Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M303316200 on May 6, 2003

J. Biol. Chem., Vol. 278, Issue 30, 27804-27810, July 25, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/30/27804    most recent
M303316200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Seshadri, V.
Right arrow Articles by Adam, R. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Seshadri, V.
Right arrow Articles by Adam, R. D.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Giardia lamblia RNA Polymerase II

AMANITIN-RESISTANT TRANSCRIPTION*

Vishwas Seshadri {ddagger}, Andrew G. McArthur §, Mitchell L. Sogin § and Rodney D. Adam § ¶ ||

From the {ddagger}Departments of Microbiology and Immunology and Medicine, University of Arizona College of Medicine, Tucson, Arizona 85724-5049 and §Josephine Bay Paul Center for Comparative Molecular Biology and Evolution, Marine Biological Laboratory, Woods Hole, Massachusetts 02543-1015

Received for publication, March 31, 2003 , and in revised form, May 3, 2003.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Giardia lamblia is an early branching eukaryote, and although distinctly eukaryotic in its cell and molecular biology, transcription and translation in G. lamblia demonstrate important differences from these processes in higher eukaryotes. The cyclic octapeptide amanitin is a relatively selective inhibitor of eukaryotic RNA polymerase II (RNAP II) and is commonly used to study RNAP II transcription. Therefore, we measured the sensitivity of G. lamblia RNAP II transcription to {alpha}-amanitin and found that unlike most other eukaryotes, RNAP II transcription in Giardia is resistant to 1 mg/ml amanitin. In contrast, 50 µg/ml amanitin inhibits 85% of RNAP III transcription activity using leucyl-tRNA as a template. To better understand transcription in G. lamblia, we identified 10 of the 12 known eukaryotic rpb subunits, including all 10 subunits that are required for viability in Saccharomyces cerevisiae. The amanitin motif (amanitin binding site) of Rpb1 from G. lamblia has amino acid substitutions at six highly conserved sites that have been associated with amanitin resistance in other organisms. These observations of amanitin resistance of Giardia RNA polymerase II support previous proposals of the mechanism of amanitin resistance in other organisms and provide a molecular framework for the development of novel drugs with selective activity against G. lamblia.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Giardia is a flagellated unicellular eukaryotic microorganism that commonly causes diarrheal disease throughout the world. This protist is a diplomonad with two nuclei but lacks nucleoli and peroxisomes and mitochondria. Based on comparisons of 18 S rRNA sequences, Giardia lamblia appears to be a basal eukaryote (13), although there is an ongoing debate about the interpretation of the position of Giardia in molecular trees (35).

Gene organization and transcription in Giardia is unusual relative to more commonly studied eukaryotes. Most Giardia transcripts have a very short 5'-untranslated region (1–6 nucleotides) (6) and do not possess a 7-methyl guanosine cap (7). Because many of the intergenic regions are less than 100 base pairs in length (6) and can be as short as 8–10 bp,1 the very compact nature of the genome might prevent the general use of longer 5'-untranslated regions. Because of the potential impact on organization of promoter regions, these short intergenic elements may constrain the regulation of transcription. Eukaryotic RNA polymerase II (RNAP II)2 promoters are highly conserved and usually have 3 short sequences centered at 30 (TATA box), 75 (CAAT box), and 90 (GC box) bases upstream of the transcription start site (8). In contrast, the G. lamblia RNAP II promoters have AT-rich sequences at the transcription start site (consensus AATTAAAAA), 20–35 nucleotides upstream of the start site (consensus CAAAAA(A/T)(T/C)AGA(G/T)TC(C/T)GAA), and a third hexamer 40–70 bases upstream of the start site (consensus CAATTT) (9, 10). These differences in Giardia transcription suggest the possibility that the components of G. lamblia RNAP II that affect the transcription start site may differ from those of other eukaryotes.

The RNAP II holoenzyme in eukaryotes consists of 12 subunits, Rpb1 through Rpb12 (1116). Rpb1, Rpb2, Rpb3, Rpb4, Rpb7, Rpb9, and Rpb11 are unique to RNAP II, whereas Rpb5, Rpb6, Rpb8, Rpb10, and Rpb12 are also components of the other two nuclear RNA polymerases (RNA polymerases I and III) (16). Rpb4 and Rpb9 are dispensable in Saccharomyces cerevisiae at optimal growth conditions, whereas the remaining subunits are essential for viability (17, 18).

The three nuclear RNA polymerases vary in their sensitivities to the cyclic octapeptide {alpha}-amanitin. RNAP I is resistant to amanitin, RNAP II is 50% inhibited by 5–20 µg/ml, and RNAP III is 50% inhibited by 250 µg/ml amanitin. These differences in sensitivity are frequently exploited to study the transcription of genes by different polymerases. For example, the amanitin resistance of variant surface glycoprotein gene transcription in African trypanosomes provided the basis for the proposal that these genes are transcribed by RNAP I (19).

However, there are organisms in which RNAP II transcription is naturally amanitin-resistant. RNAP II transcription in Trichomonas vaginalis is resistant to 250 µg/ml amanitin (20, 21), whereas Entamoeba histolytica transcription is resistant to 1 mg/ml amanitin (22). In the current manuscript, we describe the genes encoding G. lamblia RNAP II and demonstrate a potential molecular basis for amanitin-resistant transcription of protein-coding genes in G. lamblia.


    EXPERIMENTAL PROCEDURES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Source and Cultivation of Organisms—G. lamblia trophozoites were grown in modified TYI-S-33 as previously described (23). The WB (24) and ISR isolates (25) have been described previously as has the E11 cloned line of the ISR isolate (ISRE11) (26). The YRP-840 strain of S. cerevisiae (27) was grown in YPD medium (1% yeast extract, 2% bactopeptone, 2% dextrose) to obtain 5 x 108 cells.

Identification of G. lamblia rpb Genes—The Giardia genome project (28) is now at 7.7-fold coverage with an estimated 99% coverage with at least a single pass. To identify the Rpb subunits of Giardia, we used the protein sequences of the Schizosaccharomyces pombe rpb genes as a query in a TBLASTN search against the G. lamblia project data base (www.mbl.edu/Giardia). We then analyzed the contigs containing the putative rpb genes. Because introns are rare in Giardia (one has been identified in the 2Fe2S ferredoxin gene (29)), we used the ORFs of the primary genomic sequences for subsequent analysis. We used the translation of each putative rpb ORF as a query in a BLASTP search against the nonredundant data base to confirm whether it was the ortholog of the given gene. When bidirectional sequences were not available, we used primer walking to obtain complete bidirectional sequences.

Using the S. pombe ortholog as a query, BLAST failed to identify the rpb7 gene in the genome data base, but a consensus of two conserved motifs from S. cerevisiae, Caenorhabditis elegans, Mus musculus, Rattus norvegicus, and Homo sapiens returned a putative rpb7 sequence with a TBLASTN score of 0.24.

rpb Probes—We prepared probes for each rpb gene to determine genomic location and organization as well as transcript length. The ORFs of the three largest subunits, Rpb1, Rpb2, and Rpb3, were found entirely within the plasmid clones MJ3673, NJ2874, and KJ2040 (www.mbl.edu/Giardia); therefore, these plasmids were used as probes. In the case of rpb3, we used the plasmid clone KJ2040 for pulsed-field gel electrophoresis hybridizations and an antisense oligo (described below) to probe genomic restriction fragments and RNA blots. We used PCR products amplified from genomic DNA with the following primers as probes for the following rpb ORFs. The number indicated in the brackets refers to the size of the amplified product. TACCAACAGTCTCCGACG and GTCTACGGAACGGCAGAG for rpb5a (651), ATGGACTCACTTGCGCTG and AGAGATGTTTCCCCGCAC for rpb5b (586), GCCCTTGATCGTGGAAAG and GTAACTCGCTGAGCTTCC for rpb6 (283), CTTCCACATTGAGGCCAC and CCCCCCTATTGATGTTTC for rpb7 (382), ATCATCCCTGTTCGGTGC and TTACTTCTGCTCCGCCGC for rpb10 (241), CGGATCGGTACAAAACAC and GTGGGTGTGCATGATACT for rpb11 (356), and GGGAAAATCAGCCTGTCG and GATTAGGGTTTGTGTTGC for rpb12 (96). We used single-stranded antisense oligonucleotide probes for rpb3 (5'-GGGAGCCTTTCAAATTCATCGCAC) and rpb8 (5'-GCATAATCTAAGTCTGGGTAGGCG). Because of the small size of rpb12, we used reverse transcription-PCR with primers rpb12A (GGGAAAATCAGCCTGTCG) and rpb12B (GATTAGGGTTTGTGTTGC) to analyze the transcription of rpb12. The EZ rTth RNA PCR kit (Applied Biosystems, Foster City, CA) was used to amplify a 96-bp product within the rpb12 ORF. Procedures were followed as suggested by the manufacturer, except that a 50 °C annealing temperature was used instead of 60 °C. Sequences similar to rpb4 and rpb9 do not occur in the current coverage of the G. lamblia genome.

Identification of the G. lamblia Leucyl-tRNA Gene—The BLAST annotation of the Giardia genome sequences identified a putative leucyl-tRNA. The G. lamblia sequence was aligned with the C. elegans leucyl-tRNA sequence using LALIGN (30), using a +5/–4 scoring matrix with gap and extension penalties of –12 and –4, respectively. An oligonucleotide with the sequence complementary to the identified gene (5'-GCCAGCTGTGGGGTTCGAACCCACGCGGTCTTGCAACCAATGGGACTTGAATCCATCGCCTTAACCACTCGG CCAAACTGGC) was used to probe northern blots as well as run-on transcripts.

Electrophoresis and Hybridization of Nucleic Acids—Total chromosomal DNA was prepared and separated by pulsed-field gel electrophoresis using the ISR E11 isolate to identify chromosomal locations because chromosomes 1 and 2 of this isolate can be readily distinguished (26). Restriction enzyme digestion and agarose gel electrophoresis of DNA were performed by standard methods. DNA was transferred to a nylon membrane by alkaline transfer in 0.4 M NaOH. RNA was extracted using the RNeasy kit (Qiagen, Valencia, CA), separated on a formaldehyde gel, and transferred to nylon in 10x SSC (1x SSC = 0.15 M NaCl and 0.015 M sodium citrate). Double-stranded DNA probes were labeled by random priming, and unincorporated nucleotides were removed by Sephadex G-50 spun column chromatography. Hybridization to DNA was performed in 5x SSC at 50 °C, and hybridization to RNA was performed in 5x SSC and 50% formamide at 37 °C. Oligonucleotide probes were end-labeled with [{gamma}-32P]ATP and T4 polynucleotide kinase and purified using a G-25 column. Hybridization was carried out in 6x SSC, and washing was done in 1x SSC at 50 °C.

Nuclear Run-on Assays—G. lamblia nuclear run-on assays were performed as previously described for Trypanosoma brucei (31) and G. lamblia (32), with minor modifications. Trophozoite cultures were harvested in late log phase by centrifugation at 1200 x g and washed twice in phosphate-buffered saline. The pellets were re-suspended in Buffer A (150 mM sucrose, 20 mM KCl, 3 mM MgCl2, 20 mM HEPES, 1 mM dithiothreitol, 10 µg/ml leupeptin (Sigma-Aldrich) to a density of 6 x 108 cells/ml in 400-µl aliquots. Palmitoyl lysophosphatidylcholine (lysolecithin) was added to a concentration of 500 µg/ml and chilled on ice for 1 min. Two volumes of Buffer A at room temperature were added, and the trophozoites were then recovered by centrifugation as described before. The pellets were washed twice in Buffer A and resuspended in 100 µl of the run-on mixture (50 mM Tris-HCl, pH 7.9, 100 mM KCl, 5 mM MgCl2, 1 mM MnCl2, 2 mM dithiothreitol, 4 mM ATP, 2 mM GTP, 2 mM CTP, 100 µCi of [32P]UTP), 1 unit/µl RNasin (Promega, Madison, WI), 10 mM phosphocreatine, and 1.2 µg/µl creatine kinase). In the amanitin experiments, amanitin was added at concentrations of 0, 50, 250, or 1000 µg/ml. The reaction was carried out for 1 h at room temperature and stopped by adding DNase I (0.2 mg/ml) and proteinase K (25 mg/ml) followed by incubation at 55 °C for 30 min. Radiolabeled RNA was extracted from the cells using the DNA/RNA kit procedure for RNA extraction (Qiagen). DNA probes used for nuclear run-on assays were denatured and slot-blotted onto 0.45 µM Supercharge Nytran membranes (Schleicher and Schuell).

For the S. cerevisiae run-on assays, a log phase culture of S. cerevisiae was harvested by centrifugation at 4600 x g. The pellet (3 x 107 cells) was washed with TMN buffer (10 mM Tris HCl, pH 7.4, 100 mM NaCl, 5 mM MgCl2) and resuspended in 1 ml of 0.5% Sarkosyl. The suspension was placed on ice for 15 min, and the cells were recovered by centrifugation at 4000 x g for 1 min at 4 °C. The pellet was resuspended in 100 µl of run-on mixture (50 mM Tris-HCl pH 7.9, 100 mM KCl, 5 mM MgCl2, 1 mM MnCl2, 2 mM dithiothreitol, 0.5 mM ATP, GTP, and CTP, 100 µCi of [32P]UTP, 1 unit/µl RNasin, 10 mM phosphocreatine, and 1.2 µg/µl creatine kinase). In the {alpha}-amanitin control experiments, {alpha}-amanitin (50 µg/ml) was added to the run-on mixture (33). The reaction was carried out for 1 h at room temperature and stopped by adding DNase I (0.2 mg/ml) and proteinase K (25 mg/ml) followed by incubation at 55 °C for 10 min. RNA was then extracted from the run-on mixture as for G. lamblia and hybridized to the slot-blotted nucleic acid probes (discussed below) in 6x SSC and 25% formamide at 37 °C. The blots were washed in 1x SSC at 50 °C. In the RNase A control experiment, the extracted RNA was incubated at 37 °C in the presence of 1 mg/ml RNaseA for 1 h before hybridization.

Probes Used in Nuclear Run-on Assays—A plasmid probe for ribosomal DNA in Giardia was obtained from Tom Edlind (34). {beta}-Giardin (35, 36) and vsp conserved region (37) probes were amplified from genomic DNA using the primers listed below. The vsp conserved primers were based on the vspA6 (CRP170) (38) sequence. In that region, all published vsp sequences demonstrate greater than 90% nucleotide identity; thus, all vsp transcripts should hybridize to the probe (37).3 The probes for {beta}-giardin (810 bp) (GenBankTM accession number GI X85958 [GenBank] ) and the vsp conserved region (93 bp) (GenBankTM accession number GI M83933 [GenBank] ) were obtained by means of PCR from genomic DNA using the primer sets ATGTTCACCTCCACCCTTACG/GTGCTTTGTGACCATCGAGAG for {beta}-giardin and GGTGCCATCGCGGGGATCTCC/CGCCTTCCCTCTACAG ATGAA for the vsp conserved region.

Custom made oligo 60-mers, GGCAAGCACGTCCCGCGCGCGGTCTTCGTTGACCTCGAGCCCACGGTCGTC GACGAGGTC and GACCTCGTCGACGACCGTGGGCTCGAGGTCAACGAAGACCGCGCGCGGGACGTGCTTGCC, which are the sense and antisense strands of the {alpha}2-tubulin gene, were used as single strand DNA probes. Probes for the S. cerevisiae genes were amplified from genomic DNA using the primers GGTTGATCCTGCCAGTAGTCATATG and GACTTGCCCTCCAATTGTTCCTCG for 18 S rRNA (783-bp product) (39), ATATCACGGCCATGACGATATCCAG and GGCATCAAACATTTGCTGTG for {beta}-tubulin (531-bp product; GenBankTM accession number GI V01296 [GenBank] ), and CGTTGTCGTTATCGGTCATGTCG and CGAATGGAACAGTCTTTGGGTTG for the EF-1{alpha} gene (538 bp; GenBankTM accession number GI X00779 [GenBank] ).

MEME Analysis—The Rpb1 sequences of M. musculus (GenBankTM U37500 [GenBank] ), H. sapiens (X63564 [GenBank] ), C. elegans (T29959 [GenBank] ), Drosophila melanogaster (P04052 [GenBank] ), Arabidopsis thaliana (CAB81489 [GenBank] ), Helobdella stagnalis (AAA50227 [GenBank] ), S. pombe (AL121795 [GenBank] ), S. cerevisiae (X03128 [GenBank] ), Aspergillus oryzae (AB017184 [GenBank] ), Plasmodium falciparum (NP_473294 [GenBank] ), Leishmania major (AF009163 [GenBank] ), T. brucei (J03157 [GenBank] ), Mastigamoeba invertens (AF083338 [GenBank] ), Bonnemaisonia hamifera (U90209 [GenBank] ), T. vaginalis (U20501 [GenBank] ), and G. lamblia and Rpc1 sequences of G. lamblia, S. cerevisiae, and H. sapiens were entered in FASTA format at the MEME web site (meme.sdsc.edu/meme/website/meme.html) (40). To restrict the alignment to the {alpha}-amanitin motif, the training sequences included the amanitin motif described for M. musculus, D. melanogaster, C. elegans, and S. cerevisiae (41) The multiple sequence alignment (MSA) of these orthologs was also done using ClustalW (42), which allows gaps to be introduced in the sequences. The results were identical to that of the MEME output within the amanitin motif. A similar procedure was followed to obtain a block diagram of the bridge helix.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Amanitin Resistance of RNAP II Transcription—{alpha}-Amanitin, a mushroom-derived cyclic octapeptide, inhibits RNAP II of most eukaryotes by interacting with Rpb1. To determine its potential usefulness in studying RNAP II transcription in Giardia, we conducted nuclear run-on assays using housekeeping genes that have previously been characterized. The cytoskeletal gene {alpha}2-tubulin is highly expressed in trophozoites (43). {beta}-Giardin is a cytoskeletal protein that is unique to G. lamblia and is found in the ventral disk that mediates attachment to the intestinal wall (35, 36, 44). Both have upstream flanking regions that fit the consensus for promoters of G. lamblia protein-coding genes (9, 43), and transcripts for each of the genes have polyadenylated tails. Thus, we would expect both of these genes to be transcribed by RNAP II. The vsp gene transcripts also have polyadenylated tails and the short 5'-untranslated regions that are typical of G. lamblia genes and are most likely transcribed by RNAP II. However, vsp genes do not have the typical G. lamblia promoter regions. The vsp genes that have been characterized demonstrate at least 90% identity in the 110-bp 3' region, so all vsp gene transcripts should hybridize to this region (37).3

Frequent antisense transcripts for a variety of genes have been reported in G. lamblia (45, 46); therefore, we used complementary 60-mer antisense and sense oligonucleotides for the tubulin gene to distinguish between sense and antisense transcripts in the run-on product. The antisense probe gave a strong signal, whereas the sense probe gave no signal (Fig 1A), indicating that the level of antisense transcription for the tubulin gene is low or absent. Control experiments using RNase A before hybridization yielded no signal, as expected (data not shown). We observed no inhibition of transcription in the presence of 50 µg/ml amanitin with the tubulin, giardin, or the vsp conserved region probes (Fig 1A). RNAP I transcription as measured by hybridization to the rRNA gene was unaffected at a concentration of 50 µg/ml. In contrast to the amanitin resistance of Giardia RNAP II, transcription of the S. cerevisiae EF1-{alpha} and tubulin genes was almost totally inhibited by 50 µg/ml amanitin, whereas rRNA transcription was unaffected (Fig 1B). Actinomycin D almost completely inhibited G. lamblia RNAP I and RNAP II transcription at a concentration of 10 µg/ml (Fig. 2).



View larger version (14K):
[in this window]
[in a new window]
 
FIG. 1.
Nuclear run-on assays. A, run-on assays of nascent G. lamblia RNA were performed in the presence and absence of {alpha}-amanitin (50 µg/ml). The detected transcript is indicated in the right panel. B, run-on assays of S. cerevisiae RNA were used as a positive control for RNAP II inhibition by {alpha}-amanitin. 1, PCR product of the tubulin ORF. 2, tubulin ORF cloned into pBlueScriptII SK+.

 


View larger version (37K):
[in this window]
[in a new window]
 
FIG. 2.
Nuclear run-on assays in the presence of 1 mg/ml amanitin or 10 µg/ml actinomycin D. The table shows the number of radioactive counts in excess of background detected by phosphorimaging over a period of 10 min.

 

Amanitin Susceptibility of RNAP III Transcription—Because eukaryotic RNAP III transcription is partially susceptible to high concentrations of amanitin, we used the leucyl-tRNA gene to evaluate the sensitivity of Giardia RNAP III transcription to amanitin. A putative G. lamblia leucyl-tRNA sequence from the BLAST annotations of the genomic sequences was 78.6% identical to the C. elegans ortholog (Fig. 3). A complementary oligonucleotide identified an 80-nucleotide band on a Northern blot (Fig. 4), which is the expected size of a tRNA gene. Run-on assays at varying concentrations of amanitin (50, 250, and 1000 µg/ml) using the leucyl-tRNA antisense oligonucleotide probe demonstrated that RNAP III transcription was 85% inhibited by 50 µg/ml of amanitin, whereas RNAP I and RNAP II transcription was unaffected (Fig. 5). When we separated the run-on transcripts on a denaturing polyacrylamide gel, we observed a series of bands ranging in size from 70 to 82 nucleotides (Fig. 6), which most likely represent tRNA, as well as 93- and 110-nucleotide bands, which were present in the amanitin untreated sample and not in the treated ones. We do not know the identity of the 93- and 110-nucleotide bands.



View larger version (9K):
[in this window]
[in a new window]
 
FIG. 3.
Alignment of leucyl-tRNA ortholog sequences of G. lamblia and C. elegans. Sequence alignment of the putative G. lamblia leucyl-tRNA gene and the C. elegans ortholog (indicated G. lam and C. ele, respectively) using the LALIGN algorithm and a +5/–4 scoring matrix with gap and gap extension penalties of –12 and –4, respectively, reveals a 78.6% identity in the 83-nucleotide alignment. Gaps are indicated by dashes, and positions of identity are indicated by dots in the C. elegans sequence.

 


View larger version (13K):
[in this window]
[in a new window]
 
FIG. 4.
Leucyl-tRNA Northern blot. Northern blot of G. lamblia RNA probed with an 80-mer oligonucleotide complementary to the leucyl-tRNA sequence.

 


View larger version (44K):
[in this window]
[in a new window]
 
FIG. 5.
Nuclear run-on assays at varying amanitin concentrations. The top panel shows the hybridization of RNAP I, RNAP II, and RNAP III probes to the nascent transcripts of run-on reactions carried out in the presence of 0, 50, 250, or 1000 µg/ml amanitin. The detected transcripts are indicated in the right panel. The experiment was carried out three times, and the results were consistent. The bottom panel demonstrates the relative levels of RNAP I (rRNA), RNAP II (tubulin), and RNAP III (tRNA) transcription at varying amanitin concentrations. The radioactive counts per minute in each of the above shown bands was estimated by scintillation counting and subtracting the background. The transcription efficiency for each transcript in amanitin-treated run-on samples is expressed as a percentage of the signal obtained in the untreated sample.

 


View larger version (48K):
[in this window]
[in a new window]
 
FIG. 6.
PAGE analysis of run-on RNA extracts. The run-on reactions shown in Fig. 5 were separated on an 8% denaturing polyacrylamide gel containing 7 M urea. The gel was then fixed, dried, and autoradiographed. Lanes 1–4 were loaded with samples from untreated, 50, 250, and 1000 µg/ml amanitin-treated run-on experiments, respectively.

 

Identification of G. lamblia rpb Genes—To evaluate the potential molecular basis for amanitin resistance as well as other differences of G. lamblia RNAP II transcription from that of other eukaryotes, we identified the genes that encode the subunits of RNAP II from the Giardia genome data base. We identified rpb1, rpb2, rpb3, rpb5, rpb6, rpb7, rpb8, rpb10, rpb11, and rpb12, including two isoforms of rpb5 (rpb5a and rpb5b), but did not find rpb4 or rpb9. However, we did identify rpc9, which demonstrated a 23% identity with the S. cerevisiae Rpb9 along almost the entire length of the polypeptide, including the cysteine residues that coordinate Zn2+ ions in both Rpb9 and Rpc9. Table I shows the chromosomal location and approximate transcript sizes for each of the rpb genes. The rpb genes are distributed among all five chromosomes, and restriction digests (data not shown) show that each is present as a single copy. As for most G. lamblia genes, the transcripts of the rpb genes were approximately the same size as the ORFs (Table I). The comparisons of the G. lamblia and S. cerevisiae Rpb amino acid sequences are shown in Table I.


View this table:
[in this window]
[in a new window]
 
TABLE I
G. lamblia rpb subunits

 

Molecular Correlations between the Rpb1 Sequence and Amanitin Resistance in G. lamblia and Other Organisms— Amanitin contacts residues in two helices in Rpb1, the amanitin motif (residues 719–779 in S. cerevisiae) and the bridge helix (residues 810–825), as shown by {alpha}-amanitin-RNA polymerase II co-crystals at 2.8-Å resolution (47). The residues of the bridge helix of Rpb1 directly contact the DNA base that is paired with the first base in the RNA strand, whereas the amanitin motif forms a helix that lines a funnel-shaped cavity through which nucleotides gain access to the active site. The amanitin-RNAP II co-crystals show potential hydrogen bonds between amanitin and S. cerevisiae residues 722 (leucine) and 769 (serine) (48), which are also conserved in other eukaryotes. Therefore, we analyzed this region with the MSA tool MEME (40) (Fig. 7). These positions are shown at positions 5 and 52 on Fig. 7 and correspond to the mouse R749P/Drosophila R741H and mouse N792D mutations that are associated with amanitin resistance (41). In G. lamblia, valine replaces the leucine at position 5, whereas phenylalanine replaces asparagine at position 52. Other potential hydrogen bonds have been suggested between amanitin and the glutamine residues at positions 50 and 51. These glutamine residues are conserved in all the Rpb1 orthologs including that of G. lamblia (Fig. 7).



View larger version (85K):
[in this window]
[in a new window]
 
FIG. 7.
Amanitin motif. MEME was used to generate the block diagram of the amanitin motif. Amino acid positions have been assigned such that the start of the motif is labeled as position 1. The start site of the motif in each Rpb1 and Rpc1 ORF is shown in the column labeled AA#. Point mutations that have been associated with {alpha}-amanitin resistance in Rpb1 are indicated at the top of each of the six amino acid positions. The borders around the amino acids in those positions indicate the organism in which each mutation was identified.

 

Four additional mutations in the amanitin motif associated with amanitin resistance have been described (41). Replacement of cysteine with tyrosine at position 47 (Fig. 7) is associated with resistance in C. elegans (C777Y) (41), possibly because of the presence of the hydroxyl group of tyrosine rather than its bulky nature, since T. brucei has a phenylalanine at the same position but is {alpha}-amanitin-sensitive. This position is occupied by serine in G. lamblia. The R749P mutation (position 9 in Fig. 7) confers {alpha}-amanitin resistance in M. musculus, and in G. lamblia this position is occupied by serine. The {alpha}-amanitin-resistant G55E mutation has been reported in C. elegans. This glycine is conserved in all the Rpb1 sequences except G. lamblia, which has a serine residue at that position. Replacement of isoleucine with phenylalanine at position 39 in M. musculus has also been associated with amanitin resistance. G. lamblia has a phenylalanine at this position. Thus, the amanitin motif of G. lamblia Rpb1 differs from that of other eukaryotes at all six conserved positions that have been associated with amanitin resistance in other organisms.

The Rpc1 amanitin motif sequences of G. lamblia, S. cerevisiae, and H. sapiens contained five of the six conserved amino acids. All the three Rpc1 orthologs had substitutions at position 52 of the amanitin motif (Fig. 7).

The movement of the bridge helix is important for the translocation of RNAP II on DNA, and binding of amanitin to the bridge helix imposes a constraint on its movement, hampering the translocation of the polymerase on DNA. X-ray co-crystals showed a very strong hydrogen bond between S. cerevisiae glutamate residue 822 of the bridge helix and amanitin (47). This glutamate is conserved in all Rpb1 orthologs with the exception of T. vaginalis, which has a threonine residue at that position (Fig. 8). Therefore, it is possible that this substitution contributes to the amanitin resistance observed in T. vaginalis RNAP II. The glutamate is conserved in RNAP III (Rpc1) of S. cerevisiae and H. sapiens, whereas the G. lamblia sequence encodes a conservative substitution (aspartate).



View larger version (103K):
[in this window]
[in a new window]
 
FIG. 8.
Bridge helix motif. The MEME algorithm was used to generate the MSA block diagram of the bridge helix. The amino acid position of the start of the bridge helix in each ortholog is indicated. The conserved position where T. vaginalis Rpb1 has a threonine substituted for glutamate has been shaded. Rpc1 orthologs are indicated by the suffix III. Rpc1 of G. lamblia has an aspartate substitution at this position.

 

Other Comparisons of G. lamblia RNAP II with Other Eukaryotes—Rpb1 and Rpb2 form the two lobes flanking the cleft through which the DNA gains entry to the active site. The active site of the enzyme is marked by the presence of two Mg2+ ions, designated A and B (47). The metal ion A is coordinated by three alternating aspartate residue side chains present in an absolutely conserved motif, NADFDGD, at positions 479–485 in S. cerevisiae Rpb1 (47, 49). This motif is found at positions 496–502 of the G. lamblia Rpb1 and is in perfect alignment with the motif in all the other eukaryotes in the MSA generated using ClustalW with a BLOSUM62 substitution model (data not shown). The metal ion B at the active site is held in correct position for the formation of the phosphodiester bond by glutamate and aspartate residue side chains at positions 835 and 836, respectively, in the yeast Rpb2 (47, 50). These residues are conserved in all eukaryotic Rpb2 orthologs and are present at positions 877 and 878 in the G. lamblia ortholog in our MSAs (data not shown).

The C-terminal domain is required for enhancer-driven transcription and consists of heptapeptide repeats (consensus YS-TPSTS) in most Rpb1 orthologs. The C-terminal domain also recruits factors involved in co-transcriptional processes, such as 5' capping, splicing, and transcription termination. The hydroxyl side chains of the C-terminal domain are hyperphosphorylated during elongation and hypophosphorylated during initiation of transcription. Most protists including G. lamblia lack regular repeats but have a frequent occurrence of hydroxyl-containing amino acids in this domain (Table II).


View this table:
[in this window]
[in a new window]
 
TABLE II
Rpb1 C-terminal domain

The C-terminal domain (CTD) table represents the length of the C-terminal domain (amanitin-domain) in different Rpb1 orthologs and the combined frequency of serine, tyrosine, threonine, and proline in the domain. The genes with regular repeats have higher percents of STYP residues (61-93%) than those lacking the regular repeat (32-55%). However, even the genes without the regular repeat have a frequency of these residues that is greater than the background frequency.

 

Nucleotide triphosphates gain entry through a pore (known as pore1) in RNAP II beneath the active site. The pore module has a conserved motif PXIXKPXXLWXGKQ (where X is any amino acid), which is essential for the interaction of Rpb1 with Rpb8 (51). The sequence of the G. lamblia Rpb1 pore module is PXIXYPXXRWXGKQ, beginning at position 689. The rpb8 motif that interacts with rpb1, GGLLM, at position 119 in the yeast is replaced by GGLIA at position 120 in the G. lamblia rpb8 gene.

In S. cerevisiae, Rpb5 and Rpb9 (along with some regions of Rpb1) flank the Rpb1-Rpb2 cleft and position the downstream DNA. We identified two isoforms of Rpb5 in G. lamblia using the TBLASTN function with S. pombe Rpb5 as the query sequence. They are 229 and 201 amino acids long and positions 136–229 of Rpb5a and 108–201 of Rpb5b are 43% identical, whereas there is little similarity throughout the remainder of the genes. Both G. lamblia Rpb5 genes align with S. cerevisiae ortholog over nearly the entire sequence and are 30% identical and 46% similar (Rpb5a) or 26% identical and 41% similar (Rpb5b) to the S. cerevisiae ortholog. Thus, in terms of overall alignment, the two G. lamblia Rpb5s are nearly as similar to S. cerevisiae Rpb5 as to each other. Proline residues at positions 86 and 118 of S. cerevisiae Rpb5 contact the DNA backbone through nonspecific van der Waals interactions, which might favor a particular rotational setting for DNA while allowing its helical screw rotation (50). Neither proline residue was present in either of the G. lamblia Rpb5 sequences.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Our nuclear run-on assays indicate that RNAP II transcription in G. lamblia is highly resistant to {alpha}-amanitin. In organisms known to have {alpha}-amanitin-sensitive RNAP II transcription, the sequence of the RNAP II amanitin motif matches the consensus at all six residues that have been associated with resistant mutants, except that S. pombe, T. brucei, and S. cerevisiae each have a single conservative substitution (Fig. 7). These six residues are found in the amanitin binding site, as demonstrated by RNAP II-amanitin co-crystal structures (48). T. vaginalis, which has {alpha}-amanitin-resistant transcription (20), differs at three of the six amino acids, whereas G. lamblia differs at all six, providing a potential molecular basis for {alpha}-amanitin resistance in these two organisms. The protist M. invertens also differed at three positions, but the susceptibility of its transcription to {alpha}-amanitin has not yet been reported. In contrast, G. lamblia RNAP III shows greater similarity to other eukaryotes at the amanitin binding domain and is actually more sensitive to amanitin than most other orthologs.

Our inability to detect rpb4 and rpb9 may indicate their absence from the genome, a level of divergence making them impossible to detect by BLAST or Hidden Markov Models (the latter attempted for rbp4 as available at pfam.wustl.edu), or could indicate that they have not yet been sequenced. Because the genome project is now at 7.7-fold coverage, we expect that 99% of the genome has been sequenced, making it relatively unlikely that these genes have not been sequenced. It is notable that these are the only two subunits that are nonessential in S. cerevisiae, lending credibility to the possibility that these subunits are truly absent in Giardia.

Mutations in Rpb9 affect the start site of transcription (5254) but are not lethal for yeast. Because G. lamblia has very short 5'-untranslated regions and lacks the typical eukaryotic RNAP II promoters, it is possible that Rpb9 is not required. Alternatively, it is possible that another protein such as Rpc9 performs that function in G. lamblia. In contrast to the apparent absence of two rpb genes, we found two rpb5 genes. The reason for this finding is not clear.

There is considerable controversy regarding whether the cellular, molecular, and biochemical differences between G. lamblia and other eukaryotes are ancestral or whether they represent a more recent divergence from other eukaryotes. A better understanding of transcription in Giardia along with its unique features may help to resolve this controversy. In addition, it is possible that the difference in the structure of the G. lamblia RNAP II that leads to amanitin resistance can be exploited for the development of novel chemotherapeutic agents.


    FOOTNOTES
 
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EBI Data Bank with accession number(s) AF510641 [GenBank] –51 (rpb genes) and AY245002 [GenBank] (leucyl-tRNA gene).

* This work was supported in part by National Institutes of Health Grants AI43273 (to M. L. S.) and AI51089 (to A. G. M.). Additional support was provided by the G. Unger Vetlesen Foundation and LI-COR Biotechnology. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

|| To whom correspondence should be addressed: Dept. of Microbiology/Immunology, University of Arizona, 1501 N. Campbell, Tucson, AZ 85724-5049. Tel.: 520-626-6430; Fax: 626-2100; E-mail: adamr{at}u.arizona.edu.

1 V. Seshadri and R. D. Adam, unpublished results. Back

2 The abbreviations used are: RNAP, RNA polymerase; MSA, multiple sequence alignment; MEME, multiple expectation maximizations and motif elicitation; contig, group of overlapping clones; ORF, open reading frame. Back

3 V. Seshadri, A. G. McArthur, M. L. Sogin, and R. D. Adam, unpublished data from MEME (multiple expectation maximizations and motif elicitation) analysis of 14 published vsp genes. Back


    ACKNOWLEDGMENTS
 
We thank Lynda Schurig for technical assistance. Sequences that are part of the genome project can be accessed at the web site www.mbl.edu/Giardia.



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Sogin, M. L., Gunderson, J. H., Elwood, H. J., Alonso, R. A., and Peattie, D. A. (1989) Science 243, 75–77[Abstract/Free Full Text]
  2. Philippe, H., and Germot, A. (2000) Mol. Biol. Evol. 17, 830–834[Free Full Text]
  3. Philippe, H., Germot, A., and Moreira, D. (2000) Curr. Opin. Genet. Dev. 10, 596–601[CrossRef][Medline] [Order article via Infotrieve]
  4. Bapteste, E., Brinkmann, H., Lee, J. A., Moore, D. V., Sensen, C. W., Gordon, P., Durufle, L., Gaasterland, T., Lopez, P., Muller, M., and Philippe, H. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 1414–1419[Abstract/Free Full Text]
  5. Adam, R. D. (2001) Clin. Microbiol. Rev. 14, 447–475[Abstract/Free Full Text]
  6. Adam, R. D. (2000) Int. J. Parasitol. 30, 475–484[CrossRef][Medline] [Order article via Infotrieve]
  7. Yu, D. C., Wang, A. L., Botka, C. W., and Wang, C. C. (1998) Mol. Biochem. Parasitol. 96, 151–165[CrossRef][Medline] [Order article via Infotrieve]
  8. Zawel, L., and Reinberg, D. (1993) Prog. Nucleic Acids Res. Mol. Biol. 44, 67–108[Medline] [Order article via Infotrieve]
  9. Holberton, D. V., and Marshall, J. (1995) Nucleic Acids Res. 23, 2945–2953[Abstract/Free Full Text]
  10. Sun, C. H., and Tai, J. H. (1999) J. Biol. Chem. 274, 19699–19706[Abstract/Free Full Text]
  11. Kimura, M., Sakurai, H., and Ishihama, A. (2001) Eur. J. Biochem. 268, 612–619[Medline] [Order article via Infotrieve]
  12. Ishihama, A., Kimura, M., and Mitsuzawa, H. (1998) Curr. Opin. Microbiol. 1, 190–196[CrossRef][Medline] [Order article via Infotrieve]
  13. Sakurai, H., Mitsuzawa, H., Kimura, M., and Ishihama, A. (1999) Mol. Cell. Biol. 19, 7511–7518[Abstract/Free Full Text]
  14. McKune, K., Moore, P. A., Hull, M. W., and Woychik, N. A. (1995) Mol. Cell. Biol. 15, 6895–6900[Abstract]
  15. Sakurai, H., and Ishihama, A. (1997) Gene (Amst.) 196, 165–174[CrossRef][Medline] [Order article via Infotrieve]
  16. Woychik, N. A., and Young, R. A. (1990) Trends Biochem. Sci. 15, 347–351[Medline] [Order article via Infotrieve]
  17. Woychik, N. A., Liao, S. M., Kolodziej, P. A., and Young, R. A. (1990) Genes Dev. 4, 313–323[Abstract/Free Full Text]
  18. McKune, K., Richards, K. L., Edwards, A. M., Young, R. A., and Woychik, N. A. (1993) Yeast 9, 295–299[CrossRef][Medline] [Order article via Infotrieve]
  19. Kooter, J. M., and Borst, P. (1984) Nucleic Acids Res. 12, 9457–9472[Abstract/Free Full Text]
  20. Quon, D. V. K., Delgadillo, M. G., and Johnson, P. J. (1996) J. Mol. Evol. 43, 253–262[Medline] [Order article via Infotrieve]
  21. Vanacova, S., Tachezy, J., Ullu, E., and Tschudi, C. (2001) Mol. Biochem. Parasitol. 115, 239–247[CrossRef][Medline] [Order article via Infotrieve]
  22. Lioutas, C., and Tannich, E. (1995) Mol. Biochem. Parasitol. 73, 259–261[CrossRef][Medline] [Order article via Infotrieve]
  23. Keister, D. B. (1983) Trans. R. Soc. Trop. Med. Hyg. 77, 487–488[CrossRef][Medline] [Order article via Infotrieve]
  24. Smith, P. D., Gillin, F. D., Kaushal, N. A., and Nash, T. E. (1982) Infect. Immun. 36, 714–719[Abstract/Free Full Text]
  25. Nash, T. E., McCutchan, T., Keister, D., Dame, J. B., Conrad, J. D., and Gillin, F. D. (1985) J. Infect. Dis. 152, 64–73[Medline] [Order article via Infotrieve]
  26. Adam, R. D., Nash, T. E., and Wellems, T. E. (1988) Nucleic Acids Res. 16, 4555–4567[Abstract/Free Full Text]
  27. Hatfield, L., Beelman, C. A., Stevens, A., and Parker, R. (1996) Mol. Cell. Biol. 16, 5830–5838[Abstract]
  28. McArthur, A. G., Morrison, H. G., Nixon, J. E. J., Passamaneck, N. Q. E., Kim, U., Hinkle, G., Crocker, M. K., Holder, M. E., Farr, R., Reich, C. I., Olsen, G. E., Aley, S. B., Adam, R. D., Gillin, F. D., and Sogin, M. L. (2000) FEMS Microbiol. Lett. 189, 271–273[CrossRef][Medline] [Order article via Infotrieve]
  29. Nixon, J. E. J., Wang, A., Morrison, H. G., McArthur, A. G., Sogin, M. L., Loftus, B. J., and Samuelson, J. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 3701–3705[Abstract/Free Full Text]
  30. Huang, X., Xiaoqiu, Miller, W., and Webb (1991) Adv. Appl. Math. 12, 337–357[CrossRef]
  31. Ullu, E., and Tschudi, C. (1990) Nucleic Acids Res. 18, 3319–3326[Abstract/Free Full Text]
  32. Yee, J., Mowatt, M. R., Dennis, P. P., and Nash, T. E. (2000) J. Biol. Chem. 275, 11432–11439[Abstract/Free Full Text]
  33. Tukey, R. H., and Okino, S. T. (1991) Methods Enzymol. 206, 284–290[Medline] [Order article via Infotrieve]
  34. Edlind, T. D., and Chakraborty, P. R. (1987) Nucleic Acids Res. 15, 7889–7901[Abstract/Free Full Text]
  35. Baker, D. A., Holberton, D. V., and Marshall, J. (1988) Nucleic Acids Res. 16, 7177[Abstract/Free Full Text]
  36. Aggarwal, A., Adam, R. D., and Nash, T. E. (1989) Infect. Immun. 57, 1305–1310[Abstract/Free Full Text]
