suzuki, H., Kumagai, H., and Murooka, Y. (1996) J. Bacteriol. 178, 2941–2947[Abstract/Free Full Text]
  44. Galán, B., Kolb, A., García, J. L., and Prieto, M. A. (2001) J. Biol. Chem. 276, 37060–37068[Abstract/Free Full Text]
  45. Kovárová, K., Käch, A., Zehnder, A. J. B., and Egli, T. (1997) Appl. Environ. Microbiol. 63, 2619–2624[Abstract]
  46. Kolb, A., Busby, S., Buc, H., Garges, S., and Adhya, S. (1993) Annu. Rev. Biochem. 62, 749–795[CrossRef][Medline] [Order article via Infotrieve]
  47. Saier, M. H., Ramseier, T. M., and Reizer, J. (1996) in Escherichia coli and Salmonella: Cellular and Molecular Biology (Neidhardt, F. C., Curtiss, R., III, Ingraham, J. L., Lin, E. C. C., Low, K. B., Magasanik, B., Reznikoff, W. S., Riley, M., Schaechter, M., and Umbarger, H. E., eds), pp. 1325–1343, ASM Press, Washington, D. C.
  48. Kimata, K., Takahashi, H., Inada, T., Postma, P., and Aiba, H. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 12914–12919[Abstract/Free Full Text]
  49. Wade, J. T., Belyaeva, T. A., Hyde, E. I., and Busby, S. J. W. (2001) EMBO J. 20, 7160–7167[CrossRef][Medline] [Order article via Infotrieve]
  50. Strem, S. T., Gaal, T., Ross, W., and Gourse, R. L. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 9761–9766[Abstract/Free Full Text]
  51. Busby, S., and Ebright, R. H. (1999) J. Mol. Biol. 293, 199–213[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
G. L. Lorca, A. Ezersky, V. V. Lunin, J. R. Walker, S. Altamentova, E. Evdokimova, M. Vedadi, A. Bochkarev, and A. Savchenko
Glyoxylate and Pyruvate Are Antagonistic Effectors of the Escherichia coli IclR Transcriptional Regulator
J. Biol. Chem., June 1, 2007; 282(22): 16476 - 16491.
[Abstract] [Full Text] [PDF]

Home page
 J. Bacteriol.Home page
H. Hara, L. D. Eltis, J. E. Davies, and W. W. Mohn
Transcriptomic Analysis Reveals a Bifurcated Terephthalate Degradation Pathway in Rhodococcus sp. Strain RHA1
J. Bacteriol., March 1, 2007; 189(5): 1641 - 1647.
[Abstract] [Full Text] [PDF]

Home page
 J. Bacteriol.Home page
S. Kuhner, L. Wohlbrand, I. Fritz, W. Wruck, C. Hultschig, P. Hufnagel, M. Kube, R. Reinhardt, and R. Rabus
Substrate-Dependent Regulation of Anaerobic Degradation Pathways for Toluene and Ethylbenzene in a Denitrifying Bacterium, Strain EbN1
J. Bacteriol., February 15, 2005; 187(4): 1493 - 1503.
[Abstract] [Full Text] [PDF]

Home page
 Genome ResHome page
K. Tan, L. A. McCue, and G. D. Stormo
Making connections between novel transcription factors and their DNA motifs
Genome Res., February 1, 2005; 15(2): 312 - 320.
[Abstract] [Full Text] [PDF]

Home page
 MicrobiologyHome page
R. L. Stingley, B. Brezna, A. A. Khan, and C. E. Cerniglia
Novel organization of genes in a phthalate degradation operon of Mycobacterium vanbaalenii PYR-1
Microbiology, November 1, 2004; 150(11): 3749 - 3761.
[Abstract] [Full Text] [PDF]

Home page
 Microbiol. Mol. Biol. Rev.Home page
D. Tropel and J. R. van der Meer
Bacterial Transcriptional Regulators for Degradation Pathways of Aromatic Compounds
Microbiol. Mol. Biol. Rev., September 1, 2004; 68(3): 474 - 500.
[Abstract] [Full Text] [PDF]

Home page
 J. Bacteriol.Home page
E. Arias-Barrau, E. R. Olivera, J. M. Luengo, C. Fernandez, B. Galan, J. L. Garcia, E. Diaz, and B. Minambres
The Homogentisate Pathway: a Central Catabolic Pathway Involved in the Degradation of L-Phenylalanine, L-Tyrosine, and 3-Hydroxyphenylacetate in Pseudomonas putida
J. Bacteriol., August 1, 2004; 186(15): 5062 - 5077.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/30/27575    most recent
M303245200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Torres, B.
Right arrow Articles by Díaz, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Torres, B.
Right arrow Articles by Díaz, E.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement