![]()
|
|
||||||||
J. Biol. Chem., Vol. 278, Issue 30, 27772-27780, July 25, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the aRobert H. Lurie Comprehensive Cancer Center and Division of Hematology-Oncology, Northwestern University Medical School and Lakeside Veterans Administration Medical Center, Chicago, Illinois 60611, the cSection of Hematology-Oncology, University of Chicago, Chicago, Illinois 60637, the gDivision of Cell & Molecular Biology, Toronto Research Institute, University Health, Network and Department of Immunology, University of Toronto, Toronto, Ontario M5S 3E2, Canada, the dDivision of Signal Transduction, Beth Israel Medical Center, Harvard Medical School, Boston, Massachusetts 02115, the eInstitut fuer Biochemie, Freie Universitaet Berlin, Berlin 14195, Germany, the hDepartment of Biochemistry, McGill University, Montreal, Quebec H3G 1Y6, Canada, and the iDepartment of Molecular Genetics, University of Illinois, Chicago, Illinois 60607
Received for publication, February 7, 2003 , and in revised form, May 13, 2003.
| ABSTRACT |
|---|
|
|
|---|
and
IFN
induce phosphorylation of insulin receptor substrate proteins and
downstream engagement of the phosphatidylinositol (PI) 3'-kinase
pathway. In the present study we provide evidence for the existence of a Type
I IFN-dependent signaling cascade activated downstream of PI 3'-kinase,
involving p70 S6 kinase. Our data demonstrate that p70 S6K is rapidly
phosphorylated on threonine 421 and serine 424 and is activated during
treatment of cells with IFN
or IFN
. Such activation of p70 S6K is
blocked by pharmacological inhibitors of the PI 3'-kinase or the FKBP
12-rapamycin-associated protein/mammalian target of rapamycin (FRAP/mTOR).
Consistent with this, the Type I IFN-dependent phosphorylation/activation of
p70 S6K is defective in embryonic fibroblasts from mice with targeted
disruption of the p85
and p85
subunits of the PI 3'-kinase
(p85
/
/). Treatment of sensitive cell
lines with IFN
or IFN
also results in
phosphorylation/inactivation of the 4E-BP-1 repressor of mRNA translation.
Such 4E-BP1 phosphorylation is also PI3'-kinase-dependent and
rapamycin-sensitive, indicating that the Type I IFN-inducible activation of
PI3'-kinase and FRAP/mTOR results in dissociation of 4E-BP1 from the
eukaryotic initiation factor-4E (eIF4E) complex. Altogether, our data
establish that the Type I IFN receptor-activated PI 3'-kinase pathway
mediates activation of the p70 S6 kinase and inactivation of 4E-BP1, to
regulate mRNA translation and induction of Type I IFN responses. | INTRODUCTION |
|---|
|
|
|---|
In addition to tyrosine phosphorylation of STAT proteins by
interferon-activated Jak kinases, phosphorylation on serine residues is
required for their full transcriptional activation
(1014).
It appears that, at least in the case of STAT1, phosphorylation on serine 727
is regulated by a member of the protein kinase C family of proteins, protein
kinase C
(15). There
is also accumulating evidence that the p38 MAPK pathway is activated in a Type
I IFN-dependent manner (16,
17) and that its function is
essential for gene transcription via ISRE
(16,
17) or GAS elements
(18). Such regulatory effects
of this pathway play critical roles in IFN signaling, because p38 activation
is essential for generation of Type I IFN-dependent antiproliferative
responses
(1921).
The p70 S6 kinase was originally identified as a kinase that regulates serine phosphorylation of the 40 S ribosomal S6 protein (2229). This kinase plays important roles in the regulation of cell-cycle progression, cell survival, as well as regulation of mRNA translation via phosphorylation of the 40 S ribosomal S6 protein (2235). Previous studies have established that the activation of this kinase is regulated by the FKBP 12-rapamycin-associated protein (FRAP/mTOR), whose activation is in turn regulated by the upstream activation of the phosphatidylinositol 3'-kinase pathway (3641).
The signals generated by the Type I interferon receptor to ultimately
regulate mRNA translation are not known. We have previously demonstrated that
Type I IFNs activate the insulin receptor substrate (IRS)-PI 3'-kinase
pathway in human and mouse cells
(4245)
and that both the lipid (42)
and serine (45) kinase
activities of the p110 catalytic subunit of the PI 3'-kinase are
activated during engagement of the Type I interferon receptor. In the present
study we sought to determine whether the p70 S6 kinase is activated downstream
of the PI 3'-kinase to mediate induction of Type I IFN responses. Our
data demonstrate that the p70 S6 kinase is rapidly phosphorylated and
activated during treatment of sensitive cell lines with IFN
or
IFN
. They also show that the IFN
-dependent
phosphorylation/activation of the p70 S6 kinase is defective in mouse
embryonic fibroblasts (MEFs) from p85
/
p85
/ double knock-out mice. In other studies we establish
that the translational mRNA repressor 4E-BP1 is phosphorylated in a Type I
IFN-dependent manner, and such phosphorylation is also PI
3'-kinase-dependent, further demonstrating that activation of PI
3-kinase/mTOR by Type I IFNs ultimately induces signals important for mRNA
translation.
| MATERIALS AND METHODS |
|---|
|
|
|---|
2 was
provided by Hoffmann-La Roche. Human recombinant consensus IFN
was
provided by Amgen Inc. Human recombinant IFN
was provided by Biogen Inc.
Antibodies against the phosphorylated forms of p70 S6 kinase, mTOR, and 4EBP-1
were obtained from Cell Signaling Technology Inc. An antibody against 4EB-P1
has been previously described
(46). The FRAP/mTOR inhibitor,
rapamycin, and the PI 3'-kinase inhibitors LY294002 and wortmannin were
obtained from Calbiochem Inc. (La Jolla, CA). U266 cells were grown in RPMI
1640 supplemented with fetal bovine serum and antibiotics. U2OS and T98G cells
were grown in McCoy's and Dulbecco's modified Eagle's media, respectively,
supplemented with fetal bovine serum and antibiotics. The generation of
p85
/
/ mice, by crossing
p85
+/ (48) mice
with p85
+/ mice
(47) will be described
elsewhere.2 The
p85
/
/ mouse embryonic fibroblasts
were obtained from p85
/
/ double
knock-out mice. Briefly, mouse embryos were harvested at day 14; the limbs,
head, and liver removed, and the resultant torso was finely minced. Following
trypsinization, the single cell suspension was transferred onto gelatinized
tissue culture dishes, and the mouse embryonic fibroblasts were immortalized
after a few passages using SV40 large T antigen, expressed by a retroviral
vector. The genotypes of the cells were determined by polymerase chain
reaction. All transfections were performed using FuGENE 6, according to the
manufacturer's instructions (Roche Applied Science).
Cell Lysis and ImmunoblottingCells were stimulated with 1 x 104 units/ml of the indicated IFNs for the indicated times, then lysed in phosphorylation lysis buffer as previously described (49). Immunoprecipitations and immunoblotting, using an enhanced chemiluminescence (ECL) method, were performed as previously described (49). In the experiments in which pharmacological inhibitors of FRAP/mTOR or the PI 3'-kinase were used, the cells were pretreated for 60 min with the indicated concentrations of the inhibitors and subsequently treated for the indicated times with IFNs, prior to lysis in phosphorylation lysis buffer. In some of the experiments to determine the phosphorylation of 4E-BP1, cell extracts were obtained by three freeze-thaw cycles, as previously described (46).
Chromatography on m7GDP-AgaroseChromatography of
cell extracts from IFN-treated cells on m7GDP-agarose was performed
essentially as previously described
(46,
51). Briefly, cell extracts
were obtained by four freeze-thaw cycles, in cold cap-binding buffer,
containing 100 mM KCl, 20 mM HEPES, pH 7.6, 7
mM
-mercaptoethanol, 0.2 mM EDTA, 10% glycerol, 50
mM
-glycerol phosphate, 50 mM NaF, 100
µM sodium orthovanadate, and 1 mM
phenylmethylsulfonyl fluoride. Protein extracts were subsequently incubated
for 60 min with m7GDP-agarose resin
(46,
51) at 4 °C. The resin was
then washed with cap-binding buffer, once with 500 ml and twice with 1 ml,
resuspended in Laemmli sample buffer, and boiled.
p70 S6 Kinase AssaysAssays to detect the Type I IFN-dependent activation of the p70 S6 kinase were performed as previously described (52). Briefly, cells were lysed in phosphorylation lysis buffer, and cell lysates were immunoprecipitated with an antibody against p70 S6 kinase or control non-immune rabbit immunoglobulin (RIgG). In vitro kinase assays were performed using a synthetic peptide substrate (AKRRRLSSLRA), and p70 S6 kinase activity was measured using an S6 kinase assay kit (Upstate Biotechnology Inc.) according to the manufacturer's instructions (52). Values were calculated by subtracting nonspecific activity, detected in RIgG immunoprecipitates, from kinase activity detected in anti-p70 S6K immunoprecipitates.
Isolation of Normal Peripheral Blood GranulocytesInformed consent was obtained from healthy volunteers, according to the guidelines established by the Institutional Review Board of Northwestern University Medical School. Polymorphonuclear leukocytes were separated from peripheral venous blood using the Mono-Poly resolving medium (M-PRM, ICN Biomedicals, Aurora, OH), as previously described (20). Briefly, after centrifugation at 300 x g for 30 min at room temperature, the plasma and the mononuclear leukocyte band were discarded, and the polymorphonuclear band was transferred into an individual tube. Cells were washed with culture medium and were subsequently resuspended in culture medium, prior to interferon treatment.
Mobility Shift AssaysActively growing cells were treated
with IFN
for the indicated times, in the presence or absence of
rapamycin, as indicated. 10 µg of nuclear extracts, from untreated or
IFN
-treated cells, was analyzed using electrophoretic mobility shift
assays, as described previously
(19,
20). A double-stranded
oligodeoxynucleotide (ATTTCCCGTAAATCCC), representing a sis-inducing element
(SIE) of the c-fos promoter, was synthesized and used in the gel
shift assays. A double-stranded oligodeoxynucleotide (CTGTTGGTTTCGTTTCCTCAGA),
representing an ISRE element from the ISG-15 gene, was also synthesized and
used to detect ISGF3 complexes.
Luciferase Reporter AssaysCells were transfected with a
-galactosidase expression vector and either an ISRE luciferase construct
or a luciferase reporter gene containing eight GAS elements linked to a
minimal prolactin promoter (8X-GAS), using the SuperFect transfection reagent
as per the manufacturer's recommended procedure (Qiagen). The ISRE-luciferase
construct (16) included an
ISG15 ISRE (TCGGGAAAGGGAAACCGAAACTGAAGCC) cloned via cohesive ends into the
BamHI site of the pZtkLuc vector and was provided by Dr. Richard Pine
(Public Health Research Institute, New York, NY). The 8X-GAS construct
(53) was kindly provided by
Dr. Christofer Glass (University of California San Diego, San Diego, CA).
Forty-eight hours after transfection, triplicate cultures were either left
untreated or treated with 5 x 103 units/ml IFN
, and
luciferase activity was subsequently measured using the manufacturer's
protocol (Promega). The measured luciferase activities were normalized for
-galactosidase activity for each sample.
| RESULTS |
|---|
|
|
|---|
or IFN
.
Molt-4 cells were incubated for 30 min in the presence or absence of
IFN
. Cells were lysed in phosphorylation lysis buffer, and total cell
lysates were analyzed by SDS-PAGE and immunoblotted with an antibody against
the phosphorylated form of p70 S6 kinase on threonine 421 and serine 424.
IFN
treatment resulted in strong phosphorylation of the p70 S6 kinase,
whereas there was no change in the amounts of p70 S6 kinase protein detected
after IFN
stimulation (Fig. 1,
A and B). Similarly, phosphorylation of p70 S6K
was detectable when another Type I IFN, IFN
, was used
(Fig. 1, C and
D). In experiments, in which the phosphorylation of the
p70 S6 kinase by Type I IFNs was determined, we found that both IFN
(Fig. 2, A and
B), as well as IFN
(Fig. 2, C and
D) are capable of inducing phosphorylation of the protein
when used at doses as low as 100 IU/ml, further emphasizing the specificity of
the process. Furthermore, the Type I interferon-dependent phosphorylation of
the p70 S6 kinase was inducible in various cell types, including U2OS
osteosarcoma cells (Fig. 3, A and
B) or U-266 multiple myeloma cells (Figs.
2A, 2B,
3C, and
3D).
|
|
|
Phosphorylation of the S6 kinase was rapid, occurring within 15 min of IFN
treatment and was still detectable after 120 min of incubation with IFN
(Fig. 3, A and
B). As expected, phosphorylation of p70 S6K was also
detectable in lysates from cells treated with insulin, used as positive
controls for these assays (Fig. 3,
AD). To examine whether the phosphorylation of p70
S6K also occurs in primary human cells, we determined whether IFN
is
capable of inducing phosphorylation of the protein in human granulocytes
isolated from the peripheral blood of healthy donors. Consistent with the data
observed in cell lines, IFN
treatment induced p70 S6K phosphorylation
in normal granulocytes (Fig. 3, E
and F), suggesting that this kinase is also activated in
primary human cells, and may participate in the induction of IFN responses
under physiological conditions.
As our data established that p38 is phosphorylated during engagement of the
Type I IFN receptor, we sought to identify the upstream signaling events that
ultimately lead to p70 S6K activation. In previous studies we have shown that
the serine and lipid kinase activities of the phosphatidylinositol
3'-kinase are activated in a Type I IFN-dependent manner, during the
interaction of the p85 regulatory subunit of this kinase with IRS proteins
(IRS-1 and IRS-2)
(4245).
Because the PI 3'-kinase pathway is a known regulator of activation of
the p70 S6K, we examined whether its activation is required for engagement of
the p70 S6 kinase in Type I interferon signaling. Cells were pretreated with
the PI 3'-kinase inhibitors LY294002 or wortmannin and were subsequently
incubated in the presence or absence of IFN
. Treatment of cells with
insulin was included as a positive control. As shown in
Fig. 4, inhibition of PI
3'-kinase activity, by either LY294002 or wortmannin, abrogated the
IFN
-dependent phosphorylation of p70 S6K
(Fig. 4, A and
B). Similarly, and as expected, the PI 3'-kinase
inhibitors also blocked the insulin-dependent phosphorylation of the protein
(Fig. 4, A and
B).
|
To definitively establish the requirement of PI3'-kinase in the Type
I IFN-dependent activation of p70 S6K, we undertook studies using embryonic
fibroblasts from mice with targeted disruption of the genes for both the
and
isoforms of the p85 regulatory subunit of the PI
3'-kinase. p85
/ p85
/ or control
p85
+/+ p85
+/+ MEFs were treated with mouse IFN
, and the
phosphorylation of p70 S6K was examined by anti-phospho-p70 S6K
immunoblotting. As shown in Fig.
5, IFN
treatment resulted in phosphorylation of p70 S6K on
threonine 421 and serine 424 in p85
+/+ p85
+/+ cells but not in
MEFs lacking expression of the p85 isoforms (p85
/
p85
/) (Fig. 5,
A and B). In a similar manner, when p85
+/ p85
/ cells were compared with
p85
/ p85
/ cells, phosphorylation of
p70 S6K was detectable in the cells expressing p85
but not in the cells
lacking both isoforms of the p85 regulatory subunit of the PI 3'-kinase
(Fig. 5, C and
D). Thus, activation of the PI 3'-kinase pathway is
essential for downstream engagement of the p70 S6K by Type I interferons, and
the presence of either the p85
or p85
isoform of the PI
3'-kinase may be sufficient to mediate such a response.
|
FRAP/mTOR Is Activated in a Type I IFN-dependent Manner to Regulate
Downstream p70 S6 Kinase ActivationThe FKB12-rapamycin associated
protein (FRAP), also called mammalian target of rapamycin (mTOR), has
previously been shown to regulate activation of the p70 S6 kinase, downstream
of the PI 3'-kinase and the PDK-1 kinase
(3641,
55). It is also well
established that activation of mTOR requires its phosphorylation on serine
2448. We investigated whether mTOR is engaged in Type I IFN signaling, to
regulate downstream activation of the p70 S6K. U-266 cells were treated with
IFN
, and, after cell lysis, total lysates were resolved by SDS-PAGE and
immunoblotted with an anti-phospho mTOR antibody. Some baseline
phosphorylation of mTOR was detectable prior to IFN treatment
(Fig. 6A). However,
type I IFN treatment of the cells resulted in phosphorylation/activation of
mTOR, demonstrating that this protein is indeed engaged in IFN-signaling
(Fig. 6A).
|
The demonstration that the p70 S6 kinase is phosphorylated by Type I IFNs
strongly suggested that such phosphorylation activates the kinase domain of
p70 S6K to regulate generation of IFN responses. We therefore sought to
directly determine whether Type I IFN-dependent treatment of cells results in
induction of p70 S6 kinase activity. U-266 cells were incubated in the
presence or absence of IFN
, and, after immunoprecipitation of cell
lysates with an anti-p70 S6K antibody, immunoprecipitates were subjected to an
in vitro kinase assay
(52). As shown in
Fig. 6B, Type I IFN
treatment resulted in an activation of the catalytic domain of the p70 S6
kinase (Fig. 6B). Such
activation was blocked by pretreatment of cells with the PI 3'-kinase
inhibitor LY294002, as well as by the FRAP/mTOR inhibitor rapamycin,
demonstrating that the IFN-dependent induction of p70 S6 kinase activity is
FRAP/mTOR-dependent (Fig.
6B). Consistent with this, the IFN-dependent
phosphorylation of p70 S6 kinase was also blocked when cells were pretreated
with rapamycin prior to IFN
stimulation
(Fig. 6, C and
D), confirming that p70 S6K is a downstream effector for
mTOR. The effects of rapamycin (Fig.
6C) on p70 S6K phosphorylation were apparently due to
suppression of the IFN-dependent phosphorylation and not the minimal baseline
phosphorylation of the protein, because they were accompanied by suppression
of the IFN-dependent kinase activity of the protein
(Fig. 6B).
Activation of the p70 S6 Kinase Downstream of mTOR Does Not Regulate
Type I IFN-dependent Gene TranscriptionOur data demonstrating
activation of p70 S6K downstream of FRAP/mTOR, indicated that this pathway
plays a role in mRNA translation, because it is well established that the
kinase activity of p70 S6K regulates phosphorylation of the 40 S ribosomal S6
protein. We also examined whether activation of FRAP/mTOR downstream of the PI
3'-kinase plays any role in the Type I IFN-inducible activation of the
STAT-pathway, which regulates transcriptional regulation of IFN-sensitive
genes. We initially performed gel mobility shift assays, using either ISRE or
a GAS (SIE) recognition element, to evaluate the effects of FRAP/mTOR
inhibition on the formation of STAT-containing DNA-binding complexes. Cells
were incubated with IFN
in the presence or absence of rapamycin, and
the formation of the active ISGF3 or SIF complexes in response to IFN
was determined. As expected, treatment of various cell lines with IFN
induced formation of ISGF3 complexes (STAT2·STAT1·IRF-9)
(Fig. 7A) or SIF
complexes (STAT3:3, STAT1:3, STAT1:1) (Fig.
7, BD). Rapamycin did not block the induction of
ISGF3 or SIF complexes (Fig. 7,
AD), indicating that the activation of the p70 S6
kinase does not exhibit regulatory effects upon STAT activation. In a similar
manner, treatment of cells with rapamycin had no effects on the
phosphorylation of STAT1 on serine 727
(Fig. 7, E and
F), which is required for full transcriptional activation
of STAT1
(1015).
|
It is now established that, in addition to the STAT pathway, activation of
the p38 MAPK pathway is essential for full transcriptional activation of
interferon-stimulated genes
(16,
18). Furthermore, it has been
demonstrated that the p38 MAPK pathway regulates Type I IFN-dependent gene
transcription without modifying phosphorylation or activation of STAT proteins
or their DNA binding activities in vitro
(16,
18). Our data demonstrated
that the function of the p70 S6 kinase is not required for STAT activation and
their DNA-binding activities but did not exclude the possibility that this
pathway may still be facilitating transcriptional regulation of IFN-sensitive
genes via effects on auxiliary pathways, including the p38 pathway. To address
this issue, experiments were performed in which the effects of rapamycin on
gene transcription via ISRE or GAS elements were examined. Cells were
transfected with ISRE or 8X-GAS luciferase constructs and treated with
IFN
, in the presence or absence of the FRAP/mTOR inhibitor rapamycin.
Luciferase activity was subsequently measured. As expected, IFN
induced
strong luciferase activity via either ISRE
(Fig. 8A) or GAS
elements (Fig. 8B),
but preincubation with rapamycin had no effect on the induction of such
luciferase activities. Thus, based on these findings, it is unlikely that
activation of p70 S6K downstream of PI 3'-K/FRAP/mTOR exerts any
regulatory effects on IFN-dependent gene transcription, and its primary role
in IFN signaling appears to be mediation of signals that regulate mRNA
translation.
|
Type I IFN-dependent Phosphorylation of the 4E-BP1 Repressor of mRNA
Translation and Its Dissociation from the Eukaryotic Initiation Factor-4E
(eIF4E) ComplexIt has previously been shown that, in response to
insulin, the 4E-BP1 repressor of mRNA translation is phosphorylated downstream
of the PI 3'-kinase pathway and that this phosphorylation inhibits its
interaction with the initiation factor eIF4E
(46). We sought to determine
whether IFN
treatment also results in phosphorylation of 4E-BP1. U-266
cells were treated with IFN
, and after cell lysis, total lysates were
analyzed by SDS-PAGE and immunoblotted with an anti-4E-BP1 antibody
(46,
54). IFN
treatment
resulted in a mobility shift of the 4E-BP1 protein and detection of a slowly
migrating form (Fig.
9A), which corresponds to the hyperphosphorylated form of
the protein (46,
54). To determine whether such
phosphorylation of 4E-BP1 requires upstream activation of the PI
3'-kinase and FRAP/mTOR activity, we examined the effects of LY294002
and rapamycin on such phosphorylation. Cells were preincubated with the
different pharmacological inhibitors and subsequently treated with IFN
.
The phosphorylation of 4E-BP1 was subsequently analyzed by determination of
the mobility shift of the protein. As shown in
Fig. 9B, treatment
with LY294002 or rapamycin abrogated the IFN
-inducible
hyperphosphorylated form of 4E-BP1 (Fig.
8B), indicating that this event occurs downstream of PI
3'-kinase/FRAP/mTOR activation. On the other hand, the SB203580
inhibitor, which selectively blocks activation of the p38 MAPK
(1618),
had no effects on 4E-BP1 phosphorylation
(Fig. 9B). To further
confirm the phosphorylation of 4E-BP1 in response to Type I IFNs, experiments
were performed in which the phosphorylation of the 4E-BP1 protein was detected
by using an anti-phospho 4E-BP1 antibody that recognizes the protein only when
it is phosphorylated on threonine 70. Using this approach, strong
IFN
-dependent phosphorylation of 4E-BP1 was detectable in U-266 cells
(Fig. 10, A and
B) as well as COS cells
(Fig. 10, C and
D), whereas this phosphorylation was inhibited by
pretreatment of cells with rapamycin or LY294002
(Fig. 10, A and
B).
|
|
Recent studies have shown that, in addition to phosphorylation on Thr-70,
phosphorylation of additional sites, most likely the priming sites Thr-37 and
Thr-46, is essential for the release of 4E-BP1 from eIF4E
(60). We examined whether Type
I IFN treatment induces phosphorylation of these sites, whose function is
critical for optimal phosphorylation of 4E-BP1. Cells were incubated in the
presence or absence of IFN
, and total cell lysates were analyzed by
SDS-PAGE and immunoblotted with an anti-phospho 4E-BP-1 antibody, which
recognizes the protein only when is phosphorylated on both Thr-37 and Thr-46.
As shown in Fig. 11, treatment
of cells with IFN
resulted in strong phosphorylation of 4E-BP1 on Thr-37
and Thr-46 (Fig. 11, A and
B). To directly examine whether the IFN-dependent
phosphorylation of 4E-BP1 regulates its activity, we examined the effects of
Type I IFN treatment on the interaction of 4E-BP1 with eIF4E, using
cap-affinity chromatography. Cells were incubated in the presence or absence
of IFN
, and cell extracts were subjected to cap-affinity isolation of
eIF4E. After Type I IFN treatment, the binding of 4E-BP1 to eIF4E was
dramatically decreased (Fig.
11D), whereas there was no change in the total amount of
4E-BP1 (Fig. 11C),
indicating that 4E-BP1 dissociates from eIF4E, in an interferon-dependent
manner. Taken altogether, these studies indicate that, in addition to the
activation of the p70 S6 kinase, Type I IFN-dependent activation of PI
3-kinase and FRAP/mTOR regulates phosphorylation of 4E-BP1 and its
dissociation from eIF4E, providing an additional mechanism by which this
pathway regulates mRNA translation in response to Type I IFNs.
|
| DISCUSSION |
|---|
|
|
|---|
or IFN
to the Type I IFN receptor result in the production
of proteins that exhibit antiviral and/or antiproliferative properties
(17).
The transcription of genes encoding for such proteins is regulated by
activation of Type I IFN-dependent Jak-STAT pathways
(14).
Such transcription appears to be facilitated by other auxiliary, non-STAT
pathways, such as the Type I IFN-activated p38 MAPK pathway
(1621). In addition to the Jak-STAT and p38 MAPK signaling cascades, Type I interferons engage insulin receptor substrate (IRS) proteins, to regulate activation of the PI 3'-kinase (4245, 58). This pathway is activated by all Type I IFNs (42) downstream of Jak kinases (43, 58), and there is evidence that it mediates classic IFN responses, including protection from viral infection (59). However, the precise mechanisms that ultimately lead to the generation of IFN biological effects through this signaling cascade are not known. It is well established that interferons regulate gene transcription and mRNA translation for target genes in a variety of malignant and non-malignant cells, resulting in the production of various protein products, among which proteins that suppress neoplastic cell proliferation, such as the pml gene product (6063). On the other hand, it is well established that one mechanism by which interferons mediate antiviral responses is suppression of viral replication for different viruses, via regulation of viral RNA translation (6469). In the present study we provide evidence that activation of the PI 3'-kinase by Type I IFNs ultimately leads to activation of the p70 S6 kinase, phosphorylation of the 4E-B1 repressor of mRNA translation, and its dissociation from the eIF4E. These data provide the first direct evidence linking an interferon-signaling pathway to events that positively regulate protein translation and address a long outstanding question in the interferon signaling field: the identification of Type I IFN signaling cascades ultimately responsible for generation of protein products that mediate the biological effects of Type I IFNs.
Several different cascades have been previously shown to be activated downstream of the phosphatidylinositol 3'-kinase in eukaryotic cells. It is now well established that signaling proteins with pleckstrin homology domains bind directly to phosphatidylinositol 3,4,5-triphosphate, which results from conversion of the plasma membrane phosphatidylinositol 4,5-biphosphate by the activated PI 3'-kinase (reviewed in Ref. 69). These include the kinase PDK1 and the Akt kinase (69), which activate diverse downstream signaling cascades. PDK1 phosphorylates and activates the Akt kinase (reviewed in Ref. 75), which in turn activates several downstream effectors, including the mammalian target of rapamycin FRAP/mTOR (70, 76, 77), which subsequently mediates phosphorylation of p70 S6K (3641) and 4E-BP1 (7174). Thus, FRAP/mTOR is required for the phosphorylation/activation of the p70 S6 kinase and phosphorylation/inactivation of 4E-BP1, events essential for the initiation of protein translation. Other pathways activated downstream of Akt include forkhead-related transcription factor 1, the inducer of apoptosis Bad, and the glycogen synthase kinase 3 (70, 76, 77).
The PI 3'-kinase-dependent pathways are traditionally believed to be
pathways that mediate events essential for cell growth and anti-apoptotic
effects. In fact, most studies have focused on the roles of these proteins in
growth factor signaling or in the context of malignant transformation by
oncogenes. Our finding, that Type I IFNs also activate the S6 kinase and
phosphorylate 4E-BP1, in a FRAP/mTOR-dependent manner, implicates these
proteins in the generation of antiproliferative and/or antiviral responses.
Thus, it is likely that, as in the case of other pathways (Jak-STAT and MAPK
cascades), the PI 3'-kinase/FRAP/mTOR pathway is capable of mediating
either cell-proliferative or growth inhibitory responses, depending on the
stimulus and the cellular context. This is not surprising, because it is well
established that Type IFNs regulate transcription of genes, whose protein
products suppress cell growth and mediate antiviral responses. Interestingly,
a previous study (78) had
demonstrated that PI 3'-kinase and mTOR mediate
lipopolysaccharide-stimulated nitric oxide (NO) production in macrophages via
secretion of IFN
, which functions as an autocrine cofactor for NO
production (78). It is of
interest that, in that study, addition of exogenous of IFN
, in the
presence of PI 3-kinase and mTOR inhibitors, did not restore NO production
(78). Taken together with our
data, these findings suggest that this pathway is part of an autocrine loop
that regulates production of Type I IFNs and, most importantly, mediates Type
I IFN signals. Such downstream signals appear to be activation of the p70 S6K
and de-activation of 4E-BP1, which in the context of interferon-induced
transcription, facilitate protein translation of mRNA for IFN-sensitive genes
and, therefore, induction of IFN-dependent biological effects.
It remains to be determined whether other signaling elements and pathways, beyond the IRS-PI 3'-kinase pathway, facilitate activation of p70 S6K and phosphorylation of 4E-BP1. It is well established that several sites of phosphorylation exist in 4E-BP1, and that the phosphorylation of the protein occurs via a two-step mechanism (79). Recently, it was shown that Erk kinases can phosphorylate 4E-BP1 in response to stress (80), whereas the downstream effector of the p38 MAPK, Msk1, phosphorylates 4E-BP1 in response to ultraviolet irradiation (81). Previous studies have also demonstrated that Type I IFNs activate Erk kinases (82) and that such activation is PI 3'-kinase-dependent (45). Similarly, the p38 MAPK pathway is activated by Type I IFNs (1618), and in recent studies we have observed that Msk1 is phosphorylated/activated in a Type I IFN-dependent manner.3 Most importantly, activation of the p38 MAPK pathway is essential for the generation of Type I IFN-dependent antiproliferative and/or antiviral responses in a variety of different cell types (19, 20). Thus, it is possible that these kinases are also required for phosphorylation/inactivation of 4E-BP1 and initiation of Type I IFN-dependent mRNA translation, but this remains to be examined in future studies.
Independently of the precise mechanisms involved, our data for the first
time establish that the PI 3'-kinase pathway and cascades downstream of
FRAP/mTOR participate in Type I IFN signaling, to generate IFN-dependent
translational responses. These findings may have important clinical
implications, because there are ongoing efforts toward the clinical
development of rapamycin and the related analog CCI-779 for the treatment of
certain malignancies (56,
57). Such efforts are
conceptually based on the documented ability of these compounds to inhibit
growth factor-dependent malignant cell growth. IFN
is an antitumor
agent widely used in clinical oncology and clinical virology. Therefore, our
data indicate that caution should be taken in designing clinical trials
combining these agents with IFN
, because it is possible that they may
ameliorate its antitumor properties in vivo.
| FOOTNOTES |
|---|
b Both authors contributed equally to this work and are first co-authors. ![]()
f Recipient of a fellowship from Boehringer Ingelheim Funds. ![]()
j To whom correspondence should be addressed: Robert H. Lurie Comprehensive Cancer Center, Northwestern University Medical School, 710 North Fairbanks St., Olson 8250, Chicago, IL 60611. Tel.: 312-503-4267; Fax: 312-908-1372; E-mail: l-platanias{at}northwestern.edu.
1 The abbreviations used are: IFN, interferon; STAT, signal transducer and
activator of transcription; PI, phosphatidylinositol; ISRE,
interferon-stimulated response element; SIE, sis-inducible element;
GAS, IFN
-activated site; p70 S6K, p70 S6 kinase; FRAP, FKBP12
rapamycin-associated protein; mTOR, mammalian target of rapamycin; eIF4E,
eukaryotic initiation factor-4E; 4E-BP1, 4E-binding protein 1; MAPK,
mitogen-activated protein kinase; IRS, insulin receptor substrate; MEF, mouse
embryonic fibroblast; RIgG, rabbit immunoglobulin; SIF, sis-inducible
factor. ![]()
2 S. Brachmann and L. C. Cantley, manuscript in preparation. ![]()
3 Y. Li and L. C. Platanias, manuscript in preparation. ![]()
| REFERENCES |
|---|
|
|
|---|