![]()
|
|
||||||||
J. Biol. Chem., Vol. 278, Issue 30, 27789-27795, July 25, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||






¶
From the
The Aging and Apoptosis Research Center,
Department of Biochemistry and Molecular Biology, Seoul National University
College of Medicine, Seoul 110-799, Korea and
Department of Biochemistry, College of Medicine,
Dankook University, Cheonan, Korea
Received for publication, August 8, 2002 , and in revised form, April 17, 2003.
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Caveolin, a 2124-kDa integral membrane protein, is the principal component of caveolae, and the caveolin gene family consists of caveolin-1, -2, and -3. Caveolin-1 and -2 are co-expressed, form a hetero-oligomer in the plasma membrane, and exist in many cell types (57), whereas the expression of caveolin-3 is muscle-specific (8). Moreover, recent studies have suggested a regulatory role for caveolin in addition to its structural function. For example, the stable expressions of the caveolin-1 or -3 genes in caveolin-deficient mammalian cells induced the formation of caveolae structures (9).
The caveolin functions as scaffolding protein within the caveolae membrane and interacts with signaling proteins such as EGFR,1 G-proteins, Src-like kinases, Ha-Ras, protein kinase C, endothelial nitric-oxide synthase, and integrin (1015). In addition, a short cytosolic N-terminal region of caveolin is involved in the formation of oligomers and mediates the interaction with signaling molecules, which result in the their inactivation (4). The targeted down-regulation of caveolin-1 is sufficient to drive cell transformation and hyperactivates the Erk kinase cascade (16). And caveolin levels in most tumor tissues are significantly lower than in normal tissues, suggesting the circumvention of signal suppression by caveolin. Moreover, the co-expression of EGFR, Raf, MEK-1, or Erk-2 with caveolin-1 dramatically inhibits signaling from the cytoplasm to the nucleus in vivo (3).
Many cell types, such as human diploid fibroblast, show cellular senescence
in vitro. Senescent cells enter into irreversible growth arrest when
they contain increased levels of cell cycle inhibitory molecules
(1719),
and in this state, the cells have a large and flat morphology and show
senescence-associated
-galactosidase activity
(21). Senescent human diploid
fibroblast (HDF) cells do not show mitogen-activated protein kinase activation
upon EGF stimulation
(2022).
Moreover, accumulated cytosolic p-Erk-1/2 failed to translocate to the nuclei
upon EGF stimulation
(2325).
In consequence, senescent cells show lower levels of p-Erk in the nucleus,
despite its high level in the cytosol, and lack transcription factor (Elk-1)
activation (9).
Previously, we reported that the hyporesponsiveness of senescent fibroblasts to EGF stimulation might be related to the up-regulation of caveolins with aging and that the overexpression of caveolin-1 in young HDF cells could down-regulate EGF signaling (21). However, it is not known whether the reduced caveolin-1 in senescent cells might restore the signaling cascades and cellular cycling in response to growth factors. Therefore, in this study, we attempted to test the possibility of recovery of growth factor responsiveness by reducing the level of caveolin-1 in senescent HDFs by use of antisense oligonucleotide and small interfering RNA (siRNA).
| EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
Cell CultureHuman diploid fibroblasts were kept in 10-cm
plates in Dulbecco's modified Eagle's medium supplemented with 10% fetal
bovine serum and antibiotics and subculture at a ratio of 1:4. We defined
young cells as those resulting from <25 population doublings, and old cells
were from >60 population doublings. Cellular senescence of all of the old
cells was confirmed by their delayed population doubling times and by a
senescence-associated
-galactosidase activity assay as described by
Dimri et al. (26).
After being grown in a semi-confluent state, senescence-associated
-galactosidase, pH 6.0, activity was examined. Cells were washed with
phosphate-buffered saline and fixed with 2% paraformaldehyde containing 0.2%
glutaraldehyde in phosphate-buffered saline for 5 min at room temperature.
After washing with phosphate-buffered saline, cells were incubated with
-galactosidase reagent (1 mg/ml
5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside (X-gal), 40
mM citric acid/sodium phosphate buffer, pH 6.0, 5 mM
potassium ferrocyanide/potassium ferricyanide, 150 mM NaCl, 2
mM MgCl2) at 37 °C.
Down-regulation of Caveolin-1 by Antisense Oligonucleotide and siRNAHDF cells were seeded at a density of 1 x 106 cells/100-mm dish. Twenty-four hours later, 100 nM each of antisense caveolin-1 oligonucleotide (TTTGCCCCCAGACAT, complementary to the 15-base initiation sequence of human caveolin-1) was transfected into HDF cells using LipofectAMINE PLUS (Invitrogen). Three hours later, the medium was discarded and replaced with complete Dulbecco's modified Eagle's medium. A sense caveolin-1 oligonucleotide (ATGTCTGGGGGCAAA) corresponding to 15-bases of the initiation sequence of caveolin-1 was used as a control (27). For monitoring purposes, we conjugated fluorescein isothiocyanate in the N-terminal of oligonucleotides.
Double-stranded siRNA molecules were designed to target the human caveolin-1 mRNA. 21-nucleotide siRNAs were obtained from Dharmacon Research (Lafayette, CO) as duplexed 2'-unprotected, desalted, and purified siRNA. We targeted 5 regions of caveolin-1 mRNA. The target sequence of C1 is AACACCTCAACGATGACGTGG; that of C2 is AACCAGAAGGGACACACAGTT; that of C3 is AATACTGGTTTTACCGCTTGC; that of C4 is AACAGGGCAACATCTACAAGC; and that of C5 is AACAUCUACAAGCCCAACAAC. A GL2 luciferase oligonucleotide was used as a negative control. Senescent HDF cells were grown to 40% confluence in 10-cm dishes and transfected with annealed siRNA using OligofectAMINE (Invitrogen) for 6 h as recommended by the manufacturer. Dulbecco's modified Eagle's medium containing 30% fetal bovine serum and 3% penicillin-streptomycin was added to each dish to a final concentration of 10% fetal bovine serum and 1% penicillin-streptomycin. Cells were harvested 48 h later for further assays.
Western Blot and Erk Activation AnalysisWhole cell extracts were separated using SDS-polyacrylamide gel electrophoresis and transferred onto nitrocellulose filters (Protran, Schleicher & Schuell) using standard techniques. The following antibodies were used: mouse monoclonal anti-caveolin-1 (Transduction Laboratories), mouse monoclonal anti-p-Erk (Santa Cruz Biotechnology), rabbit polyclonal anti-Erk (Santa Cruz Biotechnology), rabbit polyclonal anti-p-Elk (Cell Signaling Technology), rabbit polyclonal anti-Elk (Cell Signaling Technology), rabbit polyclonal anti-EGFR (Santa Cruz Biotechnology), goat polyclonal anti-actin (Santa Cruz Biotechnology), mouse monoclonal anti-p53 (Santa Cruz Biotechnology), and mouse monoclonal anti-p21 (Oncogene). The immune complexes were incubated with a peroxidase-conjugated anti-mouse or anti-rabbit secondary antibody and finally visualized using an enhanced chemiluminescence detection kit (ECL kit, Amersham Biotechnology).
Electron Microscopic AnalysisSense and antisense oligonucleotide-treated senescent HDFs were pelleted and fixed with 3% glutaraldehyde/phosphate-buffered saline at pH 7.4. After washing with 0.2 M sodium cacodylate buffer, pH 7.4, the cell pellets were treated with 1% osmium tetroxide in cacodylate buffer for 1 h. Cells were then dehydrated in graded ethanol through propylene oxide and embedded in epoxy resin (Polyscience Co.). Ultrathin sections were cut and stained with uranyl acetate and lead citrate. Sections were observed using a transmission electron microscope (H-600, Hitachi).
Subcellular FractionationTo prepare nuclear and cytoplasmic extracts, 12 x 108 cells were harvested by trypsin, washed three times with calcium-deficient phosphate-buffered saline, and resuspended to 2.5 x 108 cells/ml in a buffer containing 10 mM Tris, pH 7.4, 2 mM MgCl2, 1 mM phenylmethylsulfonyl fluoride, and protease inhibitors. Resuspended cells were incubated at room temperature for 1 min and then transferred into a tube in ice for 5 min with Triton X-100 added to a final concentration of 0.5% and incubated on ice for 5 min. Cell lysates were separated by several passages through a 260-gauge needle and examined under a phase-contrast microscope. The nuclei were isolated from the cytosol by centrifugation at 300 x g at 4 °C for 10 min in a Sorvall RC-5B centrifuge using a SS-34 rotor. Isolated nuclei were washed with 10 ml of buffer and resuspended in a nuclear extraction buffer containing 20 mM of Hepes, pH 7.9, 0.42 M NaCl, 1.5 mM MgCl2, 25% (v/v) glycerol, 0.2 mM EDTA, 0.5 mM dithiothreitol, and protease inhibitors. Resuspended nuclei were incubated on ice for 30 min with occasional shaking to extract the nuclear proteins and finally were spun down in a microcentrifuge for 5 min.
Immunocytochemistry and QuantificationEach of the transfected senescent HDFs was cultured on coverslips in 24-well plates and treated with EGF and BrdUrd for 24 h. Cultures were processed for immunocytochemistry as described previously (23). The following antibodies were used: BrdUrd (1:100, mouse; Roche Applied Science), p-Elk (1:200, rabbit; Cell Signaling Technology, Inc), caveolin-1 (1:500, rabbit; Transduction Laboratories), phalloidin (1:1000; Molecular Probes), and DAPI (1:1000; Sigma). Detection was performed using a Bio-Rad confocal system at a magnification of x40 with individual filter sets for each channel, and images were assembled using Adobe PhotoShop.
Fluorescent-labeled cells were visualized by confocal microscopy. Positive cells were quantified in at least 10 fields systematically across the coverslips from three independent experiments conducted in parallel. Statistical analysis was performed using Microsoft Excel.
| RESULTS |
|---|
|
|
|---|
To modulate the intracellular caveolin level of senescent cells, an antisense oligonucleotide (AS-ON) complementary to the 15-base initiation sequence of human caveolin-1 was prepared, whereas a sense oligonucleotide (S-ON) corresponding to the 15 bases of the initiation sequence was used as a control (27). To monitor oligonucleotides efficiency, we used conjugated fluorescent oligonucleotides.
We found that the expression of caveolin-1 was abnormally high (Fig. 1A) and that was primarily localized to the membrane domain of senescent HDF cells. To identify the effect of antisense oligonucleotide, we examined the dose responsiveness by immunocytochemistry and Western blotting (Fig. 1B). Sense and antisense oligonucleotides could effectively penetrate senescent HDF cells in the presence of LipofectAMINE reagent (Fig 1B). Interestingly, the antisense oligonucleotide of caveolin-1 was localized to the nucleus and could inhibit caveolin-1 expression level in senescent HDFs, whereas the sense oligonucleotide was localized mainly to the cytosol and had no effect. The expression of caveolin-1 was dose-dependently reduced by antisense oligonucleotide in senescent cells (Fig 1B). Therefore, the expressions of caveolin-1 were found to significantly decrease by AS-ON in senescent HDFs.
|
Caveolin-1, a key constituent of caveolae structures, forms caveolae structures in senescent HDFs. Electron microscopic experiments upon the plasmalemmal profiles of senescent (S-ON-transfected cells) HDFs revealed the presence of numerous non-clathrin-coated vesicular structures 50 100 nm in diameter that were juxtaposed to the plasma membrane and morphologically indistinguishable from caveolae (Fig. 2A). In contrast, profiles of AS-ON-transfected cells contained significantly fewer caveolae-like structures. Quantitative analysis of multiple plasmalemmal profile revealed that AS-ON-treated senescent HDF cells contained over five times less caveolae-like structure than S-ON-treated senescent HDF cells (Fig. 2B). From these results, the antisense oligonucleotide to caveolin-1 was found to be active not only in terms of caveolin reduction but also in terms of the inhibition of caveolae structures in senescent HDFs.
|
To confirm the specificity of AS-ON effect, we designed five siRNA for caveolin-1 and tested their efficiency. As shown in Fig. 4A, C2 and C5 of siRNA for caveolin-1 significantly reduced the level of caveolin-1 in senescent HDFs compared with the control. For further experiment, we used C2 siRNA and we observed that siRNA effect could maintain until 72 h (Fig. 4B).
|
Recovery of Downstream Signal Transduction Cascade in Senescent HDF CellsDespite the elevated p-Erk level in cytosol, the translocation of p-Erk and the phosphorylation of Elk failed upon EGF stimulation in senescent HDFs (24, 25). However, the expression levels of EGFR and Erk were not significantly different in young and senescent HDFs (Fig. 3A). Despite the high basal level of p-Erk, no mitogenic response was observed upon EGF stimulation in senescent HDFs (Fig. 3B). As a consequence of adjusting the caveolin-1 levels in senescent cells, basal p-Erk was decreased by AS-ON treatment but not by S-ON treatment (Fig. 3C). We further tested the functional recovery of the Erk system in response to EGF stimulation by modulating the caveolin-1 level in senescent HDFs. No significant changes in the level of Erk phosphorylation by EGF stimulation in S-ON-treated senescent HDFs were observed, whereas Erk activation significantly resumed in AS-ON-treated senescent HDFs, and this was similar to that observed in young cells (Fig. 3D). To confirm this recovery of Erk activation by down-regulation of caveolin-1 using AS-ON, we used siRNA for this experiment. No significant changes in the level of Erk phosphorylation by EGF stimulation in control-transfected senescent HDFs were observed, whereas Erk activation was resumed in C2-transfected senescent HDFs (Fig. 4C). Therefore, these data show that the recovery of EGF signaling in senescent HDF cells was due to reduction of the caveolin-1 expression level by siRNA as well as antisense oligonucleotide.
|
Activated Erk translocates into the nucleus and subsequently activates several target transcriptional factors, including members of the transcription factor family (2528). It is known that the abundance of serine-phosphorylated Elk is reduced in senescent cells (25). Therefore, in our experiment, we checked the mode of Elk activation in response to EGF in caveolin-reduced senescent HDF cells and determined the basal levels of p-Erk and p-Elk by subcellular fractionation in young and senescent HDFs. Despite the high level of p-Erk, Elk was very weakly phosphorylated in nuclei, suggesting that it would be inactive in senescent cells (Fig. 5A). To confirm this result, we determined the phosphorylation status of Erk and Elk in young and senescent HDFs and found that EGF stimulation strongly phosphorylated Elk within 30 min in young HDFs but weakly in senescent HDFs (Fig. 5B). We also examined Elk phosphorylation in senescent HDFs upon EGF simulation after S-ON or AS-ON treatment (Fig. 6A). Interestingly, the treatment of senescent HDFs with AS-ON restored EGF-induced Elk phosphorylation, although partially and slowly, it reached maximum activity only after 60 min. Moreover, immunocytochemical analysis showed that Elk was phosphorylated only in young and AS-ON-treated senescent HDFs and very weakly in senescent and S-ON-treated cells (Fig. 6B).
|
|
Modulation of Cell Cycle Regulatory SystemThe restoration of EGF-induced signal transduction by adjusting caveolin status in senescent cells led us to question the impact of recovery on cell cycle, because replicative senescence implied irreversible growth arrest despite growth factor stimuli. Therefore, we examined the cell cycle-associated molecules. Certain members of the cyclin-dependent kinase (CDK)/cyclin family, which are responsible for cell cycle progress, are expressed but are inactive in the senescent state (29). This lack of CDK activity and arrest in the G1 phase of the cell cycle is attributed to the induction of the G1-S CDK/cyclin inhibitors p21 (WAF1) (30) and p16 (INK4a) (31, 3335). Therefore, we determined the levels of p53 and p21 in AS-ON- and S-ON-treated senescent HDFs and found that the levels of p53 and p21 are significantly attenuated in AS-ON-treated senescent HDFs (Fig. 7A). To monitor the G1-S transition, we examined changes in the BrdUrd incorporation rate in response to EGF stimulation. Since the BrdUrd index is a measure of the DNA synthesis rate, it can be used to monitor S phase activity. As a results, almost 60% AS-ON-transfected senescent HDFs showed DNA synthesis in contrast to the negligible activity shown by S-ON-transfected HDFs as monitored using anti-BrdUrd antibody (Fig. 7, B and C).
|
| DISCUSSION |
|---|
|
|
|---|
In this study, we set out to show that the down-regulation of caveolin-1 expression could recover the attenuated Erk signaling and the consequent cell cycling of senescent HDFs. Accordingly, we reduced the expression of caveolin-1 (Fig. 1) and the formation of caveolae structures (Fig. 2) successfully using the antisense oligonucleotide of caveolin-1 in senescent HDFs. We found that the down-regulation of caveolin-1 in senescent HDFs could recover the signaling from EGF to Erk-1/2 in the cytosol with respect to Erk phosphorylation to a considerable degree (Fig. 3D).
Over the last few years, RNA interference has been recognized as a major mechanism of posttranscriptional gene silencing in various systems (43, 44). To verify the effect of AS-ON, we used siRNA of 21 nucleotides for down-regulation of caveolin-1 in senescent HDFs. As seen in Fig. 4, the effect of recovery of Erk activation by siRNA of caveolin-1 was correlated well with the effect of AS-ON. Our results suggest that the down-regulation of caveolin-1 by AS-ON as well as siRNA can lead to the recovery of signaling in senescent HDFs.
Senescent HDF cells and Ha-Ras mutant-expressed HDFs did not respond to EGF stimulation in the MAPK activation system (20, 22), and the accumulated cytosolic p-Erk-1/2 failed to translocate to nuclei on EGF stimulation (23, 24). Our data also confirmed that the translocation of p-Erk was diminished in senescent HDFs, regardless of the elevated level of p-Erk in the cytosol (Fig. 5A). Interestingly, we found that the down-regulation of caveolin-1 by antisense oligonucleotide and siRNA treatment reduced the basal p-Erk level (Figs. 3C and 4C) and resumed Erk activation upon EGF stimulation (Figs. 3D and 4C), which resulted in Elk phosphorylation in senescent HDFs (Fig. 6). These results suggest that a simple reduction of the caveolin level in senescent HDF cells can induce the restoration of the Erk signaling system upon EGF stimulation, not only in terms of its phosphorylation but also its translocation into and activation of transcriptional factors in the nuclei.
Recently, it was reported that caveolin-1-mediated cell cycle arrest occurs
through a p53/p21-dependent pathway
(35). p53 is directly involved
in G1 phase arrest through the induction of p21
(42). p21 mediates
p53-dependent G1 arrest by inhibiting the activity of CDKs, which
phosphorylate the retinoblastoma gene product as well as other substrates. p21
also induces growth arrest by preventing proliferating cell nuclear antigen
from activating DNA polymerase
, which is essential for DNA replication
(45). Moreover, p21-deficient
fibroblasts show impairment of G1 arrest
(46), confirming a key role
for p21 in cell cycle arrest. Our experiment showed that the down-regulation
of caveolin-1 in senescent HDF also reduced the level of the cell cycle
inhibitors p53 and p21 (Fig.
7A). The reduction of p53 and p21 by antisense
oligonucleotide to caveolin-1 gene in senescent HDF cells indicated the strong
possibility of deregulation of the senescence-associated cell cycle
inhibition. Therefore, the cell cycle reentry of the senescent cells was
examined by monitoring BrdUrd incorporation in response to EGF stimuli after
reduction of caveolin status. Because BrdUrd index is the measure of DNA
synthesis rate, it indicates the S phase activity. Actually, in our
experiment, almost 60% antisense-oligonucleotide-treated senescent HDF cells
showed the BrdUrd incorporation in contrast to the negligible activity in the
control senescent HDF cells (Fig. 7,
B and C). These data strongly suggest that the
cell cycle reentry into S phase can be induced by the reduction of caveolin
status in the senescent cells.
These results indicate that a simple adjustment of the caveolin level in senescent cells can profoundly influence the aging phenotype. Moreover, evidence of the role of caveolin in cancer cells have been well documented (47), wherein caveolin was suggested to be a tumor suppressor gene. Therefore, it is apparent that caveolin plays an important role in the regulation of both aging and cancer.
Taken together, we suggest that the growth factor responsiveness of senescent cells can be resumed to a considerable degree by reducing caveolin levels. Therefore, we cannot exclude the possibility that the accepted nature of the senescent phenotype, i.e. irreversible growth arrest and irresponsiveness to growth factors, may be at the point of redefinition. These results imply that the functional recovery of senescent cells can be probably achieved, which may extendable to the functional restoration of aged organisms.
| FOOTNOTES |
|---|
¶ To whom correspondence should be addressed. Tel.: 82-2-740-8244; Fax: 82-2-744-4534; E-mail: scpark{at}snu.ac.kr.
1 The abbreviations used are: EGFR, epidermal growth factor receptor; MEK,
mitogen-activated protein kinase/extracellular signal-regulated kinase kinase;
HDF, human diploid fibroblast; Erk, extracellular signal-regulated kinase;
siRNA, small interfering RNA; BrdUrd, bromodeoxyuridine; AS-ON, antisense
oligonucleotide; S-ON, sense oligonucleotide; CDK, cyclin-dependent kinase;
EGF, epidermal growth factor; DAPI, 4,6-diamidino-2-phenylindole. ![]()
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
A. Nishiyama, T. Shinohara, T. Pantuso, S. Tsuji, M. Yamashita, S. Shinohara, Q. N. Myrvik, R. A. Henriksen, and Y. Shibata Depletion of cellular cholesterol enhances macrophage MAPK activation by chitin microparticles but not by heat-killed Mycobacterium bovis BCG Am J Physiol Cell Physiol, August 1, 2008; 295(2): C341 - C349. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-q. Wang, Q. Yan, P. Sun, J.-W. Liu, L. Go, S. M. McDaniel, and A. S. Paller Suppression of Epidermal Growth Factor Receptor Signaling by Protein Kinase C-{alpha} Activation Requires CD82, Caveolin-1, and Ganglioside Cancer Res., October 15, 2007; 67(20): 9986 - 9995. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Costa, M. Senou, F. Van Rode, J. Ruf, M. Capello, D. Dequanter, P. Lothaire, C. Dessy, J. E. Dumont, M.-C. Many, et al. Reciprocal Negative Regulation between Thyrotropin/3',5'-Cyclic Adenosine Monophosphate-Mediated Proliferation and Caveolin-1 Expression in Human and Murine Thyrocytes Mol. Endocrinol., April 1, 2007; 21(4): 921 - 932. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. M. Wang, Y. Zhang, H. P. Kim, Z. Zhou, C. A. Feghali-Bostwick, F. Liu, E. Ifedigbo, X. Xu, T. D. Oury, N. Kaminski, et al. Caveolin-1: a critical regulator of lung fibrosis in idiopathic pulmonary fibrosis J. Exp. Med., December 25, 2006; 203(13): 2895 - 2906. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Chen and M. S. Goligorsky Premature senescence of endothelial cells: Methusaleh's dilemma Am J Physiol Heart Circ Physiol, May 1, 2006; 290(5): H1729 - H1739. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Cavallo-Medved, J. Mai, J. Dosescu, M. Sameni, and B. F. Sloane Caveolin-1 mediates the expression and localization of cathepsin B, pro-urokinase plasminogen activator and their cell-surface receptors in human colorectal carcinoma cells J. Cell Sci., April 1, 2005; 118(7): 1493 - 1503. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kyoung Kim, Y. Kyoung Kim, I.-H. Song, S.-H. Baek, S.-R. Lee, J. Hye Kim, and J.-R. Kim Down-Regulation of a Forkhead Transcription Factor, FOXO3a, Accelerates Cellular Senescence in Human Dermal Fibroblasts J. Gerontol. A Biol. Sci. Med. Sci., January 1, 2005; 60(1): 4 - 9. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A Cho, S. J. Ryu, Y. S. Oh, J. H. Park, J. W. Lee, H.-P. Kim, K. T. Kim, I. S. Jang, and S. C. Park Morphological Adjustment of Senescent Cells by Modulating Caveolin-1 Status J. Biol. Chem., October 1, 2004; 279(40): 42270 - 42278. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. H. Kwak, H. S. Kim, O. R. Choi, M. S. Ryu, and I. K. Lim Nuclear Accumulation of Globular Actin as a Cellular Senescence Marker Cancer Res., January 15, 2004; 64(2): 572 - 580. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||