  37. Mowatt, M. R., Aggarwal, A., and Nash, T. E. (1991) Mol. Biochem. Parasitol. 49, 215–227[CrossRef][Medline] [Order article via Infotrieve]
  38. Adam, R. D., Yang, Y. M., and Nash, T. E. (1992) Mol. Cell. Biol. 12, 1194–1201[Abstract/Free Full Text]
  39. Rubtsov, P. M., Musakhanov, M. M., Zakharyev, V. M., Krayev, A. S., Skryabin, K. G., and Bayev, A. A. (1980) Nucleic Acids Res. 8, 5779–5794[Abstract/Free Full Text]
  40. Bailey, T. L., and Elkan, C. (1994) Proceedings of the Second International Conference on Intelligent Systems for Molecular Biology (ISMB'94) pp. 28–36, AAAI Press, Menlo Park, CA
  41. Bartolomei, M. S., and Corden, J. L. (1995) Mol. Gen. Genet. 246, 778–782[CrossRef][Medline] [Order article via Infotrieve]
  42. Thompson, J. D., Higgins, D. G., and Gibson, T. J. (1994) Nucleic Acids Res. 22, 4673–4680[Abstract/Free Full Text]
  43. Elmendorf, H. G., Singer, S. M., Pierce, J., Cowan, J., and Nash, T. E. (2001) Mol. Biochem. Parasitol. 113, 157–169[CrossRef][Medline] [Order article via Infotrieve]
  44. Crossley, R., and Holberton, D. V. (1983) J. Cell Sci. 59, 81–103[Abstract]
  45. Elmendorf, H. G., Singer, S. M., and Nash, T. E. (2001) Nucleic Acids Res. 29, 4674–4683[Abstract/Free Full Text]
  46. Knodler, L. A., Svärd, S. G., Silberman, J. D., Davids, B. J., and Gillin, F. D. (1999) Mol. Microbiol. 34, 327–340[CrossRef][Medline] [Order article via Infotrieve]
  47. Cramer, P., Bushnell, D. A., and Kornberg, R. D. (2001) Science. 292, 1863–1876[Abstract/Free Full Text]
  48. Bushnell, D. A., Cramer, P., and Kornberg, R. D. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 1218–1222[Abstract/Free Full Text]
  49. Zaychikov, E., Martin, E., Denissova, L., Kozlov, M., Markovtsov, V., Kashlev, M., Heumann, H., Nikiforov, V., Goldfarb, A., and Mustaev, A. (1996) Science 273, 107–109[Abstract]
  50. Cramer, P., Bushnell, D. A., Fu, J., Gnatt, A. L., Maier-Davis, B., Thompson, N. E., Burgess, R. R., Edwards, A. M., David, P. R., and Kornberg, R. D. (2000) Science 288, 640–649[Abstract/Free Full Text]
  51. Briand, J. F., Navarro, F., Rematier, P., Boschiero, C., Labarre, S., Werner, M., Shpakovski, G. V., and Thuriaux, P. (2001) Mol. Cell. Biol. 21, 6056–6065[Abstract/Free Full Text]
  52. Furter-Graves, E. M., Furter, R., and Hall, B. D. (1991) Mol. Cell. Biol. 11, 4121–4127[Abstract/Free Full Text]
  53. Furter-Graves, E. M., Hall, B. D., and Furter, R. (1994) Nucleic Acids Res. 22, 4932–4936[Abstract/Free Full Text]
  54. Hull, M. W., McKune, K., and Woychik, N. A. (1995) Genes Dev. 9, 481–490[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
Y.-J. Pan, C.-C. Cho, Y.-Y. Kao, and C.-H. Sun
A Novel WRKY-like Protein Involved in Transcriptional Activation of Cyst Wall Protein Genes in Giardia lamblia
J. Biol. Chem., July 3, 2009; 284(27): 17975 - 17988.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y.-C. Huang, L.-H. Su, G. A. Lee, P.-W. Chiu, C.-C. Cho, J.-Y. Wu, and C.-H. Sun
Regulation of Cyst Wall Protein Promoters by Myb2 in Giardia lamblia
J. Biol. Chem., November 7, 2008; 283(45): 31021 - 31029.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
H.-M. Bourbon
Comparative genomics supports a deep evolutionary origin for the large, four-module transcriptional mediator complex
Nucleic Acids Res., July 1, 2008; 36(12): 3993 - 4008.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
S. Teodorovic, C. D. Walls, and H. G. Elmendorf
Bidirectional transcription is an inherent feature of Giardia lamblia promoters and contributes to an abundance of sterile antisense transcripts throughout the genome
Nucleic Acids Res., April 3, 2007; 35(8): 2544 - 2553.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C.-H. Wang, L.-H. Su, and C.-H. Sun
A Novel ARID/Bright-like Protein Involved in Transcriptional Activation of Cyst Wall Protein 1 Gene in Giardia lamblia
J. Biol. Chem., March 23, 2007; 282(12): 8905 - 8914.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Hausmann, M. A. Altura, M. Witmer, S. M. Singer, H. G. Elmendorf, and S. Shuman
Yeast-like mRNA Capping Apparatus in Giardia lamblia
J. Biol. Chem., April 1, 2005; 280(13): 12077 - 12086.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
A. A. Best, H. G. Morrison, A. G. McArthur, M. L. Sogin, and G. J. Olsen
Evolution of Eukaryotic Transcription: Insights From the Genome of Giardia lamblia
Genome Res., August 1, 2004; 14(8): 1537 - 1547.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/30/27804    most recent
M303316200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Seshadri, V.
Right arrow Articles by Adam, R. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Seshadri, V.
Right arrow Articles by Adam, R. D.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement