JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M302128200 on May 16, 2003

J. Biol. Chem., Vol. 278, Issue 30, 27703-27711, July 25, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/30/27703    most recent
M302128200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pircher, P. C.
Right arrow Articles by Westin, S. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pircher, P. C.
Right arrow Articles by Westin, S. K.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Farnesoid X Receptor Regulates Bile Acid-Amino Acid Conjugation*

Parinaz C. Pircher, Jennifer L. Kitto, Mary L. Petrowski, Rajendra K. Tangirala, Eric D. Bischoff, Ira G. Schulman and Stefan K. Westin {ddagger}

From the Department of Biology, X-Ceptor Therapeutics Inc., San Diego, California 92121

Received for publication, February 28, 2003 , and in revised form, May 7, 2003.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The farnesoid X receptor (FXR; NR1H4) regulates bile acid and lipid homeostasis by acting as an intracellular bile acid-sensing transcription factor. Several identified FXR target genes serve critical roles in the synthesis and transport of bile acids as well as in lipid metabolism. Here we used Affymetrix micro-array and Northern analysis to demonstrate that two enzymes involved in conjugation of bile acids to taurine and glycine, namely bile acid-CoA synthetase (BACS) and bile acid-CoA: amino acid N-acetyltransferase (BAT) are induced by FXR in rat liver. Analysis of the human BACS and BAT genes revealed the presence of functional response elements in the proximal promoter of BACS and in the intronic region between exons 1 and 2 of the BAT gene. The response elements resemble the consensus FXR binding site consisting of two nuclear receptor half-sites organized as an inverted repeat and separated by a single nucleotide (IR-1). These response elements directly bind FXR/retinoid X receptor (RXR) heterodimers and confer the activity of FXR ligands in transient transfection experiments. Further mutational analysis confirms that the IR-1 sequence of the BACS and BAT genes mediate transactivation by FXR/RXR heterodimers. Finally, Fisher rats treated with the synthetic FXR ligand GW4064 clearly show increased transcript levels of both the BACS and BAT mRNA. These studies demonstrate a mechanism by which FXR regulates bile acid amidation, a critical component of the enterohepatic circulation of bile acids.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Bile acids act as signaling molecules that regulate their own synthesis and transport, at least in part, by serving as physiological ligands for the farnesoid X receptor (FXR1; NR1H4), a member of the nuclear receptor superfamily (14). For example, bile acid-activated FXR exerts inhibitory effects on the gene encoding cholesterol-7{alpha} hydroxylase (CYP7A1), the rate-limiting enzyme in bile acid synthesis, indirectly by inducing the gene encoding the short heterodimer partner (SHP). SHP then inactivates CYP7A1 by binding to liver receptor homolog 1, a competence factor for CYP7A1 expression (5, 6). A similar mechanism has also been shown for bile acid feedback repression of the sodium/taurocholate cotransporter peptide (NTCP), the major bile acid uptake protein in the liver (7). In contrast, bile acid-activated FXR directly induces the transcription of the gene for the bile salt export pump (BSEP), the principal bile salt efflux pump in the liver (8). Thus, regulation of hepatic gene expression by FXR promotes a net efflux of bile acids from the liver.

FXR induces transcription of SHP and BSEP by binding DNA sequences composed of two inverted repeats separated by one nucleotide (IR-1) as a heterodimer with the retinoid X receptor (RXR) (5, 6, 8). FXR also activates transcription of the ileal bile acid-binding protein (IBABP) and phospholipid transfer protein (PLTP) genes via IR-1 elements in the promoters of these genes (9, 10). In contrast to this IR-1 arrangement, FXR has also been shown to bind and activate an inverted repeat without a spacing nucleotide (IR-0). This IR-0 arrangement was found to be the cognate FXR element in the dehydroepiandrosterone sulfotransferase gene, which encodes an enzyme with bile acid sulfo-conjugating activity (11).

Bile acids are synthesized in the liver from cholesterol and conjugated to glycine or taurine before they are secreted into bile canaliculi (12, 13). In humans conjugated bile acids are the major solutes in bile, whereas unconjugated bile acids are almost nondetectable. Importantly, conjugated bile acids are less toxic and are more efficient promoters of intestinal absorption of dietary lipid than unconjugated bile acids (14). The primary bile acids in humans, cholic acid and chenodeoxycholic acid, are synthesized via the concerted action of enzymes located in the endoplasmic reticulum, cytosol, mitochondria, and peroxisomes (13). The immediate precursors of the C24 bile acids cholate and chenodeoxycholate are the C27 compounds 3{alpha},7{alpha},12{alpha}-trihydroxy-5-{beta}-cholestanoic acid (THCA) and 3{alpha}, 7{alpha},12{alpha}-dihydroxy-5-{beta}-cholestanoic acid (DHCA), respectively. Before chain shortening of THCA and DHCA via peroxisomal {beta}-oxidation can take place, the C27 compounds have to be activated to their CoA thioesters. Current knowledge of the synthesis of bile acid-amino acid conjugates in human liver involves two independent enzyme reactions (15). An ATP-dependent microsomal enzyme, bile acid-CoA synthetase (BACS), catalyzes the formation of the thioester intermediate and is considered the rate-limiting step in bile acid amidation (16). Interestingly, it was recently demonstrated that human very long chain acyl CoA synthetase homolog 2 (VLCS-H2) is a bile acid-CoA synthetase (17). VLCS-H2 belongs to a family that includes very long chain synthetase (VLCS) and fatty acid transport proteins. In the second reaction, the thioester bond is cleaved and an amide bond is formed between the bile acid and the amino acids glycine or taurine. The bile acid-CoA:amino acid N-acetyltransferase (BAT) catalyzes this reaction (18).

Here we show that FXR regulates the expression of genes required for bile acid conjugation to amino acids. We have used Northern analysis and micro-array technology to identify BACS and BAT as FXR target genes. Induction of BACS and BAT gene expression occurs through the direct interaction of FXR/RXR heterodimers with conserved IR-1 elements in the promoter of BACS and in the first intron of the human BAT gene. Finally we show that these genes are up-regulated in rats treated with a synthetic FXR ligand. These findings provide further evidence for the critical role of FXR in regulating bile acid homeostasis.


    EXPERIMENTAL PROCEDURES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Affymetrix GeneChip Expression Analysis—Oligonucleotide microarray experiments were performed on 10 µg of total RNA and analyzed according to protocols developed by Affymetrix (Santa Clarita, CA). Briefly, after quality determination on test arrays, samples were hybridized for 16 h at 45 °C to Affymetrix Rat Genome arrays (U34A). Arrays were washed and then stained with streptavidin-phycoerythrin (genome arrays were amplified with an anti-streptavidin Ab). Stained arrays were scanned with the GeneArray scanner (Agilent Technologies, Palo Alto, CA). Raw data were collected and analyzed by using Affymetrix Microarray Suite and Data Mining Tools software. Experiments were done in two replicates from two rat primary hepatocyte pools. Each of the two compound-treated samples was compared with vehicle-treated samples resulting in four pairwise comparisons for each treatment. Genes with concordance exceeding 75% were considered statistically significant (p < 0.05).

RNA Isolation and Northern Blot Analysis—Total RNA was isolated from rat primary hepatocytes and rat liver RNA using TRIzol reagent (Invitrogen) and further purified by using an RNeasy kit (Qiagen, Valencia, CA). Poly(A)+ RNA was purified from rat liver total RNA using Oligotex (Qiagen) according to the manufacturer's instructions. Five micrograms of poly(A)+ RNA was resolved on a 1% agarose/formaldehyde gel, transferred to nylon membrane, and cross-linked to the membrane with UV light. cDNA probes were radiolabeled with [{alpha}-32P]dCTP using the Rediprime II labeling kit (Amersham Biosciences). Membranes were hybridized using the Rapid hybridization buffer (Amersham Biosciences), washed according to the manufacturer's instructions, and quantified using a Molecular Imager (Bio-Rad).

Taqman Primers and Probes—Oligonucleotide primers and probes for rat SHP and BSEP were designed using the Primer Express program and were synthesized by Integrated DNA Technologies Inc. The sequences (5'->3') were as follows: Rat SHP, forward primer (ttggatttcctcggtttgc), probe (6FAM-cagtgtttgactaadtgtccagcaggcc-TAMRA), and reverse primer (acccaggtaagggaaggcata); rat BSEP, forward primer (tgcatgtcaggagacggc), probe (6FAM-tcacattgtggaactcaatttcacccttg-TAMRA), and reverse primer (tcacgtccggtctagaagga).

Primary Hepatocyte Cultures and Cell Lines—Primary rat hepatocytes were obtained from In Vitro Technologies plated on collagen-coated plates. Upon arrival (2 days after collagenase isolation), shipping media was replaced by fresh hepatocyte growth media (In Vitro Technologies). After a 2-h recovery period the cells were treated with vehicle (Me2SO) or the following FXR ligands: 100 µM 3{alpha},7{alpha}-dihydroxy-5{beta}-cholanic acid (CDCA), 1 µM 3-(2,6-dichlorophenyl)-4-(3'-carboxy-2-chlorostilben-4-yl)oxymethyl-5-isopropylisoxazole (GW4064) (19). After 48 h, total RNA was isolated from the cells. CV-1 cells were obtained from and maintained according to ATCC depository.

cDNA Probes and Reporter Genes—Human cDNAs for BAT and BACS were PCR-amplified from reverse-transcribed HepG2 mRNA using primers 5'-atgatccagttgacagctacccctgtg-3' and 5'-tcaagcatgttcctgtgcagctgcgtg-3' for BAT, and 5'-gtaccatgggtgtcaggcaacag-3' and 5'-cagagctcagcacagagtgcgc-3' for BACS. The PCR amplicons, 1230 and 667 bp for BAT and BACS, respectively, were radiolabeled and used as probes for Northern analysis. Human BAT and BACS gene sequences were obtained from GenBankTM. A fragment spanning ~1.5 kb of 5'-flanking sequence of the BACS (VLCS-H2) gene was PCR-amplified from human genomic DNA using primers 5'-gctgtgagcacctggatcagtgc-3' and 5'-gtgacgactgtcaccgaccaggag-3' and cloned into XhoI-HindIII sites of pGL3-basic vector (Promega). A fragment spanning nucleotide –383 to + 2751 of the BAT gene was PCR-amplified from human genomic DNA using primers 5'-ccctggtctcctgcggtaccctcaggc-3' and 5'-gcacaagcagggcacgcatgtggg-3' and cloned into SacI-XhoI sites of pGL3-basic vector (Promega). The three-copy BACS IR-1 construct was generated by annealing the oligonucleotides 5'-agcttcccaaggggcagagacctgcggggcagagacctgcggggcagagacctgggag-3' and 5'-gatcctcccaggtctctgccccgcaggtctctgccccgcaggtctctgccccttggga-3' before ligation into HindIII/BamHI-digested TK-Luc. The three-copy BAT IR-1 was done using the oligonucleotides 5'-agcttcttggaggtcaagtgcctcgaggtcaagtgcctcgaggtcaagtgcctcgttg-3' and 5'-gatccaacgaggcacttgacctcgaggcacttgacctcgaggcacttgacctccaaga-3'. Point mutations of FXRE (IR-1) sequences were done using the QuikChange mutagenesis kit from Stratagene. For mutation of the BACS IR-1, an antisense primer (5'-gtggtgcccaaggaagcagagatttgggaacccaga-3') and a sense primer (5'-tctgggttcccaaatctctgcttccttgggcaccac-3') (mutated bases indicated in boldface type) were used in a PCR according to the manufacturer's directions. For mutation of the IR-1 in the BAT gene, the antisense primer (5'-aggcatcttggaaatcaagtgtttcgttcatccttg-3') and the sense primer (5'-caaggatgaacgaaacacttgatt- tccaagatgcct-3') were used. All oligonucleotides primers were ordered from Integrated DNA Technologies Inc. The sequences of all constructs were verified by automated DNA sequencing.

Transient Transfections and Reporter Gene Assays—CV-1 cells were transfected using the FuGENE 6 reagent (Roche Applied Science). Briefly, 30 ng of reporter plasmid, 10 ng of pCMX-hFXR, 10 ng of pCMX-hRXR{alpha}, and 10 ng of pCMV-{beta}-galactosidase and 0.28 µl of FuGENE 6 were used in a final volume of 10 µl. After a 15-min incubation at room temperature, the mixture was added to cells in 96-well plates and incubated for5hat37 °C. The cells were then treated with medium containing 10% charcoal/dextran-stripped fetal bovine serum and vehicle (Me2SO) or one of the following ligands: 100 µM CDCA, 1 µM GW4064, or 0.1 µM LG1305. After 24 h, cells were lysed and assayed for luciferase and {beta}-galactosidase activity. The normalized luciferase units (RLUs) were determined by dividing the luciferase activity by the {beta}-galactosidase activity.

Electrophoretic Mobility Shift Assays—Core sequences of the BAT, BACS, and IBABP IR-1s are shown below in Fig. 2A. Annealed double-stranded oligonucleotides were radiolabeled with [{alpha}-32P]dCTP using the Klenow fragment of DNA polymerase II. hFXR and hRXR{alpha} were synthesized from pCMX-FXR and pCMX-RXR{alpha} expression vectors using the TNT T7 Coupled Reticulocyte System (Promega, Madison, WI). Binding reactions contained 20 mM Hepes, pH 7.2, 75 mM KCl, 2 mM dithiothreitol, 0.2% Nonidet P-40, 15% glycerol, 1 µg of poly(dI-dC)-poly(dI-dC), 3 µl each of synthesized receptor proteins, and 0.05 pmol of 32P-labeled double-stranded oligonucleotide. Competitor oligonucleotides were added at 50- and 150-fold molar excesses. The oligonucleotides used for BAT and BACS IR-1s were 5'-agcttcttggaggtcaagtgcctcgttg-3' and 5'-agcttcccaaggggcagagacctgggag-3', respectively (only one strand is shown, and the IR-1 is indicated in boldface). IBABP IR-1 was 5'-agcttttccttaaggtgaataaccttggggct-3'.



View larger version (25K):
[in this window]
[in a new window]
 
FIG. 2.
The BACS and BAT genes contain potential FXREs. A, comparison of BACS and BAT FXREs to an IR-1 found in the mouse IBABP gene and an idealized IR-1 consensus sequence. B, location of FXREs (IR-1s) in the BACS and BAT genes and comparison to the IBABP consensus IR-1. Exon 1 indicates the first exon, and the star marks the translation start site of each gene.

 

Animal Studies—Male F344/NHsd rats were fed ad libitum and were kept under standard light/dark cycle. The GW4064 compound was suspended in 0.5% carboxymethyl cellulose vehicle for a dosing volume of 1 ml. Animals were dosed bis in die for 7 days with a 16-gauge 5.08-cm feeding needle to give a final concentration of 100 mg/kg.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Identification of BAT as a FXR Target Gene—To identify FXR target genes expressed in the liver, primary rat hepatocytes were used for gene expression profiling experiments. Cells were treated for 48 h with CDCA (100 µM) or the synthetic FXR ligand GW4064 (1 µM), whereas control cells were treated with Me2SO (vehicle) before isolation of total RNA. To confirm that FXR target genes were regulated in this experiment, quantitative reverse transcription-PCR analysis of total RNA was performed using specific primers for BSEP and SHP. SHP mRNA levels were significantly increased with the synthetic FXR agonist GW4064, whereas an increase of ~2-fold was seen with CDCA compared with vehicle-treated cells (Fig. 1A) consistent with studies indicating that CDCA is a weak activator of SHP in vivo (20). BSEP mRNA levels were also induced by GW4064, and a 2-fold induction was seen with CDCA (Fig. 1B). Having verified regulation of FXR target genes in this experiment, total RNA from each sample was processed and hybridized to Affymetrix rat genomic U34A GeneChips according to Affymetrix protocols. Differentially expressed genes were identified by comparing hybridization signals for FXR ligand treated samples to signals for vehicle treated samples using the Affymetrix Microarray Suite and Data Mining Tools software. Expression profiling by a natural versus a synthetic FXR agonist of primary hepatocytes indicated some degree of overlap but also separation of activities by these ligands (Tables I, II, III). Two known FXR target genes, BSEP and SHP, and one novel target gene, namely bile acid-CoA:amino acid N-acetyltransferase (BAT), were clearly differentially expressed in this experiment (Tables I and II). We decided to focus on the BAT gene for further characterization, because FXR has previously been shown to play a critical role in bile acid homeostasis. The BAT transcript was induced ~2-fold by GW4064 as well as with CDCA in the micro-array experiment.



View larger version (14K):
[in this window]
[in a new window]
 
FIG. 1.
Induction of FXR target genes in rat primary hepatocytes. Cells were cultured as described under "Experimental Procedures" and treated with FXR ligands GW4064 (1 µM) and CDCA (100 µM) for 48 h. Total RNA was prepared, and mRNA levels of FXR targets were determined by quantitative RT-PCR. A, SHP mRNA levels; B, BSEP mRNA levels.

 

View this table:
[in this window]
[in a new window]
 
TABLE I
Genes regulated by GW4064 and CDCA in rat primary hepatocytes

Listed are genes that showed 1.8-fold regulation in at least one of the treatments and above 1.5-fold in the other treatment. Induction/repression is expressed as -fold over vehicle-treated cells.

 

View this table:
[in this window]
[in a new window]
 
TABLE II
Genes regulated by GW4064 but not CDCA in rat primary hepatocytes

Listed are genes that showed above a 2.0-fold regulation. Induction/repression is expressed as -fold over vehicle-treated cells.

 

View this table:
[in this window]
[in a new window]
 
TABLE III
Genes regulated by CDCA but not GW4064 in rat primary hepatocytes

Listed are genes that showed above a 2.0-fold regulation. Induction/repression is expressed as -fold over vehicle-treated cells.

 

The Human BACS and BAT Genes Contain Potential FXREs—The finding that BAT is transcriptionally activated by FXR ligands suggested that the rate-limiting enzyme in bile acid-amino acid conjugation, bile acid-CoA synthetase (BACS) may also be an FXR target gene. To date, most functional binding sites (FXRE) identified in FXR target genes correspond to two inverted repeats spaced by one nucleotide as exemplified by the IR-1 from the mouse IBABP promoter (Fig. 2A). Analysis of the proximal promoter of the human BACS gene identified a potential IR-1 (5'-GGGGCAaAGACCT-3') in the flanking region located ~230 bp upstream of the transcription start site. Similar analysis of the proximal promoter and intron 1 of the human BAT gene identified an IR-1 (5'-AGGTCAaGTGCCT-3') located in intron 1 at +2615 to +2628 relative to the transcription start site (Fig. 2B). Electrophoresis mobility gel shift assays (EMSA) and transient transfection experiments were next performed to investigate direct binding and functionality of the FXR/RXR binding to these sequences.

FXR/RXR Heterodimers Bind to FXREs in the BACS and BAT Genes—EMSA experiments with a radiolabeled oligonucleotide spanning the BACS IR-1 showed that when incubated with in vitro translated FXR and RXR protein this element produced a significant band shift that was competed with 150-fold molar excess of unlabeled BACS or IBABP IR-1. No shifted DNA-protein complex was observed when either FXR or RXR was omitted from the EMSAs (Fig. 3A). An oligonucleotide containing the BAT IR-1 sequence was next radiolabeled and used in a gel-shift experiment (Fig. 3B). The BAT IR-1 produced a significant band shift when incubated with FXR and RXR proteins but not when incubated by RXR alone. Interestingly, a weak band shift was detected when the BAT IR-1 was incubated with FXR alone, indicating that FXR may bind as a monomer or homodimer to this DNA element. The binding of FXR/RXR was blocked by 50- and 150-fold excesses of either unlabeled BAT IR-1 or IBABP IR-1. Conversely, the binding of FXR/RXR heterodimers to the radiolabeled IBABP IR-1 was efficiently competed by 50- and 150-fold molar excesses of either unlabeled IBABP IR-1, BAT IR-1 (Fig. 3C), or BACS IR-1 (data not shown).



View larger version (30K):
[in this window]
[in a new window]
 
FIG. 3.
FXR/RXR heterodimers bind to IR-1 elements in the proximal BACS gene promoter and an intronic element in the BAT gene. AC, FXR/RXR proteins bind to radiolabeled IR-1 sequences from the BACS and BAT genes with similar affinities as binding to an IR-1 from the mouse IBABP gene. Electrophoretic mobility shift assays were performed using in vitro translated FXR/RXR proteins and radiolabeled IR-1s as outlined under "Experimental Procedures." Competitions were done using unlabeled oligonucleotides at 50- and 150-fold molar excesses as indicated.

 

The BACS and BAT IR-1s Are Functional FXREs in the Context of a Heterologous Promoter—To test the ability of the BACS and BAT IR-1 elements to function as FXREs, three copies of each of the IR-1s were cloned into the thymidine kinase luciferase (TK-Luc) reporter plasmid. The resultant 3xBACS-IR-1-TK-Luc and 3xBAT-IR-1-TK-Luc reporters were cotransfected with expression plasmids for FXR and RXR into CV-1 cells. After treatment with vehicle (Me2SO), GW4064, and CDCA the cells were lysed and assayed for luciferase activity. The BACS and BAT IR-1 elements were able to confer FXR-dependent transactivation as demonstrated by activation of the 3xBACS-IR-1-TK-Luc (Fig. 4A) and 3xBAT-IR-1-TK-Luc (Fig. 4B) reporters by GW4064 and CDCA, whereas no significant induction was seen with the empty TK-Luc vector (Fig. 4, A–B). Similar activities were achieved with a three-copy IR-1 from the mouse IBABP promoter (data not shown). These data together with the band-shift results in Fig. 3 suggest that the two IR-1s from the BACS and BAT genes are functional FXR binding sites.



View larger version (17K):
[in this window]
[in a new window]
 
FIG. 4.
FXR and FXR ligands activate reporter genes under control of BACS and BAT IR-1 sequences. A and B, the IR-1 sequences from the BACS and BAT genes are functional FXREs in the context of a heterologous promoter. CV-1 cells were transfected with either 3xBACS-IR-1-TK-Luc, 3xBAT-IR-1-TK-Luc, or TK-Luc reporters, together with pCMX-RXR{alpha}, pCMX-FXR, and pCMV-{beta}-galactosidase. Cells were then treated with vehicle control (Me2SO), 1 µM GW4064, or 100 µM CDCA, and lysed cells were assayed for luciferase activity 24 h later. The results were normalized to {beta}-galactosidase activity, expressed as relative light units (RLUs), and represent the mean ± S.D. of triplicate determinations. Transfections were performed at least three times, and one representative experiment is shown.

 

The BACS and BAT IR-1s Are Functional FXREs in the Context of Their Native Gene—To demonstrate that the BACS IR-1 is a functional FXRE in the context of its natural promoter, ~1.5 kb of the 5' flanking region of the human BACS gene was cloned in pGL3b, and the resultant reporter gene construct was tested in transient transfection experiments using CV-1 cells (Fig. 5A). This region of the BACS gene conferred significant FXR activity mediated by GW4064 as well as CDCA. The BACS promoter was also significantly activated by the synthetic RXR ligand LG1305, and an additive effect was seen with the combination of LG1305 with GW4064 or CDCA. Mutation of the putative IR-1 in the BACS gene reporter construct significantly reduced the FXR/RXR-mediated activity (Fig. 5A). It is concluded from these experiments that the BACS gene confers FXR regulation via a functional FXRE located in the proximal promoter of the gene. To demonstrate that the BAT IR-1 element identified in the above experiments is a functional FXRE in the context of the BAT gene promoter, a fragment spanning the human BAT gene from –383 to + 2751 was cloned into the luciferase vector pGL3 and the resultant reporter gene (BAT-wt-Luc) was tested for FXR-dependent transactivation. No activation of the BAT-wt-Luc by FXR or RXR ligands was observed in CV-1 cells when cotransfected with FXR and RXR expression plasmids (data not shown). FXR ligand-dependent activation of the BAT promoter/intron 1 construct was observed, however, when a VP16-FXR fusion protein was introduced (Fig. 5B). Importantly, the ligand-dependent activation detected with VP16-FXR requires the IR-1 sequence in the first intron, because mutation of this site eliminates the response (Fig. 5B). The failure to see activation of the BAT promoter/intron by wild-type FXR most likely arises from the relatively low transcriptional activity of this reporter in CV-1 cells. A similar VP16-FXR construct was used to define the FXR-dependent regulation of apoCII (21). We conclude from these experiments that the BAT gene contains a functional FXRE located in the first intron of the gene.



View larger version (23K):
[in this window]
[in a new window]
 
FIG. 5.
The IR-1 sequences in the BACS and BAT genes mediate transactivation by FXR/RXR heterodimers. A, the BACS IR-1 is a functional FXRE in the context of the native BACS gene. CV-1 cells were transfected with either wild-type or mutated BACS reporter genes, together with pCMX-RXR{alpha}, pCMX-FXR, and pCMV-{beta}-galactosidase. B, the IR-1 in intron 1 of the BAT gene is a functional FXRE in the context of the native gene. CV-1 cells were transfected with either wild-type or mutated BAT promoter/intron-Luc reporters and pCMV-{beta}-galactosidase with or without plasmids for pCMX-VP16FXR and pCMX-RXR{alpha}. Transfected cells were treated with vehicle control (Me2SO), 1 µM GW4064, 100 µM CDCA, 0.1 µM LG1305, or a combination of FXR and RXR ligands, and lysed cells were assayed for luciferase activity 24 h later. The results were normalized to {beta}-galactosidase activity, expressed as relative light units (RLUs), and represent the mean ± S.D. of triplicate determinations. Transfections were performed at least three times, and one representative experiment is shown.

 

Hepatic BACS and BAT mRNAs Are Induced in Vivo—To confirm that the FXR-dependent regulation of BAT and BACS observed in vitro also occurs in vivo, Fisher rats (six vehicle- and six GW4064-treated) were treated for 7 days with the synthetic FXR agonist GW4064. Northern blot analysis demonstrated that treatment of rats with GW4064 (lanes 1–6) results in the induction of BAT mRNA compared with vehicle (lanes 7–12)-treated rats (Fig. 6A). Similarly, the BACS transcript was also significantly induced by the GW4064 ligand in rat liver. After normalization to the glyceraldehyde-3-phosphate dehydrogenase control transcript, the BAT and the BACS transcripts showed an average induction of ~2- to 3-fold by GW4064 compared with vehicle-treated rats (Fig. 6B). Taken together these results support the conclusion that both the BAT and the BACS genes are direct targets of FXR.



View larger version (35K):
[in this window]
[in a new window]
 
FIG. 6.
Northern blot analysis of BAT and BACS mRNAs from vehicle- or GW4064-treated rats. A, rats were administered vehicle (Me2SO) (lanes 1–6) or GW4064 (lanes 7–12) for 7 days as described under "Experimental Procedures." Total RNA was prepared, and 5 µg of poly(A)+-enriched RNA was loaded in each lane. After blotting the filter was hybridized with the indicated radiolabeled cDNAs. B, relative mRNA levels for BAT and BACS were determined for rats treated as described in panel A. Values (±S.D.) are the average obtained for each group of rats (n = 6) after normalization to glyceraldehyde-3-phosphate dehydrogenase mRNA. Significant differences compared with vehicle treated rats; ***, p < 0.0005.

 


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Bile acids are not simply by-products of cholesterol metabolism but play an essential role in solubilizing cholesterol and facilitating the uptake of dietary lipids. In addition, recent discoveries have established bile acids, including CDCA and CA, and their respective conjugated metabolites, as signaling molecules that bind and activate the nuclear receptor FXR (22). FXR is highly expressed in the enterohepatic system where it acts as a bile acid sensor that protects the body from elevated bile acid concentrations. The role of FXR in coordinating the expression of genes involved in bile acid homeostasis has been firmly established by the use of natural and synthetic FXR agonists and FXR knockout mice (19, 23, 24). The bile acid-sensing function of FXR is largely achieved through the regulation of genes involved in bile acid transport and biosynthesis (25). These include the transport proteins BSEP, NTCP, and IBABP, as well as proteins affecting bile acid synthesis like CYP7A1, CYP8B1, and SHP. In addition, dehydroepiandrosterone-sulfotransferase, an enzyme with bile acid sulfo-conjugating activity, is directly regulated by FXR suggesting involvement also in bile acid detoxification and clearance (11).

In the present study we show that the genes encoding two key enzymes in bile acid-amino acid conjugation, BAT and BACS, are direct targets of the bile acid receptor FXR further expanding and confirming the critical role of this receptor in bile acid homeostasis. We used micro-array technology and identified BAT as a novel FXR target gene and then hypothesized that BACS, which catalyzes the rate-limiting reaction in conjugation of bile acid to taurine or glycine, may also be a target gene for FXR. A search for FXR binding sites in the human BACS gene identified one potential IR-1 in the proximal promoter of this gene. We presented evidence that the FXR-mediated activation of BACS gene transcription is mediated through this IR-1 and based upon gel-shift and competition experiments that RXR/FXR heterodimers directly bind to this element. Further mutational studies established that induction of a reporter gene was dependent on an intact IR-1 element. The observation that the proximal promoter of the BAT gene was not induced by FXR ligands (data not shown) coupled with the fact that an intronic sequence did confer FXR responsiveness led us to conclude that bile acid activation of the BAT gene is likely mediated by the FXRE in the first intron. Conceivably, other FXREs located further upstream to the BAT gene sequences used in the present study could contribute to the FXR-dependent induction of this gene. However, analysis of the rat genomic sequence for BAT showed a similar location (intron 1) of an IR-1 as for the human gene (data not shown), further supporting the conclusion that FXR regulates the BAT gene via an intronic FXRE. Functional intronic nuclear receptor binding sites have recently been found in the lipoprotein lipase gene and the gene encoding acyl-CoA-binding protein (26, 27). The current study demonstrates that BACS and BAT mRNAs are induced in rat liver in response to natural and synthetic FXR ligands. Interestingly, the FXR-dependent induction of BACS and BAT mRNA may be specific to rats, because similar studies in mice failed to demonstrate regulation of these mRNAs. On the other hand, human gene promoter sequences were used in the present study, suggesting FXR-dependent regulation in humans.

The two-step process of conjugation of bile acids with the amino acids taurine and glycine is a result of the successive action of BACS and BAT. Our results establish a role of FXR in regulating these processes. One question raised by these findings is what is the physiological basis for the regulation of bile acid-amidation by FXR. High concentrations of bile acids in the hepatocyte repress further synthesis mediated by CYP7A1, the rate-limiting enzyme of bile acid biosynthesis (13). Current understanding is that bile acids, by acting as FXR ligands, inhibit bile acid synthesis partly via activation of SHP, which in turn represses CYP7A1 (5, 6). FXR activators also decrease the intracellular bile acid concentration by directly inducing BSEP, a bile acid export pump, and by indirectly repressing NTCP, which extracts bile acids from the blood. In the enterocytes of the ileum, bile acids are efficiently reclaimed for return to the liver. In these ileal enterocytes, bile acids induce the expression of the cytosolic-binding protein IBABP, another FXR target gene that has been proposed to buffer intracellular bile acids and promote their translocation into the portal circulation. Based on the current study we propose that FXR, by controlling the level of bile acid amidation, regulates intracellular levels of unconjugated bile acids, which can be cytotoxic unless they are conjugated. Importantly, BSEP does not translocate unconjugated bile acids into bile (28). Individuals with mutations in the BAT gene have no conjugated bile acids. Consequently, small quantities of bile acids enter into bile. In these patients most of the unconjugated bile acids diffuse out of hepatocytes and into plasma, leading to high serum bile acid concentrations and low intestinal concentrations (29).

In conclusion, our results show that two genes encoding bile acid-amino acid conjugation enzymes are induced by FXR ligands in the liver via IR-1 elements cognate to the FXR/RXR heterodimer. The identification of FXR target genes involved in bile acid amidation is consistent with an important role of this nuclear receptor in regulating cholesterol and bile acid metabolism in the liver, excretion of bile acids into bile, and the re-uptake of bile acids from the intestinal lumen. These observations thus couple the process of bile acid conjugation to bile acid synthesis and transport via transcriptional regulation by FXR.


    FOOTNOTES
 
* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

{ddagger} To whom correspondence should be addressed: Dept. of Biology, X-Ceptor Therapeutics Inc., 4757 Nexus Centre Dr., San Diego, CA 92121. Tel.: 858-458-4522; Fax: 858-458-4501; E-mail: swestin{at}x-ceptor.com.

1 The abbreviations used are: FXR, farnesoid X receptor; CYP7A1, cholesterol-7{alpha} hydroxylase; SHP, short heterodimer partner; NTCP, sodium/taurocholate cotransporter peptide; BSEP, bile salt export pump; IR, inverted repeat; RXR, retinoid X receptor; IBABP, ileal bile acid receptor; THCA, trihydroxycholestanoic acid; DHCA, dihydroxycholestanoic acid; BACS, bile acid-CoA synthetase; VLCS-H2, very long chain acyl CoA synthetase homolog 2; BAT, bile acid-CoA:amino acid N-acetyltransferase; 6-FAM, 6-carboxyfluorescein; 6-TAMRA, 6-carboxytetramethylrhodamine; CA, cholic acid; CDCA, chenodeoxycholic acid; FXRE, farnesoid X receptor element; RLUs, relative light units; EMSA, electrophoretic mobility shift assay. Back


    ACKNOWLEDGMENTS
 
We thank Drs. Richard Martin and Jeff Kahl for the chemical synthesis of GW4064; Chris Daige and Calvin Vu for help with animal studies; and Bosun Kim for technical assistance.



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Makishima, M., Okamoto, A. Y., Repa, J. J., Tu, H., Learned, R. M., Luk, A., Hull, M. V., Lustig, K. D., Mangelsdorf, D. J., and Shan, B. (1999) Science 284, 1362–1365[Abstract/Free Full Text]
  2. Parks, D. J., Blanchard, S. G., Bledsoe, R. K., Chandra, G., Consler, T. G., Kliewer, S. A., Stimmel, J. B., Willson, T. M., Zavacki, A. M., Moore, D. D., and Lehmann, J. M. (1999) Science 284, 1365–1368[Abstract/Free Full Text]
  3. Wang, H., Chen, J., Hollister, K., Sowers, L. C., and Forman, B. M. (1999) Mol. Cell 3, 543–553[Medline] [Order article via Infotrieve]
  4. Nuclear Receptors Nomenclature Committee (1999) Cell 97, 161–163[CrossRef][Medline] [Order article via Infotrieve]
  5. Goodwin, B., Jones, S. A., Price, R. R., Watson, M. A., McKee, D. D., Moore, L. B., Galardi, C., Wilson, J. G., Lewis, M. C., Roth, M. E., Maloney, P. R., Willson, T. M., and Kliewer, S. A. (2000) Mol. Cell 6, 517–526[CrossRef][Medline] [Order article via Infotrieve]
  6. Lu, T. T., Makishima, M., Repa, J. J., Schoonjans, K., Kerr, T. A., Auwerx, J., and Mangelsdorf, D. J. (2000) Mol. Cell 6, 507–515[CrossRef][Medline] [Order article via Infotrieve]
  7. Denson, L. A., Sturm, E., Echevarria, W., Zimmerman, T. L., Makishima, M., Mangelsdorf, D. J., and Karpen, S. J. (2001) Gastroenterology 121, 140–147[CrossRef][Medline] [Order article via Infotrieve]
  8. Ananthanarayanan, M., Balasubramanian, N., Makishima, M., Mangelsdorf, D. J., and Suchy, F. J. (2001) J. Biol. Chem. 276, 28857–28865[Abstract/Free Full Text]
  9. Grober, J., Zaghini, I., Fujii, H., Jones, S. A., Kliewer, S. A., Willson, T. M., Ono, T., and Besnard, P. (1999) J. Biol. Chem. 274, 29749–29754[Abstract/Free Full Text]
  10. Urizar, N. L., Dowhan, D. H., and Moore, D. D. (2000) J. Biol. Chem. 275, 39313–39317[Abstract/Free Full Text]
  11. Song, C. S., Echchgadda, I., Baek, B. S., Ahn, S. C., Oh, T., Roy, A. K., and Chatterjee, B. (2001) J. Biol. Chem. 276, 42549–42556[Abstract/Free Full Text]
  12. Bahar, R. J., and Stolz, A. (1999) Gastroenterol. Clin. North Am. 28, 27–58[CrossRef][Medline] [Order article via Infotrieve]
  13. Vlahcevic, Z. R., Pandak, W. M., and Stravitz, R. T. (1999) Gastroenterol. Clin. North Am. 28, 1–25[CrossRef][Medline] [Order article via Infotrieve]
  14. Vessey, D. A., Crissey, M. H., and Zakim, D. (1977) Biochem. J. 163, 181–183[Medline] [Order article via Infotrieve]
  15. Solaas, K., Ulvestad, A., Soreide, O., and Kase, B. F. (2000) J. Lipid Res. 41, 1154–1162[Abstract/Free Full Text]
  16. Schersten, T., Bjorntorp, P., Ekdahl, P. H., and Bjorkerud, S. (1967) Biochim. Biophys. Acta 141, 155–163[Medline] [Order article via Infotrieve]
  17. Steinberg, S. J., Mihalik, S. J., Kim, D. G., Cuebas, D. A., and Watkins, P. A. (2000) J. Biol. Chem. 275, 15605–15608[Abstract/Free Full Text]
  18. Czuba, B., and Vessey, D. A. (1981) Biochem. J. 195, 263–266[Medline] [Order article via Infotrieve]
  19. Maloney, P. R., Parks, D. J., Haffner, C. D., Fivush, A. M., Chandra, G., Plunket, K. D., Creech, K. L., Moore, L. B., Wilson, J. G., Lewis, M. C., Jones, S. A., and Willson, T. M. (2000) J. Med. Chem. 43, 2971–2974[CrossRef][Medline] [Order article via Infotrieve]
  20. Li-Hawkins, J., Gafvels, M., Olin, M., Lund, E. G., Andersson, U., Schuster, G., Bjorkhem, I., Russell, D. W., and Eggertsen, G. (2002) J. Clin. Invest. 110, 1191–1200[CrossRef][Medline] [Order article via Infotrieve]
  21. Kast, H. R., Nguyen, C. M., Sinal, C. J., Jones, S. A., Laffitte, B. A., Reue, K., Gonzalez, F. J., Willson, T. M., and Edwards, P. A. (2001) Mol. Endocrinol. 15, 1720–1728[Abstract/Free Full Text]
  22. Russell, D. W. (1999) Cell 97, 539–542[CrossRef][Medline] [Order article via Infotrieve]
  23. Sinal, C. J., Tohkin, M., Miyata, M., Ward, J. M., Lambert, G., and Gonzalez, F. J. (2000) Cell 102, 731–744[CrossRef][Medline] [Order article via Infotrieve]
  24. Lambert, G., Amar, M. J., Guo, G., Brewer, H. B., Jr., Gonzalez, F. J., and Sinal, C. J. (2003) J. Biol. Chem. 278, 2563–2570[Abstract/Free Full Text]
  25. Chawla, A., Repa, J. J., Evans, R. M., and Mangelsdorf, D. J. (2001) Science 294, 1866–1870[Abstract/Free Full Text]
  26. Helledie, T., Grontved, L., Jensen, S. S., Kiilerich, P., Rietveld, L., Albrektsen, T., Boysen, M. S., Nohr, J., Larsen, L. K., Fleckner, J., Stunnenberg, H. G., Kristiansen, K., and Mandrup, S. (2002) J. Biol. Chem. 277, 26821–26830[Abstract/Free Full Text]
  27. Zhang, Y., Repa, J. J., Gauthier, K., and Mangelsdorf, D. J. (2001) J. Biol. Chem. 276, 43018–43024[Abstract/Free Full Text]
  28. Noe, J., Stieger, B., and Meier, P. J. (2002) Gastroenterology 123, 1659–1666[CrossRef][Medline] [Order article via Infotrieve]
  29. Carlton, V. E., Harris, B. Z., Puffenberger, E. G., Batta, A. K., Knisely, A. S., Robinson, D. L., Strauss, K. A., Shneider, B. L., Lim, W. A., Salen, G., Morton, D. H., and Bull, L. N. (2003) Nat. Genet. 34, 91–96[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Toxicol PatholHome page
M. B. Rosen, B. D. Abbott, D. C. Wolf, J. C. Corton, C. R. Wood, J. E. Schmid, K. P. Das, R. D. Zehr, E. T. Blair, and C. Lau
Gene Profiling in the Livers of Wild-type and PPAR{alpha}-Null Mice Exposed to Perfluorooctanoic Acid
Toxicol Pathol, June 1, 2008; 36(4): 592 - 607.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
N. A. Styles, J. L. Falany, S. Barnes, and C. N. Falany
Quantification and regulation of the subcellular distribution of bile acid coenzyme A:amino acid N-acyltransferase activity in rat liver
J. Lipid Res., June 1, 2007; 48(6): 1305 - 1315.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
D. D. Moore, S. Kato, W. Xie, D. J. Mangelsdorf, D. R. Schmidt, R. Xiao, and S. A. Kliewer
International Union of Pharmacology. LXII. The NR1H and NR1I Receptors: Constitutive Androstane Receptor, Pregnene X Receptor, Farnesoid X Receptor {alpha}, Farnesoid X Receptor beta, Liver X Receptor {alpha}, Liver X Receptor beta, and Vitamin D Receptor
Pharmacol. Rev., December 1, 2006; 58(4): 742 - 759.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
K. E. Matsukuma, M. K. Bennett, J. Huang, L. Wang, G. Gil, and T. F. Osborne
Coordinated control of bile acids and lipogenesis through FXR-dependent regulation of fatty acid synthase
J. Lipid Res., December 1, 2006; 47(12): 2754 - 2761.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
T. Claudel, B. Staels, and F. Kuipers
The Farnesoid X Receptor: A Molecular Link Between Bile Acid and Lipid and Glucose Metabolism
Arterioscler. Thromb. Vasc. Biol., October 1, 2005; 25(10): 2020 - 2030.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Ferdinandusse, S. Denis, H. Overmars, L. Van Eeckhoudt, P. P. Van Veldhoven, M. Duran, R. J. A. Wanders, and M. Baes
Developmental Changes of Bile Acid Composition and Conjugation in L- and D-Bifunctional Protein Single and Double Knockout Mice
J. Biol. Chem., May 13, 2005; 280(19): 18658 - 18666.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Li, P. C. Pircher, I. G. Schulman, and S. K. Westin
Regulation of Complement C3 Expression by the Bile Acid Receptor FXR
J. Biol. Chem., March 4, 2005; 280(9): 7427 - 7434.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
M. Miyata, A. Tozawa, H. Otsuka, T. Nakamura, K. Nagata, F. J. Gonzalez, and Y. Yamazoe
Role of Farnesoid X Receptor in the Enhancement of Canalicular Bile Acid Output and Excretion of Unconjugated Bile Acids: A Mechanism for Protection against Cholic Acid-Induced Liver Toxicity
J. Pharmacol. Exp. Ther., February 1, 2005; 312(2): 759 - 766.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
L. Alvarez, P. Jara, E. Sanchez-Sabate, L. Hierro, J. Larrauri, M. C. Diaz, C. Camarena, A. De la Vega, E. Frauca, E. Lopez-Collazo, et al.
Reduced hepatic expression of farnesoid X receptor in hereditary cholestasis associated to mutation in ATP8B1
Hum. Mol. Genet., October 1, 2004; 13(20): 2451 - 2460.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
I. Pineda Torra, L. P. Freedman, and M. J. Garabedian
Identification of DRIP205 as a Coactivator for the Farnesoid X Receptor
J. Biol. Chem., August 27, 2004; 279(35): 36184 - 36191.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
K. Solaas, B. F. Kase, V. Pham, K. Bamberg, M. C. Hunt, and S. E. H. Alexson
Differential regulation of cytosolic and peroxisomal bile acid amidation by PPAR{alpha} activation favors the formation of unconjugated bile acids
J. Lipid Res., June 1, 2004; 45(6): 1051 - 1060.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Inoue, A.-M. Yu, J. Inoue, and F. J. Gonzalez
Hepatocyte Nuclear Factor 4{alpha} Is a Central Regulator of Bile Acid Conjugation
J. Biol. Chem., January 23, 2004; 279(4): 2480 - 2489.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Higuchi, A. Grambihler, A. Canbay, S. F. Bronk, and G. J. Gores
Bile Acids Up-regulate Death Receptor 5/TRAIL-receptor 2 Expression via a c-Jun N-terminal Kinase-dependent Pathway Involving Sp1
J. Biol. Chem., January 2, 2004; 279(1): 51 - 60.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Kok, C. V. Hulzebos, H. Wolters, R. Havinga, L. B. Agellon, F. Stellaard, B. Shan, M. Schwarz, and F. Kuipers
Enterohepatic Circulation of Bile Salts in Farnesoid X Receptor-deficient Mice: EFFICIENT INTESTINAL BILE SALT ABSORPTION IN THE ABSENCE OF ILEAL BILE ACID-BINDING PROTEIN
J. Biol. Chem., October 24, 2003; 278(43): 41930 - 41937.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. O'Byrne, M. C. Hunt, D. K. Rai, M. Saeki, and S. E. H. Alexson
The Human Bile Acid-CoA:Amino Acid N-Acyltransferase Functions in the Conjugation of Fatty Acids to Glycine
J. Biol. Chem., September 5, 2003; 278(36): 34237 - 34244.
[Abstract] [Full Text] [PDF]
<