| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 278, Issue 30, 27703-27711, July 25, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the Department of Biology, X-Ceptor Therapeutics Inc., San Diego, California 92121
Received for publication, February 28, 2003 , and in revised form, May 7, 2003.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
hydroxylase (CYP7A1), the rate-limiting enzyme
in bile acid synthesis, indirectly by inducing the gene encoding the short
heterodimer partner (SHP). SHP then inactivates CYP7A1 by binding to liver
receptor homolog 1, a competence factor for CYP7A1 expression
(5,
6). A similar mechanism has
also been shown for bile acid feedback repression of the sodium/taurocholate
cotransporter peptide (NTCP), the major bile acid uptake protein in the liver
(7). In contrast, bile
acid-activated FXR directly induces the transcription of the gene for the bile
salt export pump (BSEP), the principal bile salt efflux pump in the liver
(8). Thus, regulation of
hepatic gene expression by FXR promotes a net efflux of bile acids from the
liver.
FXR induces transcription of SHP and BSEP by binding DNA sequences composed of two inverted repeats separated by one nucleotide (IR-1) as a heterodimer with the retinoid X receptor (RXR) (5, 6, 8). FXR also activates transcription of the ileal bile acid-binding protein (IBABP) and phospholipid transfer protein (PLTP) genes via IR-1 elements in the promoters of these genes (9, 10). In contrast to this IR-1 arrangement, FXR has also been shown to bind and activate an inverted repeat without a spacing nucleotide (IR-0). This IR-0 arrangement was found to be the cognate FXR element in the dehydroepiandrosterone sulfotransferase gene, which encodes an enzyme with bile acid sulfo-conjugating activity (11).
Bile acids are synthesized in the liver from cholesterol and conjugated to
glycine or taurine before they are secreted into bile canaliculi
(12,
13). In humans conjugated bile
acids are the major solutes in bile, whereas unconjugated bile acids are
almost nondetectable. Importantly, conjugated bile acids are less toxic and
are more efficient promoters of intestinal absorption of dietary lipid than
unconjugated bile acids (14).
The primary bile acids in humans, cholic acid and chenodeoxycholic acid, are
synthesized via the concerted action of enzymes located in the endoplasmic
reticulum, cytosol, mitochondria, and peroxisomes
(13). The immediate precursors
of the C24 bile acids cholate and chenodeoxycholate are the
C27 compounds
3,7,12-trihydroxy-5-
-cholestanoic acid (THCA) and
3, 7,12-dihydroxy-5--cholestanoic acid (DHCA),
respectively. Before chain shortening of THCA and DHCA via peroxisomal
-oxidation can take place, the C27 compounds have to be
activated to their CoA thioesters. Current knowledge of the synthesis of bile
acid-amino acid conjugates in human liver involves two independent enzyme
reactions (15). An
ATP-dependent microsomal enzyme, bile acid-CoA synthetase (BACS), catalyzes
the formation of the thioester intermediate and is considered the
rate-limiting step in bile acid amidation
(16). Interestingly, it was
recently demonstrated that human very long chain acyl CoA synthetase homolog 2
(VLCS-H2) is a bile acid-CoA synthetase
(17). VLCS-H2 belongs to a
family that includes very long chain synthetase (VLCS) and fatty acid
transport proteins. In the second reaction, the thioester bond is cleaved and
an amide bond is formed between the bile acid and the amino acids glycine or
taurine. The bile acid-CoA:amino acid N-acetyltransferase (BAT)
catalyzes this reaction
(18).
Here we show that FXR regulates the expression of genes required for bile acid conjugation to amino acids. We have used Northern analysis and micro-array technology to identify BACS and BAT as FXR target genes. Induction of BACS and BAT gene expression occurs through the direct interaction of FXR/RXR heterodimers with conserved IR-1 elements in the promoter of BACS and in the first intron of the human BAT gene. Finally we show that these genes are up-regulated in rats treated with a synthetic FXR ligand. These findings provide further evidence for the critical role of FXR in regulating bile acid homeostasis.
|
EXPERIMENTAL PROCEDURES |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
RNA Isolation and Northern Blot Analysis—Total RNA was
isolated from rat primary hepatocytes and rat liver RNA using TRIzol reagent
(Invitrogen) and further purified by using an RNeasy kit (Qiagen, Valencia,
CA). Poly(A)+ RNA was purified from rat liver total RNA using Oligotex
(Qiagen) according to the manufacturer's instructions. Five micrograms of
poly(A)+ RNA was resolved on a 1% agarose/formaldehyde gel, transferred to
nylon membrane, and cross-linked to the membrane with UV light. cDNA probes
were radiolabeled with [-32P]dCTP using the Rediprime II
labeling kit (Amersham Biosciences). Membranes were hybridized using the Rapid
hybridization buffer (Amersham Biosciences), washed according to the
manufacturer's instructions, and quantified using a Molecular Imager
(Bio-Rad).
Taqman Primers and Probes—Oligonucleotide primers and probes
for rat SHP and BSEP were designed using the Primer Express program and were
synthesized by Integrated DNA Technologies Inc. The sequences
(5'
3') were as follows: Rat SHP, forward primer
(ttggatttcctcggtttgc), probe (6FAM-cagtgtttgactaadtgtccagcaggcc-TAMRA), and
reverse primer (acccaggtaagggaaggcata); rat BSEP, forward primer
(tgcatgtcaggagacggc), probe (6FAM-tcacattgtggaactcaatttcacccttg-TAMRA), and
reverse primer (tcacgtccggtctagaagga).
Primary Hepatocyte Cultures and Cell Lines—Primary rat
hepatocytes were obtained from In Vitro Technologies plated on collagen-coated
plates. Upon arrival (2 days after collagenase isolation), shipping media was
replaced by fresh hepatocyte growth media (In Vitro Technologies). After a 2-h
recovery period the cells were treated with vehicle (Me2SO) or the
following FXR ligands: 100 µM
3,7-dihydroxy-5-cholanic acid (CDCA), 1 µM
3-(2,6-dichlorophenyl)-4-(3'-carboxy-2-chlorostilben-4-yl)oxymethyl-5-isopropylisoxazole
(GW4064) (19). After 48 h,
total RNA was isolated from the cells. CV-1 cells were obtained from and
maintained according to ATCC depository.
cDNA Probes and Reporter Genes—Human cDNAs for BAT and BACS
were PCR-amplified from reverse-transcribed HepG2 mRNA using primers
5'-atgatccagttgacagctacccctgtg-3' and
5'-tcaagcatgttcctgtgcagctgcgtg-3' for BAT, and
5'-gtaccatgggtgtcaggcaacag-3' and
5'-cagagctcagcacagagtgcgc-3' for BACS. The PCR amplicons, 1230 and
667 bp for BAT and BACS, respectively, were radiolabeled and used as probes
for Northern analysis. Human BAT and BACS gene sequences were obtained from
GenBankTM. A fragment spanning 
1.5 kb of 5'-flanking sequence
of the BACS (VLCS-H2) gene was PCR-amplified from human genomic DNA using
primers 5'-gctgtgagcacctggatcagtgc-3' and
5'-gtgacgactgtcaccgaccaggag-3' and cloned into
XhoI-HindIII sites of pGL3-basic vector (Promega). A
fragment spanning nucleotide –383 to + 2751 of the BAT gene was
PCR-amplified from human genomic DNA using primers
5'-ccctggtctcctgcggtaccctcaggc-3' and
5'-gcacaagcagggcacgcatgtggg-3' and cloned into
SacI-XhoI sites of pGL3-basic vector (Promega). The
three-copy BACS IR-1 construct was generated by annealing the oligonucleotides
5'-agcttcccaaggggcagagacctgcggggcagagacctgcggggcagagacctgggag-3'
and
5'-gatcctcccaggtctctgccccgcaggtctctgccccgcaggtctctgccccttggga-3'
before ligation into HindIII/BamHI-digested TK-Luc. The
three-copy BAT IR-1 was done using the oligonucleotides
5'-agcttcttggaggtcaagtgcctcgaggtcaagtgcctcgaggtcaagtgcctcgttg-3'
and
5'-gatccaacgaggcacttgacctcgaggcacttgacctcgaggcacttgacctccaaga-3'.
Point mutations of FXRE (IR-1) sequences were done using the QuikChange
mutagenesis kit from Stratagene. For mutation of the BACS IR-1, an antisense
primer (5'-gtggtgcccaaggaagcagagatttgggaacccaga-3')
and a sense primer
(5'-tctgggttcccaaatctctgcttccttgggcaccac-3')
(mutated bases indicated in boldface type) were used in a PCR according to the
manufacturer's directions. For mutation of the IR-1 in the BAT gene, the
antisense primer
(5'-aggcatcttggaaatcaagtgtttcgttcatccttg-3') and the
sense primer (5'-caaggatgaacgaaacacttgatt-
tccaagatgcct-3') were used. All oligonucleotides primers were ordered
from Integrated DNA Technologies Inc. The sequences of all constructs were
verified by automated DNA sequencing.
Transient Transfections and Reporter Gene Assays—CV-1 cells
were transfected using the FuGENE 6 reagent (Roche Applied Science). Briefly,
30 ng of reporter plasmid, 10 ng of pCMX-hFXR, 10 ng of pCMX-hRXR, and
10 ng of pCMV--galactosidase and 0.28 µl of FuGENE 6 were used in a
final volume of 10 µl. After a 15-min incubation at room temperature, the
mixture was added to cells in 96-well plates and incubated for5hat37 °C.
The cells were then treated with medium containing 10%
charcoal/dextran-stripped fetal bovine serum and vehicle (Me2SO) or
one of the following ligands: 100 µM CDCA, 1 µM
GW4064, or 0.1 µM LG1305. After 24 h, cells were lysed and
assayed for luciferase and -galactosidase activity. The normalized
luciferase units (RLUs) were determined by dividing the luciferase activity by
the -galactosidase activity.
Electrophoretic Mobility Shift Assays—Core sequences of the
BAT, BACS, and IBABP IR-1s are shown below in
Fig. 2A. Annealed
double-stranded oligonucleotides were radiolabeled with
[-32P]dCTP using the Klenow fragment of DNA polymerase II.
hFXR and hRXR were synthesized from pCMX-FXR and pCMX-RXR
expression vectors using the TNT T7 Coupled Reticulocyte System
(Promega, Madison, WI). Binding reactions contained 20 mM Hepes, pH
7.2, 75 mM KCl, 2 mM dithiothreitol, 0.2% Nonidet P-40,
15% glycerol, 1 µg of poly(dI-dC)-poly(dI-dC), 3 µl each of synthesized
receptor proteins, and 0.05 pmol of 32P-labeled double-stranded
oligonucleotide. Competitor oligonucleotides were added at 50- and 150-fold
molar excesses. The oligonucleotides used for BAT and BACS IR-1s were
5'-agcttcttggaggtcaagtgcctcgttg-3' and
5'-agcttcccaaggggcagagacctgggag-3', respectively (only one
strand is shown, and the IR-1 is indicated in boldface). IBABP IR-1 was
5'-agcttttccttaaggtgaataaccttggggct-3'.
|
Animal Studies—Male F344/NHsd rats were fed ad libitum and were kept under standard light/dark cycle. The GW4064 compound was suspended in 0.5% carboxymethyl cellulose vehicle for a dosing volume of 1 ml. Animals were dosed bis in die for 7 days with a 16-gauge 5.08-cm feeding needle to give a final concentration of 100 mg/kg.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
2-fold was seen with CDCA compared with
vehicle-treated cells (Fig.
1A) consistent with studies indicating that CDCA is a
weak activator of SHP in vivo
(20). BSEP mRNA levels were
also induced by GW4064, and a 2-fold induction was seen with CDCA
(Fig. 1B). Having
verified regulation of FXR target genes in this experiment, total RNA from
each sample was processed and hybridized to Affymetrix rat genomic U34A
GeneChips according to Affymetrix protocols. Differentially expressed genes
were identified by comparing hybridization signals for FXR ligand treated
samples to signals for vehicle treated samples using the Affymetrix Microarray
Suite and Data Mining Tools software. Expression profiling by a natural
versus a synthetic FXR agonist of primary hepatocytes indicated some
degree of overlap but also separation of activities by these ligands (Tables
I,
II,
III). Two known FXR target
genes, BSEP and SHP, and one novel target gene, namely bile acid-CoA:amino
acid N-acetyltransferase (BAT), were clearly differentially expressed
in this experiment (Tables I
and II). We decided to focus on
the BAT gene for further characterization, because FXR has previously been
shown to play a critical role in bile acid homeostasis. The BAT transcript was
induced 2-fold by GW4064 as well as with CDCA in the micro-array
experiment.
|
|
|
|
The Human BACS and BAT Genes Contain Potential FXREs—The
finding that BAT is transcriptionally activated by FXR ligands suggested that
the rate-limiting enzyme in bile acid-amino acid conjugation, bile acid-CoA
synthetase (BACS) may also be an FXR target gene. To date, most functional
binding sites (FXRE) identified in FXR target genes correspond to two inverted
repeats spaced by one nucleotide as exemplified by the IR-1 from the mouse
IBABP promoter (Fig.
2A). Analysis of the proximal promoter of the human BACS
gene identified a potential IR-1 (5'-GGGGCAaAGACCT-3') in the
flanking region located 230 bp upstream of the transcription start site.
Similar analysis of the proximal promoter and intron 1 of the human BAT gene
identified an IR-1 (5'-AGGTCAaGTGCCT-3') located in intron 1 at
+2615 to +2628 relative to the transcription start site
(Fig. 2B).
Electrophoresis mobility gel shift assays (EMSA) and transient transfection
experiments were next performed to investigate direct binding and
functionality of the FXR/RXR binding to these sequences.
FXR/RXR Heterodimers Bind to FXREs in the BACS and BAT Genes—EMSA experiments with a radiolabeled oligonucleotide spanning the BACS IR-1 showed that when incubated with in vitro translated FXR and RXR protein this element produced a significant band shift that was competed with 150-fold molar excess of unlabeled BACS or IBABP IR-1. No shifted DNA-protein complex was observed when either FXR or RXR was omitted from the EMSAs (Fig. 3A). An oligonucleotide containing the BAT IR-1 sequence was next radiolabeled and used in a gel-shift experiment (Fig. 3B). The BAT IR-1 produced a significant band shift when incubated with FXR and RXR proteins but not when incubated by RXR alone. Interestingly, a weak band shift was detected when the BAT IR-1 was incubated with FXR alone, indicating that FXR may bind as a monomer or homodimer to this DNA element. The binding of FXR/RXR was blocked by 50- and 150-fold excesses of either unlabeled BAT IR-1 or IBABP IR-1. Conversely, the binding of FXR/RXR heterodimers to the radiolabeled IBABP IR-1 was efficiently competed by 50- and 150-fold molar excesses of either unlabeled IBABP IR-1, BAT IR-1 (Fig. 3C), or BACS IR-1 (data not shown).
|
The BACS and BAT IR-1s Are Functional FXREs in the Context of a Heterologous Promoter—To test the ability of the BACS and BAT IR-1 elements to function as FXREs, three copies of each of the IR-1s were cloned into the thymidine kinase luciferase (TK-Luc) reporter plasmid. The resultant 3xBACS-IR-1-TK-Luc and 3xBAT-IR-1-TK-Luc reporters were cotransfected with expression plasmids for FXR and RXR into CV-1 cells. After treatment with vehicle (Me2SO), GW4064, and CDCA the cells were lysed and assayed for luciferase activity. The BACS and BAT IR-1 elements were able to confer FXR-dependent transactivation as demonstrated by activation of the 3xBACS-IR-1-TK-Luc (Fig. 4A) and 3xBAT-IR-1-TK-Luc (Fig. 4B) reporters by GW4064 and CDCA, whereas no significant induction was seen with the empty TK-Luc vector (Fig. 4, A–B). Similar activities were achieved with a three-copy IR-1 from the mouse IBABP promoter (data not shown). These data together with the band-shift results in Fig. 3 suggest that the two IR-1s from the BACS and BAT genes are functional FXR binding sites.
|
The BACS and BAT IR-1s Are Functional FXREs in the Context of Their
Native Gene—To demonstrate that the BACS IR-1 is a functional FXRE
in the context of its natural promoter, 1.5 kb of the 5' flanking
region of the human BACS gene was cloned in pGL3b, and the resultant reporter
gene construct was tested in transient transfection experiments using CV-1
cells (Fig. 5A). This
region of the BACS gene conferred significant FXR activity mediated by GW4064
as well as CDCA. The BACS promoter was also significantly activated by the
synthetic RXR ligand LG1305, and an additive effect was seen with the
combination of LG1305 with GW4064 or CDCA. Mutation of the putative IR-1 in
the BACS gene reporter construct significantly reduced the FXR/RXR-mediated
activity (Fig. 5A). It
is concluded from these experiments that the BACS gene confers FXR regulation
via a functional FXRE located in the proximal promoter of the gene. To
demonstrate that the BAT IR-1 element identified in the above experiments is a
functional FXRE in the context of the BAT gene promoter, a fragment spanning
the human BAT gene from –383 to + 2751 was cloned into the luciferase
vector pGL3 and the resultant reporter gene (BAT-wt-Luc) was tested for
FXR-dependent transactivation. No activation of the BAT-wt-Luc by FXR or RXR
ligands was observed in CV-1 cells when cotransfected with FXR and RXR
expression plasmids (data not shown). FXR ligand-dependent activation of the
BAT promoter/intron 1 construct was observed, however, when a VP16-FXR fusion
protein was introduced (Fig.
5B). Importantly, the ligand-dependent activation
detected with VP16-FXR requires the IR-1 sequence in the first intron, because
mutation of this site eliminates the response
(Fig. 5B). The failure
to see activation of the BAT promoter/intron by wild-type FXR most likely
arises from the relatively low transcriptional activity of this reporter in
CV-1 cells. A similar VP16-FXR construct was used to define the FXR-dependent
regulation of apoCII (21). We
conclude from these experiments that the BAT gene contains a functional FXRE
located in the first intron of the gene.
|
Hepatic BACS and BAT mRNAs Are Induced in Vivo—To confirm
that the FXR-dependent regulation of BAT and BACS observed in vitro
also occurs in vivo, Fisher rats (six vehicle- and six
GW4064-treated) were treated for 7 days with the synthetic FXR agonist GW4064.
Northern blot analysis demonstrated that treatment of rats with GW4064
(lanes 1–6) results in the induction of BAT mRNA compared with
vehicle (lanes 7–12)-treated rats
(Fig. 6A). Similarly,
the BACS transcript was also significantly induced by the GW4064 ligand in rat
liver. After normalization to the glyceraldehyde-3-phosphate dehydrogenase
control transcript, the BAT and the BACS transcripts showed an average
induction of 2- to 3-fold by GW4064 compared with vehicle-treated rats
(Fig. 6B). Taken
together these results support the conclusion that both the BAT and the BACS
genes are direct targets of FXR.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
In the present study we show that the genes encoding two key enzymes in bile acid-amino acid conjugation, BAT and BACS, are direct targets of the bile acid receptor FXR further expanding and confirming the critical role of this receptor in bile acid homeostasis. We used micro-array technology and identified BAT as a novel FXR target gene and then hypothesized that BACS, which catalyzes the rate-limiting reaction in conjugation of bile acid to taurine or glycine, may also be a target gene for FXR. A search for FXR binding sites in the human BACS gene identified one potential IR-1 in the proximal promoter of this gene. We presented evidence that the FXR-mediated activation of BACS gene transcription is mediated through this IR-1 and based upon gel-shift and competition experiments that RXR/FXR heterodimers directly bind to this element. Further mutational studies established that induction of a reporter gene was dependent on an intact IR-1 element. The observation that the proximal promoter of the BAT gene was not induced by FXR ligands (data not shown) coupled with the fact that an intronic sequence did confer FXR responsiveness led us to conclude that bile acid activation of the BAT gene is likely mediated by the FXRE in the first intron. Conceivably, other FXREs located further upstream to the BAT gene sequences used in the present study could contribute to the FXR-dependent induction of this gene. However, analysis of the rat genomic sequence for BAT showed a similar location (intron 1) of an IR-1 as for the human gene (data not shown), further supporting the conclusion that FXR regulates the BAT gene via an intronic FXRE. Functional intronic nuclear receptor binding sites have recently been found in the lipoprotein lipase gene and the gene encoding acyl-CoA-binding protein (26, 27). The current study demonstrates that BACS and BAT mRNAs are induced in rat liver in response to natural and synthetic FXR ligands. Interestingly, the FXR-dependent induction of BACS and BAT mRNA may be specific to rats, because similar studies in mice failed to demonstrate regulation of these mRNAs. On the other hand, human gene promoter sequences were used in the present study, suggesting FXR-dependent regulation in humans.
The two-step process of conjugation of bile acids with the amino acids taurine and glycine is a result of the successive action of BACS and BAT. Our results establish a role of FXR in regulating these processes. One question raised by these findings is what is the physiological basis for the regulation of bile acid-amidation by FXR. High concentrations of bile acids in the hepatocyte repress further synthesis mediated by CYP7A1, the rate-limiting enzyme of bile acid biosynthesis (13). Current understanding is that bile acids, by acting as FXR ligands, inhibit bile acid synthesis partly via activation of SHP, which in turn represses CYP7A1 (5, 6). FXR activators also decrease the intracellular bile acid concentration by directly inducing BSEP, a bile acid export pump, and by indirectly repressing NTCP, which extracts bile acids from the blood. In the enterocytes of the ileum, bile acids are efficiently reclaimed for return to the liver. In these ileal enterocytes, bile acids induce the expression of the cytosolic-binding protein IBABP, another FXR target gene that has been proposed to buffer intracellular bile acids and promote their translocation into the portal circulation. Based on the current study we propose that FXR, by controlling the level of bile acid amidation, regulates intracellular levels of unconjugated bile acids, which can be cytotoxic unless they are conjugated. Importantly, BSEP does not translocate unconjugated bile acids into bile (28). Individuals with mutations in the BAT gene have no conjugated bile acids. Consequently, small quantities of bile acids enter into bile. In these patients most of the unconjugated bile acids diffuse out of hepatocytes and into plasma, leading to high serum bile acid concentrations and low intestinal concentrations (29).
In conclusion, our results show that two genes encoding bile acid-amino acid conjugation enzymes are induced by FXR ligands in the liver via IR-1 elements cognate to the FXR/RXR heterodimer. The identification of FXR target genes involved in bile acid amidation is consistent with an important role of this nuclear receptor in regulating cholesterol and bile acid metabolism in the liver, excretion of bile acids into bile, and the re-uptake of bile acids from the intestinal lumen. These observations thus couple the process of bile acid conjugation to bile acid synthesis and transport via transcriptional regulation by FXR.
|
FOOTNOTES |
|---|
To whom correspondence should be addressed: Dept. of Biology, X-Ceptor
Therapeutics Inc., 4757 Nexus Centre Dr., San Diego, CA 92121. Tel.:
858-458-4522; Fax: 858-458-4501; E-mail:
swestin{at}x-ceptor.com.
1 The abbreviations used are: FXR, farnesoid X receptor; CYP7A1,
cholesterol-7 hydroxylase; SHP, short heterodimer partner; NTCP,
sodium/taurocholate cotransporter peptide; BSEP, bile salt export pump; IR,
inverted repeat; RXR, retinoid X receptor; IBABP, ileal bile acid receptor;
THCA, trihydroxycholestanoic acid; DHCA, dihydroxycholestanoic acid; BACS,
bile acid-CoA synthetase; VLCS-H2, very long chain acyl CoA synthetase homolog
2; BAT, bile acid-CoA:amino acid N-acetyltransferase; 6-FAM,
6-carboxyfluorescein; 6-TAMRA, 6-carboxytetramethylrhodamine; CA, cholic acid;
CDCA, chenodeoxycholic acid; FXRE, farnesoid X receptor element; RLUs,
relative light units; EMSA, electrophoretic mobility shift assay.
|
ACKNOWLEDGMENTS |
|---|
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  M. B. Rosen, B. D. Abbott, D. C. Wolf, J. C. Corton, C. R. Wood, J. E. Schmid, K. P. Das, R. D. Zehr, E. T. Blair, and C. Lau Gene Profiling in the Livers of Wild-type and PPAR{alpha}-Null Mice Exposed to Perfluorooctanoic Acid Toxicol Pathol, June 1, 2008; 36(4): 592 - 607. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. A. Styles, J. L. Falany, S. Barnes, and C. N. Falany Quantification and regulation of the subcellular distribution of bile acid coenzyme A:amino acid N-acyltransferase activity in rat liver J. Lipid Res., June 1, 2007; 48(6): 1305 - 1315. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. D. Moore, S. Kato, W. Xie, D. J. Mangelsdorf, D. R. Schmidt, R. Xiao, and S. A. Kliewer International Union of Pharmacology. LXII. The NR1H and NR1I Receptors: Constitutive Androstane Receptor, Pregnene X Receptor, Farnesoid X Receptor {alpha}, Farnesoid X Receptor beta, Liver X Receptor {alpha}, Liver X Receptor beta, and Vitamin D Receptor Pharmacol. Rev., December 1, 2006; 58(4): 742 - 759. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. E. Matsukuma, M. K. Bennett, J. Huang, L. Wang, G. Gil, and T. F. Osborne Coordinated control of bile acids and lipogenesis through FXR-dependent regulation of fatty acid synthase J. Lipid Res., December 1, 2006; 47(12): 2754 - 2761. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Claudel, B. Staels, and F. Kuipers The Farnesoid X Receptor: A Molecular Link Between Bile Acid and Lipid and Glucose Metabolism Arterioscler. Thromb. Vasc. Biol., October 1, 2005; 25(10): 2020 - 2030. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Ferdinandusse, S. Denis, H. Overmars, L. Van Eeckhoudt, P. P. Van Veldhoven, M. Duran, R. J. A. Wanders, and M. Baes Developmental Changes of Bile Acid Composition and Conjugation in L- and D-Bifunctional Protein Single and Double Knockout Mice J. Biol. Chem., May 13, 2005; 280(19): 18658 - 18666. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Li, P. C. Pircher, I. G. Schulman, and S. K. Westin Regulation of Complement C3 Expression by the Bile Acid Receptor FXR J. Biol. Chem., March 4, 2005; 280(9): 7427 - 7434. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Miyata, A. Tozawa, H. Otsuka, T. Nakamura, K. Nagata, F. J. Gonzalez, and Y. Yamazoe Role of Farnesoid X Receptor in the Enhancement of Canalicular Bile Acid Output and Excretion of Unconjugated Bile Acids: A Mechanism for Protection against Cholic Acid-Induced Liver Toxicity J. Pharmacol. Exp. Ther., February 1, 2005; 312(2): 759 - 766. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Alvarez, P. Jara, E. Sanchez-Sabate, L. Hierro, J. Larrauri, M. C. Diaz, C. Camarena, A. De la Vega, E. Frauca, E. Lopez-Collazo, et al. Reduced hepatic expression of farnesoid X receptor in hereditary cholestasis associated to mutation in ATP8B1 Hum. Mol. Genet., October 1, 2004; 13(20): 2451 - 2460. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Pineda Torra, L. P. Freedman, and M. J. Garabedian Identification of DRIP205 as a Coactivator for the Farnesoid X Receptor J. Biol. Chem., August 27, 2004; 279(35): 36184 - 36191. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Solaas, B. F. Kase, V. Pham, K. Bamberg, M. C. Hunt, and S. E. H. Alexson Differential regulation of cytosolic and peroxisomal bile acid amidation by PPAR{alpha} activation favors the formation of unconjugated bile acids J. Lipid Res., June 1, 2004; 45(6): 1051 - 1060. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Inoue, A.-M. Yu, J. Inoue, and F. J. Gonzalez Hepatocyte Nuclear Factor 4{alpha} Is a Central Regulator of Bile Acid Conjugation J. Biol. Chem., January 23, 2004; 279(4): 2480 - 2489. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Higuchi, A. Grambihler, A. Canbay, S. F. Bronk, and G. J. Gores Bile Acids Up-regulate Death Receptor 5/TRAIL-receptor 2 Expression via a c-Jun N-terminal Kinase-dependent Pathway Involving Sp1 J. Biol. Chem., January 2, 2004; 279(1): 51 - 60. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Kok, C. V. Hulzebos, H. Wolters, R. Havinga, L. B. Agellon, F. Stellaard, B. Shan, M. Schwarz, and F. Kuipers Enterohepatic Circulation of Bile Salts in Farnesoid X Receptor-deficient Mice: EFFICIENT INTESTINAL BILE SALT ABSORPTION IN THE ABSENCE OF ILEAL BILE ACID-BINDING PROTEIN J. Biol. Chem., October 24, 2003; 278(43): 41930 - 41937. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. O'Byrne, M. C. Hunt, D. K. Rai, M. Saeki, and S. E. H. Alexson The Human Bile Acid-CoA:Amino Acid N-Acyltransferase Functions in the Conjugation of Fatty Acids to Glycine J. Biol. Chem., September 5, 2003; 278(36): 34237 - 34244. [Abstract] [Full Text] [PDF] < |
