Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M300671200 on May 23, 2003

J. Biol. Chem., Vol. 278, Issue 31, 28659-28667, August 1, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/31/28659    most recent
M300671200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Samoto, H.
Right arrow Articles by Ogata, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Samoto, H.
Right arrow Articles by Ogata, Y.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Prostaglandin E2 Stimulates Bone Sialoprotein (BSP) Expression through cAMP and Fibroblast Growth Factor 2 Response Elements in the Proximal Promoter of the Rat BSP Gene*

Hiroshi Samoto {ddagger} § , Emi Shimizu {ddagger} § , Yuko Matsuda-Honjyo {ddagger}, Ryoichiro Saito ||, Sumi Nakao § **, Muneyoshi Yamazaki § ||, Shunsuke Furuyama § {ddagger}{ddagger}, Hiroshi Sugiya § {ddagger}{ddagger}, Jaro Sodek §§ and Yorimasa Ogata {ddagger} § ¶¶

From the {ddagger}Periodontology, ||Endodontics, **Pharmacology, {ddagger}{ddagger}Physiology, and §Research Institute of Oral Science, Nihon University School of Dentistry at Matsudo, Chiba, 271-8587, Japan and the §§Canadian Institutes of Health Research Group in Matrix Dynamics, Faculty of Dentistry and Department of Biochemistry, Faculty of Medicine, University of Toronto, Toronto, Ontario M5S 3E2, Canada

Received for publication, January 21, 2003 , and in revised form, May 16, 2003.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMRNTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Bone sialoprotein (BSP), an early marker of osteoblast differentiation, has been implicated in the nucleation of hydroxyapatite during de novo bone formation. Prostaglandin E2 (PGE2) has anabolic effects on proliferation and differentiation of osteoblasts via diverse signal transduction systems. Because PGE2 increases the proportion of functional osteoblasts in fetal rat calvarial cell cultures, we investigated the regulation of BSP, as an osteoblastic marker, by PGE2. Treatment of rat osteosarcoma UMR 106 cells with 3 µM, 300 nM, and 30 nM PGE2 increased the steady state levels of BSP mRNA about 2.7-, 2.5-, and 2.4-fold after 12 h. From transient transfection assays, the constructs including the promoter sequence of nucleotides (nt) –116 to +60 (pLUC3) were found to enhance transcriptional activity 3.8- and 2.2-fold treated with 3 µM and 30 nM PGE2 for 12 h. 2-bp mutations were made in an inverted CCAAT box (between nt –50 and –46), a cAMP response element (CRE; between nt –75 and –68), a fibroblast growth factor 2 response element (FRE; nt –92 to –85), and a pituitary-specific transcription factor-1 motif (between nt –111 and –105) within pLUC3 and pLUC7 constructs. Transcriptional stimulation by PGE2 was almost completed abrogated in constructs that included 2-bp mutations in either the CRE and FRE. In gel shift analyses an increased binding of nuclear extract components to double-stranded oligonucleotide probes containing CRE and FRE was observed following treatment with PGE2. These studies show that PGE2 induces BSP transcription in UMR 106 cells through juxtaposed CRE and FRE elements in the proximal promoter of the BSP gene.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMRNTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Prostaglandins are considered important local factors that modulate bone metabolism through their effects on osteoblastic cells and osteoclasts (1, 2). Prostaglandin E2 (PGE2),1 a major eicosanoid produced by osteoblasts, is a potent stimulator of bone resorption (3) that can stimulate the formation of osteoclast-like multinuclear cells in mouse bone marrow cultures (4, 5). The effects of PGE2 on osteoclastogenesis are, at least in part, mediated by osteogenic cells, which express macrophage colony-stimulating factor (6) and receptor activator of nuclear factor {kappa}B ligand (RANKL) (7) that promote, and osteoprotegerin, a decoy receptor for RANKL (8), that suppresses osteoclast formation. PGE2 has been shown to stimulate RANKL and inhibit osteoprotegerin production (7, 9) and also increases production of interleukin-6, which can further enhance osteoclastogenesis (1012). In contrast, studies have revealed that PGE2 also has bone-forming activity (2, 13). Treatment of male, female, and overiectomized mice with PGE2 increases bone mass in vivo (14), whereas PGE2 stimulates collagen and DNA synthesis and induces bone growth in calvarial organ (15) and cell cultures in vitro (16, 17). However, PGE2 can either stimulate or inhibit cellular growth and differentiation of osteoblastic cells depending on PGE2 concentration (15, 18, 19).

To explain the diverse effects of PGE2, the presence of multiple receptors for PGE2 in osteoblasts was postulated. Recent cloning of four subtypes of the PGE receptor has made it possible to analyze the PGE receptor subtypes (EP1–EP4) on osteoblasts (3, 13). EP1 is coupled to Ca2+ mobilization, EP2 and EP4 activate adenylate cyclase, whereas EP3 inhibits adenylate cyclase (2022). An EP1 agonist stimulated cell growth and inhibited alkaline phosphatase activity, whereas an EP4 agonist reduced cell growth and increased alkaline phosphatase activity in MC3T3-E1 osteoblast-like cells (23). These studies indicate that osteoblasts express multiple subtypes of the PGE receptor and that each subtype is might be linked to different aspects of PGE2 action. Thus, activation of the EP4 receptor stimulates bone formation and prevents bone loss (24), whereas bone resorption by lipopolysaccharide is impaired in EP4 knockout mice (25). Collectively, these results show that PGE2 has anabolic effects on bone formation.

Bone sialoprotein (BSP) is a highly sulfated, phosphorylated, and glycosylated protein that is characterized by its ability to bind to hydroxyapatite through polyglutamic acid sequences and to mediate cell attachment through an RGD sequence (2628). The temporospatial deposition of BSP into the extracellular matrix (29, 30) and the ability of BSP to nucleate hydroxyapatite crystal formation (31) indicate a potential role for this protein in the initial mineralization of bone, dentin, and cementum. Recent studies have shown that BSP is also expressed by osteotropic cancers, suggesting that BSP might play a role in the pathogenesis of bone metastases (32, 33). Thus, regulation of the BSP gene appears to be important in the differentiation of osteoblasts, in bone matrix mineralization, and in tumor metastasis. The rat, human, and mouse BSP genes have been cloned and partially characterized (3437). These promoters include a functional inverted TATA element (nt –24 to –19) (38), which overlaps a vitamin D response element (39), and an inverted CCAAT box (–50 to –46), which is required for basal transcription (40, 41). In addition, a fibroblast growth factor 2 (FGF2) response element (FRE; –92 to –85) (42), a cAMP response element (CRE; –75 to –68) (43), a transforming growth factor-{beta} activation element (–499 to –485) (44), a pituitary-specific transcription factor-1 (Pit-1) motif (–111 to –105) that mediates the stimulatory effects of parathyroid hormone (45), and a homeodomain binding element (–199 to –192) (46) have been characterized. Further upstream, a glucocorticoid response element overlapping an AP-1 site (27, 47) has also been identified.

Because BSP is a marker of osteoblastic differentiation and bone formation, we have analyzed the effects of PGE2 on BSP expression in UMR 106 cells. Our studies show that PGE2 increases transcription of the BSP gene through cAMP-dependent protein kinase, tyrosine kinase, and MAP kinase pathways and that the effects are mediated via CRE and FRE transcriptional elements in the proximal promoter of the rat BSP gene.


    EXPERIMRNTAL PROCEDURES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMRNTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Materials—Cell culture media, fetal bovine serum, LipofectAMINE, penicillin and streptomycin, SuperScript one-step RT-PCR with Platinum Taq, and trypsin were obtained from Invitrogen. DyNAmo SYBR green qPCR Kit and Moloney murine leukemia virus reverse transcriptase RNase H were from Finnzymes (Espoo, Finland). The pGL2-Promoter, PGL3-Basic, pSV-{beta}-galactosidase control vector, recombinant RNasin, random hexamer, and MAP kinase kinase inhibitor U0126 were purchased from Promega. The protein kinase inhibitors H89 and H7 were from Seikagaku Corporation (Tokyo, Japan), and the tyrosine phosphatase inhibitor, sodium orthovanadate, the tyrosine kinase inhibitor, herbimycin A, and the serine-threonine phosphatase inhibitor okadaic acid were purchased from Wako Pure Chemical Industries, Ltd. (Tokyo, Japan). Forskolin was from Sigma. PP1 was from Biomol Research Laboratories, Inc. PGE2, prostaglandin E1 alcohol (EP2 and EP4 agonist), 17-phenyl trinor PGE2 (EP1 and EP3 agonist), and butaprost (EP2 agonist) were obtained from Cayman Chemical. EP3 agonist ONO-AP-324-01 was kindly provided by Ono Pharmaceutical Co., Ltd. (Osaka, Japan). All other chemicals were of analytical grade.

Cell Culture—The rat clonal cell line, UMR 106 cells (generously provided by Dr. T. J. Martin) were cultured at 37 °C in 5% CO2 air in {alpha}-minimum essential medium ({alpha}-MEM) supplemented with 10% fetal bovine serum and used in these studies as an osteoblastic cell line that synthesizes BSP (27, 48). Rat stromal bone marrow cells (49), were kindly provided by Dr. S. Pitaru (Tel Aviv University, Tel Aviv, Israel). The cells were first grown to confluence in 60-mm tissue culture dishes in {alpha}-MEM medium containing 10% fetal bovine serum, then cultured in {alpha}-MEM without serum, and incubated with prostaglandin E2. RNA was isolated from triplicate cultures and analyzed for expression of BSP mRNA by RT-PCR and real time PCR as described below.

RT-PCR and Real Time PCR—Following treatment total RNA was extracted from UMR 106 cells with guanidium thiocyanate at different times, as described previously (44), and 1 µg was used as a template for one-step RT-PCR and cDNA synthesis. cDNA was prepared using random hexamer and Moloney murine leukemia virus reverse transcriptase RNase H. Conventional one-step RT-PCR was performed using a SuperScript one-step RT-PCR kit. The primers were synthesized on the basis of the reported rat cDNA sequences for BSP and glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Sequences of the primers used for PCR were as follow: BSP forward, 5'-CTGCTTTAATCTTGCTCTG-3'; BSP reverse, 5'-CCATCTCCATTTTCTTCC-3'; GAPDH forward, 5'-CCATGTTTGTGATGGGTGTG-3'; and GAPDH reverse, 5'-GGATGCAGGGATGATGTTCT-3'. cDNA synthesis and predenaturation was performed for 1 cycle at 50 °C for 30 min and 94 °C for 2 min, and amplification was carried out for 30 (BSP and GAPDH) cycles at 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 30 s, and final extension was 94 °C for 10 min in a 50-µl reaction mixture. After amplification, 10 µl of each reaction mixture was analyzed by 2% agarose gel electrophoresis, and the bands were then visualized by ethidium bromide staining. The expected size of the PCR products for BSP and GAPDH were 211 and 264 bp, respectively. Quantitative real time PCR was performed using the following primer sets: BSP-R-T forward, 5'-TCCTCCTCTGAAACGGTTTCC-3'; BSP-R-T reverse, 5'-CGAACTATCGCCATCTCCATT-3'; GAPDH-R-T forward, 5'-AGATGGTGAAGGTCGGTGTC-3'; and GAPDH-R-T reverse, 5'-ATTGAACTTGCCGTGGGTAG-3' using the SYBR Green qPCR Kit in a DNA Engine Opticon 2 continuous fluorescence detection system (MJ Research Inc.). The expected size of the PCR products for BSP and GAPDH were 73 and 167 bp, respectively. The amplification reactions were performed in 20 µl of final volume containing 1x SYBR Green Master Mix, 0.25 µM primer mixture, and 10 ng of cDNA. To reduce variability between replicates, PCR premixes, which contain all of the reagents except for cDNA, were prepared and aliquoted into 0.2-ml thin wall strip tubes (MJ Research Inc.). The thermal cycling conditions were 40 cycles of the following protocol: 15 s of denaturation at 95 °C, 50 s of annealing at 64 °C, followed by 12 s of extension at 77 °C. Post-PCR melting curves confirmed the specificity of single-target amplification, and fold expression of BSP relative to GAPDH was determined in triplicate (50).

Transient Transfection Assays—Exponentially growing UMR 106 cells were used for transfection assays. 24 h after plating, the cells at 50~70% confluence were transfected using a LipofectAMINE reagent. The transfection mixture included 1 µg of a luciferase (LUC) construct (45) and 2 µg of pSV-{beta}-galactosidase vector as an internal transfection control. Two days post-transfection, the cells were deprived of serum for 12 h, and 3 µM or 30 nM PGE2 or 3 µM of the respective EP agonists were added for 12 h prior to harvesting. The luciferase assay was performed according to the supplier's protocol (picaGene; Toyo Inki) using a Luminescence reader BLR20 (Aloka) to measure the luciferase activity. The protein kinase inhibitorsH89 (5 µM) and H7 (5 µM) were used to inhibit protein kinase A and C. Herbimycin A (1 µM) and PP1 (10 µM) were used for tyrosine kinase and Src tyrosine kinase inhibition, respectively (42, 51). U0126 (5 µM) was used to inhibit MAP kinase kinase activity (52). Sodium orthovanadate (50 µM) and okadaic acid (50 nM) were used for tyrosine phosphatase and serine-threonine phosphatase inhibition, respectively (53, 54). Forskolin (1 µM) was used for activation of adenylate cyclase (45). Oligonucleotide-directed mutagenesis by PCR was utilized to introduce dinucleotide substitutions using the QuikChange site-directed mutagenesis kit (Stratagene). All of the constructs were sequenced as described previously (42) to verify the fidelity of the mutagenesis.

Gel Mobility Shift Assays—Confluent UMR 106 cells in T-75 flasks incubated for 6 and 12 h with 30 nM PGE2 in {alpha}-MEM without serum were used to prepare nuclear extracts. Nuclear protein was extracted by the method of Dignam et al. (55) with the addition of extra proteinase inhibitors (the extraction buffer was 0.42 M NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 1 mM dithiothreitol, 25% (v/v) glycerol, 0.5 mM phenylmethylsulfonyl fluoride, 2 µg/ml leupeptin, 2 µg/ml pepstatin A, 1 µg/ml aprotinin, pH 7.9). Protein concentration was determined by the Bradford assay (56). Double-stranded oligonucleotides encompassing the inverted CCAAT (nt –61 to –37, 5'-CCGTGACCGTGATTGGCTGCTGAGA), cAMP response element (CRE; nt –84 to –59, 5'-CCCACAGCCTGACGTCGCACCGGCCG), and FGF2 response element (FRE; nt –98 to –79, 5'-TTTTCTGGTGAGAACCCACA) in the BSP promoter were prepared by Bio-Synthesis, Inc., whereas consensus CRE (5'-AGAGATTGCCTGACGTCAGAGAGCTAG) was purchased from Promega. For gel shift analysis the double-stranded oligonucleotides were end-labeled with [{gamma}-32P]ATP and T4 polynucleotide kinase. Nuclear protein extracts (3 µg) were incubated for 20 min at room temperature (21 °C) with 0.1 pM radiolabeled double-stranded oligonucleotide in buffer containing 50 mM KCl, 0.5 mM EDTA, 10 mM Tris-HCl (pH 7.9), 1 mM dithiothreitol, 0.04% Nonidet P-40, 5% glycerol, and 1 µg of poly(dI-dC). Following incubation, the protein-DNA complexes were resolved by electrophoresis on 5% nondenaturing acrylamide gels (38:2 acrylamide/bis-acrylamide) run at 150 V at room temperature. For competition experiments unlabeled oligonucleotides for the CRE, mutation CRE (5'-CCCACAGCCcGACGcCGCACCGGCCG), FRE, and mutated FRE (5'-TTTTCTGGcaAGAACCCACA) were used at 20- and 40-fold molar excess. After electrophoresis, the gels were dried, and the autoradiograms were prepared and analyzed using an image analyzer. Supershift experiments were performed with 1–2 µl of antibodies (Santa Cruz Biotechnology) against CRE-binding protein (CREB-1; sc-58), c-Jun (sc-44), c-Fos (sc-253), Pit-1 (sc-442), Oct-1 (sc-232), NF{kappa}B p65 (sc-109), NF{kappa}B p50 (sc-7178), and phospho-CREB (Upstate Biotechnology, Inc.; 06-519) separately to each gel shift reaction. The extracts were incubated for 5 h at 4 °C with the appropriate antibody before electrophoresis was performed under the same conditions as described above.

[Ca2+]i Determination—Confluent cells were preincubated with 2 µM fura-2/acetoxymethylester in {alpha}-MEM for 30 min at 37 °C. After they were loaded with fura-2/acetoxymethylester, the cells were detached from tissue culture flasks with the trypsin-EDTA solution, washed twice, and suspended in fresh {alpha}-MEM. Just before [Ca2+]i determination, the cells were washed again and resuspended in Krebs-Ringer-HEPES solution (120 mM NaCl, 5 mM KCl, 1 mM MgSO4, 0.96 mM NaH2PO4, 0.2% glucose, 0.1% bovine serum albumin, 20 mM HEPES (pH 7.4), and 1 mM CaCl2). The fluorescence of fura-2-loaded cells was measured with a CAF-110 spectrofluorometer (Nihon Bunkou, Tokyo, Japan) with excitation at 340 and 380 nm and emission at 500 nm. [Ca2+]i was calculated from the measurement of the ratio of fluorescence intensities (57, 58). All of the experiments were performed three times with different cell batches.

Statistical Analysis—Triplicate samples were analyzed for each experiment, and the experiments were replicated to ensure consistency of the responses to PGE2. Significant differences between control and PGE2 treatment were determined using Student's t test.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMRNTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Stimulation of BSP mRNA Expression in UMR 106 Cells— BSP gene expression was investigated at 6 and 12 h after PGE2 stimulation by conventional (Fig. 1A) and real time PCR (Fig. 1B). When osteoblastic UMR 106 cells were exposed to 3 µM, 300 nM, and 30 nM PGE2, expression of BSP mRNA was increased 2.3-, 2.0-, and 2.2-fold at 6 h and 2.7-, 2.5-, and 2.4-fold at 12 h, respectively, as shown by conventional RT-PCR (Fig. 1A). To further confirm the PGE2 effects on BSP transactivation, we applied real time PCR to examine the mRNA expression level of BSP. As Fig. 1B shows, PGE2 (3 µM, 300 nM, and 30 nM) can induce the mRNA expression of BSP.



View larger version (28K):
[in this window]
[in a new window]
 
FIG. 1.
Effect of PGE2 on BSP mRNA levels. A, conventional RT-PCR for BSP gene expression in UMR 106 cells treated with 3 µM, 300 nM, and 30 nM PGE2 for 6 and 12 h. Total RNA was extracted, and the expression of BSP and GAPDH mRNAs in the cells were analyzed by one-step RT-PCR. The results were quantitated by densitometry and normalized to the expression of GAPDH. B, relative gene expression for BSP generated from real time PCR of UMR 106 cells treated with 3 µM, 300 nM, and 30 nM PGE2. The expression of GAPDH was also examined as control. The relative amounts of mRNA of BSP to GAPDH were calculated. The experiments were performed in triplicate for each data point, and the standard errors are shown as error bars. Significant differences compared with controls are shown at the following probability levels: #, p < 0.2; *, p < 0.1; **, p < 0,05; ****, p < 0.01.

 

Transient Transfection Analysis of Rat BSP Promoter Constructs—To determine the site of PGE2-regulated transcription in the 5'-flanking region of the BSP gene, various sized promoter constructs ligated to a luciferase reporter gene were transiently transfected into UMR 106 cells, and their transcriptional activity was determined in the presence of PGE2. With the construct pLUC3, encompassing BSP promoter nucleotides –116 to +60, transcription was increased 3.8-fold with 3 µM PGE2 and 2.2-fold with 30 nM PGE2 after 12 h of treatment (Fig. 2, A and B). PGE2 also increased transcription of pLUC4 (–425 to +60), pLUC5 (–801 to +60), pLUC6 (–938 to +60), and pLUC7 (–1149 to +60). In shorter constructs (pLUC1, –18 to +60; pLUC2, –43 to +60), luciferase activities were not increased by PGE2 (data not shown). When transcriptional activity in response to 30 nM PGE2 was analyzed in normal rat stromal bone marrow cells (49), the transcriptional activity of pLUC3 was increased 2-fold (Fig. 2C). Within the DNA sequence that is unique to pLUC3 (between nt–116 and –43), an inverted CCAAT box (ATTGG; between nt–50 and –46), CRE (between nt–75 and –68), FRE (between nt–92 and –85), and the Pit-1 motif (between nt–111 and –105) are present (Fig. 3).



View larger version (26K):
[in this window]
[in a new window]
 
FIG. 2.
PGE2 up-regulates BSP promoter activity in UMR-106 cells. A and B, transient transfections of UMR 106 cells in the presence or absence of PGE2 (A, 3 µM; B, 30 nM) for 12 h were used to determine transcriptional activity of chimeric constructs that included various regions of the BSP promoter ligated to a luciferase reporter gene. The results of transcriptional activity obtained from three separate transfections with constructs, pLUC basic (pLUCB) and pLUC3 to pLUC7, have been combined, and the values are expressed with standard errors. Significant differences compared with controls are shown at the following probability levels: #, p < 0.2; *, p < 0.1; **, p < 0.05; ***, p < 0.02; ****, p < 0.01. C, transient transfections of rat stromal bone marrow cells (SBMC) in the presence or absence of PGE2 (30 nM) for 12 h were used to determine transcriptional activity of chimeric constructs that included various regions of the BSP promoter ligated to a luciferase reporter gene. The results of transcriptional activity were obtained from three separate transfections with constructs; pLUC basic (pLUCB) and pLUC3 have been combined, and the values are expressed with standard errors. Significant difference compared with control at the p < 0.1 level is shown (*).

 


View larger version (23K):
[in this window]
[in a new window]
 
FIG. 3.
Regulatory elements in the proximal rat BSP promoter. The positions of the inverted TATA and CCAAT boxes, a CRE, a FRE, Pit-1, a homeobox-binding site (HOX), a transforming growth factor-{beta} activation element (TAE) overlapping with AP2, glucocorticoid response elements (GRE) overlapping the AP1, and a vitamin D response element (VDRE) that overlaps the inverted TATA box are shown in the proximal promoter region of the rat BSP gene. The numbering of nucleotides is relative to the transcription start site (+1).

 

Because PGE2 signaling activities are mediated by different protein kinases, we investigated the effects of the protein kinase C inhibitor H7 (5 µM), the cAMP-dependent protein kinase inhibitor H89 (5 µM), the tyrosine kinase inhibitor herbimycin A (1 µM), the Src kinase inhibitor PP1 (10 µM), and the MAP kinase kinase inhibitor U0126 (5 µM) on PGE2-mediated transcription to determine the signaling pathway. Whereas PGE2-induced pLUC3 promoter activation was inhibited by H89, herbimycin A, PP1, and U0126, no effect was observed for H7 (Fig. 4), indicating an involvement of cAMP-dependent protein kinase, tyrosine kinase (Src), and MAP kinases in mediating the effects on BSP transcription. To assay for the responsiveness of the BSP promoter to serine-threonine phosphorylation, tyrosine phosphorylation, or elevated intracellular cAMP level, we used the serine-threonine phosphatase inhibitor okadaic acid, tyrosine phosphatase inhibitor sodium orthovanadate, and also forskolin, which is known to stimulate an adenylate cyclase. Vanadate (50 µM) and forskolin (1 µM) stimulated pLUC3 promoter activity ~1.6- and ~1.7-fold, respectively, whereas okadaic acid (50 nM) was without effect (Fig. 5). Simultaneous stimulation with vanadate (50 µM) and PGE2 (3 µM) up-regulated pLUC3 promoter activity synergistically. However, a combination of forskolin and PGE2 increased pLUC3 transcription to the same level observed for PGE2 stimulation (Fig. 5).



View larger version (25K):
[in this window]
[in a new window]
 
FIG. 4.
Effect of kinase inhibitors on transcriptional activation by PGE2. Transient transfection analysis of pLUC3 in the presence or absence of PGE2 (3 µM) for 12 h in UMR 106 cells is shown together with the effects of the protein kinase C inhibitor (H7, 5 µM), cAMP-dependent protein kinase inhibitor (H89, 5 µM), tyrosine kinase inhibitor (herbimycin A, HA, 1 µM), Src kinase inhibitor (PP1, 10 µM), and MAP kinase kinase inhibitor (U0126, 5 µM). The results obtained from three separate transfections were combined, and the values are expressed with standard errors. Significant differences compared with controls are shown at the following probability levels: **, p < 0,05; ****, p < 0.01.

 


View larger version (20K):
[in this window]
[in a new window]
 
FIG. 5.
PGE2 and tyrosine phosphatase inhibitor (sodium orthovanadate) synergistically up-regulate BSP transcription. pLUC3 was analyzed for relative promoter activity after transfection into UMR 106 cells and examined for induction in the presence of okadaic acid (OKA, 50 nM), sodium orthovanadate (VANA, 50 µM), forskolin (FSK, 1 µM), and simultaneous stimulation of each reagent with PGE2 (3 µM). The results of transcriptional activity obtained from three separate transfections with constructs pLUCB and pLUC3 were combined, and the values are expressed with standard errors. Significant differences in the relative luciferase activities obtained with pLUC3 are indicated at the following probability levels: #, p < 0.2; **, p < 0,05; ***, p < 0.02.

 

To determine which PGE2 receptor subtype transduced the PGE2 effects on BSP transcription, the following receptor agonists were used in the transcription assays: 3 µM 17-phenyl trinor PGE2 (for EP1 and EP3), ONO-AP-324-01 (for EP3), butaprost (for EP2), and prostaglandin E1 alcohol (for EP2 and EP4) (Fig. 6). Butaprost and prostaglandin E1 alcohol stimulated pLUC3 promoter activity to a similar extent as PGE2, whereas no significant increase in transcription was observed with either 17-phenyl trinor and ONO-AP-324-01, indicating that PGE2 activates BSP transcription by a mechanism involving cAMP stimulation through EP2 and EP4 receptors.



View larger version (26K):
[in this window]
[in a new window]
 
FIG. 6.
Effect of PGE agonists on the BSP promoter activity. Transient transfection analysis of pLUC3 in the presence or absence of 3 µM PGE2, 17-phenyl trinor PGE2 (EP1 and EP3 agonist), ONO-AP-324-01 (EP3 agonist), butaprost (EP2 agonist), and prostaglandin E1 alcohol (EP2 and EP4 agonist) for 12 h in UMR 106 cells is shown. The results obtained from three separate transfections were combined, and the values are expressed with standard errors. Significant difference compared with controls is shown at the p < 0,05 level (**).

 

To determine the regulatory element(s) between nt–116 and –43 that is utilized by PGE2, a series of 5' deletion constructs were prepared. Transcription by constructs–116BSPLUC and –108BSPLUC was increased by PGE2, but no increase was seen with –84BSPLUC. These results indicated that the element responding to PGE2 was present between nt–108 and –85 in the BSP promoter (Fig. 7). Next we introduced mutations in the possible response elements encoded within nt–116 to +60 of pLUC3. In addition, we examined whether these sites function in the large promoter construct (nt –1149 to +60; pLUC7), as shown in Fig. 8. Whereas mutations in the Pit-1 had little effect on PGE2 stimulation and mutation of the CCAAT box essentially abolished basal expression, mutations of the CRE and especially the FRE significantly reduced the PGE2 effects on the transcriptional activities (Fig. 8). Furthermore, when both CRE and FRE sites were mutated, PGE2-induced luciferase activity was completely abolished (Fig. 8). These results suggest that the FRE and possibly the CRE are required as functional cis-elements for up-regulation of BSP transcription by PGE2.



View larger version (20K):
[in this window]
[in a new window]
 
FIG. 7.
Fine 5' deletion mapping of the nt–116 to –43 element in the BSP promoter. A series of rat BSP promoter 5' deletion constructs were analyzed for relative promoter activity after transfection into UMR 106 cells and examined for induction in the presence of PGE2 (3 µM) for 12 h. The results of transcriptional activity obtained from four separate transfections with constructs, –43 BSPLUC (–43 to +60), –60 BSPLUC (–60 to +60), –84 BSPLUC (–84 to +60), –108BSPLUC (–108 to +60), and –116 BSPLUC (–116 to +60), have been combined, and the values are expressed with standard errors. Significant differences compared with controls are shown at the following probability levels: *, p < 0.1; ***, p < 0.02.

 


View larger version (37K):
[in this window]
[in a new window]
 
FIG. 8.
Site mutation analysis of luciferase activities in response to PGE2. Dinucleotide substitutions were made within context of the homologous –116 to +60 (pLUC3) and –1149 to +60 (pLUC7) BSP promoter fragments. M-CCAAT (ATTtt), M-CRE (cGACGcCG), M-FRE (GGcaAGAA), M-PIT (TTacAGT), and double-mutated constructs (M-CRE and M-FRE) were analyzed for relative promoter activity after transfection into UMR 106 cells and examined for induction in the presence of PGE2 (A, 3 µM; B, 30 nM) for 12 h. The results of transcriptional activity obtained from three separate transfections with constructs were combined, and the values are expressed with standard errors. Significant differences compared with controls are shown at the following probability levels: #, p < 0.2; *, p < 0.1; **, p < 0.05; ****, p < 0.01.

 

Gel Mobility Shift Assays—To identify nuclear proteins whose binding to the CRE and FRE elements might be modulated by PGE2, double-stranded oligonucleotides were end-labeled and incubated with equal amounts (3 µg) of nuclear proteins extracted from confluent UMR 106 cells that were either not treated (control) or treated with 30 nM PGE2 for 6 and 12 h. When the CRE and FRE were used as probes, the formation of FRE-protein complexes (Fig. 9, lanes 4–6) and slowly migrating CRE-protein complexes were increased by PGE2 (Fig. 9, lanes 1–3). That these DNA-protein complexes represent specific interactions was demonstrated by competition experiments in which 20- and 40-fold molar excess of CRE and consensus CRE (Fig. 10, lanes 3, 4, 7, and 8) and FRE double-stranded oligonucleotides (Fig. 11, lanes 3 and 4) reduced by the amount of complex formation dose-dependently. In contrast, mutated CRE, FRE, and inverted CCAAT (Fig. 10, lanes 5, 6, and 9–12) and mutated FRE, CRE, consensus CRE, and inverted CCAAT oligonucleotides (Fig. 11, lanes 5–12) did not compete with CRE-protein and FRE-protein complex formation. To verify that the PGE2 was operating through CRE and FRE, we also used gel mobility shift analyses to evaluate the potential effects of PGE2 on the nearby inverted CCAAT and consensus CRE sites. When we used the inverted CCAAT sequence as a probe, the CCAAT-NF-Y protein complex (40, 41, 59) did not change after PGE2 stimulation (Fig. 12, lanes 1–3). In comparison, CRE binding was increased by PGE2 (Fig. 12, lanes 4–6). Notably, a stronger shift was obtained with the concensus CRE compared with the CRE in the proximal promoter of the BSP gene.



View larger version (36K):
[in this window]
[in a new window]
 
FIG. 9.
PGE2 up-regulates a nuclear protein that recognizes the CRE and FRE. Radiolabeled double-stranded CRE (84CCCACAGCCTGACGTCGCACCGGCCG59) and FRE oligonucleotides (–98TTTTCTGGTGAGAACCCACA79) were incubated for 20 min at 21 °C with nuclear protein extracts (3 µg) obtained from UMR 106 cells incubated without (lanes 1 and 4) or with PGE2 at 30 nM for 6 h (lanes 2 and 5) and 12 h (lanes 3 and 6). DNA-protein complexes were separated on 5% polyacrylamide gel in low ionic strength Tris borate buffer, dried under vacuum, and exposed to an imaging plate for quantitation using an image analyzer.

 


View larger version (60K):
[in this window]
[in a new window]
 
FIG. 10.
Specific binding of nuclear proteins to the CRE. Radiolabeled double-stranded CRE was incubated for 20 min at 21 °C with nuclear protein extracts (3 µg) obtained from UMR 106 cells stimulated in the absence (control; lane 1) or presence (lanes 2–12) of PGE2 (30 nM) for 12 h. Competition reactions were performed using a 20- and 40-fold molar excess of unlabeled CRE (84CCCACAGCCTGACGTCGCACCGGCCG59; lanes 3 and 4), mutation CRE (m-CRE; CCCACAGCCcGACGcCGCACCGGCCG; lanes 5 and 6), consensus CRE (AGAGATTGCCTGACGTCAGAGAGCTAG; lanes 7 and 8), FRE (98TTTTCTGGTGAGAACCCACA79; lanes 9 and 10), and inverted CCAAT (61CCGTGACCGTGATTGGCTGCTGAGA37; lanes 11 and 12). DNA-protein complexes were separated on 5% polyacrylamide gel in low ionic strength Tris borate buffer, dried under vacuum, and exposed to an imaging plate for quantitation using an imaging analyzer.

 


View larger version (48K):
[in this window]
[in a new window]
 
FIG. 11.
Specific binding of nuclear proteins to the FRE. Radiolabeled double-stranded FRE was incubated for 20 min at 21 °C with nuclear protein extracts (3 µg) obtained from UMR 106 cells stimulated in the absence (control; lane 1) or presence (lanes 2–12) of PGE2 (30 nM) for 12 h. Competition reactions were performed using a 20- and 40-fold molar excess of unlabeled FRE (98TTTTCTGGTGAGAACCCACA79; lanes 3 and 4), mutation FRE (m-FRE; TTTTCTGGcaAGAACCCACA; lanes 5 and 6), CRE (84CCCACAGCCTGACGTCGCACCGGCCG59; lanes 7 and 8), consensus CRE (AGAGATTGCCTGACGTCAGAGAGCTAG; lanes 9 and 10), and inverted CCAAT (61CCGTGACCGTGATTGGCTGCTGAGA37; lanes 11 and 12). DNA-protein complexes were separated on 5% polyacrylamide gel in low ionic strength Tris borate buffer, dried under vacuum, and exposed to an imaging plate for quantitation using an imaging analyzer.

 


View larger version (41K):
[in this window]
[in a new window]
 
FIG. 12.
Comparison of CCAAT and consensus CRE DNA-protein complexes. Radiolabeled double-stranded CCAAT oligonucleotide (–61CCGTGACCGTGATTGGCTGCTGAGA37) and consensus CRE (5'-AGAGATTGCCTGACGTCAGAGAGCTAG) were incubated with nuclear protein extracts (3 µg) obtained from UMR 106 cells incubated without (lanes 1 and 4) or with PGE2 at 30 nM for6h(lanes 2 and 5) and 12 h (lanes 3 and 6). DNA-protein complexes were separated on 5% polyacrylamide gel in low ionic strength Tris borate buffer, dried under vacuum, and exposed to an imaging plate for quantitation using an imaging analyzer. Control, nuclear extract from control confluent cells.

 

To further characterize the proteins in the complexes formed with the CRE and FRE, we used antibodies for several transcription factors. The addition of antibody to CREB disrupted the formation of the CRE DNA-protein complexes (Fig. 13, lane 4), whereas incubation of nuclear extracts with anti-phospho-CREB antibody produced a visible supershift complex (Fig. 13, lane 5). FRE-nuclear protein complex was not disrupted or supershifted by antibodies to CREB, c-Jun, c-Fos, Pit-1, Oct-1, NF{kappa}B p65, and NF{kappa}B p50 (data not shown).



View larger version (31K):
[in this window]
[in a new window]
 
FIG. 13.
Specific binding of nuclear proteins to the CRE. Radiolabeled double-stranded CRE oligonucleotide (84CCCACAGCCTGACGTCGCACCGGCCG59) was incubated with nuclear protein extracts (3 µg) obtained from UMR 106 cells incubated without (lane 1) or with PGE2 (30 nM, lanes 2–5) for 12 h. Supershift experiments were performed with 1–2 µl of antibodies against CREB-1 (lane 4) and phospho-CREB (lane 5) added separately to each gel shift reaction.

 


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMRNTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Prostaglandins are among the most potent regulators of bone cell function (4, 17). Extensive studies have demonstrated that PGE2 has both anabolic and catabolic effects on osteoblastic cells (13, 18). Although the effects on bone resorption are indirect, involving the expression of cytokines such as RANKL, which promote osteoclast formation (7), prostaglandins can directly stimulate osteoblastic cells to differentiate and form bone (2, 13). The expression of BSP, which is essentially specific to mineralized tissues and is expressed by newly formed osteoblasts coincident with mineralization, provides a valuable marker for osteogenic differentiation and bone formation (28). Our studies show that PGE2, consistent with its promoting osteogenesis, increases expression of BSP by activation of EP2 and EP4 receptors in UMR 106 cells. Transduction of the PGE2 signaling is mediated by cyclic AMP-dependent protein kinase A, Src tyrosine kinase, and MAP kinase, which target nuclear proteins that bind to CRE and FRE elements in the proximal promoter of the BSP gene.

Prostaglandins, acting through different cell surface receptors on osteoblastic cells, stimulate bone remodeling by promoting both anabolic and catabolic responses, the relative responses being dependent on the target cell population and the concentration of PGE2. In bone marrow cells, which are targets for the anabolic actions of PGE2 (60), PGE2 can stimulate both phospholipase C and adelylate cyclase pathways in osteoblasts (2, 10). The stimulation of phospholipase C results in the breakdown of phospholipid to form diacylglycerol, which activates protein kinase C (61), and inositol phosphates, which cause the release of intracellular concentration of free calcium ([Ca2+]i) (58). Although 3 µM PGE2 evoked an increase in [Ca2+]i in UMR 106 cells, 30 nM and lower concentrations of PGE2 could not induce [Ca2+]i (data not shown), suggesting that PGE2 stimulation of BSP transcription is independent of Ca2+ signaling. In contrast, stimulation of BSP transcription appears to utilize the cAMP-dependent protein-tyrosine kinase pathway because transcription is inhibited by herbimycin A and stimulated by vanadate and forskolin. Moreover, BSP transcription is mediated by EP2 and EP4 receptors (Fig. 6), through which cAMP production is stimulated (21). That transcription is suppressed by Src inhibitors to Src kinase and MAP kinase (Fig. 4) further implicates these enzymes in the signaling pathway.

BSP has been characterized as a unique marker of osteogenic differentiation that can regulate the formation of mineral crystals (28). In this study, we have identified response elements in the BSP gene promoter that mediate the PGE2 action on BSP transcription. In UMR 106 cells, PGE2 (3 µM and 30 nM) stimulated BSP promoter activity (pLUC3) ~3.8- and 2.2-fold (Fig. 2, A and B), comparable with the increase in BSP mRNA levels of ~2.7- and 2.4-fold by conventional RT-PCR (Fig. 1A) and ~3.6- and 3.7-fold by real time PCR (Fig. 1B). PGE2 also induced BSP transcription in stromal bone marrow cells (Fig. 2C), indicating that the increased BSP expression occurs in normal osteoprogenitor cells and is not a specific feature of transformed UMR 106 cells. From transient transfection assays we initially located the PGE2-responsive region to the proximal promoter (nt–116 and –43; Fig. 2) of the BSP gene, which encompasses an inverted CCAAT box (nt–50 and –46), a putative CRE (nt–75 and –68), a FGF2 response element (FRE; nt–92 and –85), and a Pit-1 (nt–111 and –105) motif (Fig. 3). The results of luciferase analyses using fine 5' deletion constructs between nt–116 to –43 in the BSP promoter show that the PGE2 effects are targeted to a region encompassed by nt–108 and –43 (Fig. 7). Whereas mutation of the Pit-1 element was without effect, mutation of the CCAAT element resulted in the loss of basal transcriptional activity, as reported previously (40, 43). As a consequence the involvement of the inverted CCAAT was difficult to ascertain. However, the lack of PGE2-induced transcription with constructs –84BSPLUC and –60BSPLUC (Fig. 7) indicate that the CCAAT is not a target of PGE2 regulation. In comparison, mutations in the CRE and FRE sites suggest that they are required for the induction of BSP expression by the PGE2. The involvement of the FRE and CRE elements is further supported by EMSA analyses in which proteins from nuclear extracts formed complexes with the FRE and CRE elements that were increased by PGE2 (Fig. 9). However, although the luciferase assays show a much reduced PGE2-stimulated transcription when the individual CRE and FRE sites are mutated and the combined mutations show total abrogation, the formation of CRE-nuclear factor complexes is weak compared with results obtained with a concensus CRE (Figs. 9 and 12). Moreover, there is no significant increase in transcription with the –84BSPLUC construct (Fig. 7), which omits the FRE but retains the CRE element. In comparison, the FRE clearly shows increased binding of the nuclear protein in response to PGE2. Thus, our studies suggest that transcriptional activation is mediated by the juxtaposed FRE and CRE elements, with the FRE being the predominant target of the PGE2 effects.

Although the CRE element binding of nuclear protein was not strong, the binding protein was, nevertheless up-regulated by PGE2 (Fig. 9) and could be identified as CREB by antibody interference (Fig. 13). Moreover, phosphorylation of the CREB was induced by PGE2 (Fig. 13). Although cAMP-dependent protein kinase signaling does not affect CREB binding to its cognate CRE element, it can direct phosphorylation of CREB, which is required for transcriptional activation (62, 63). In comparison, the nuclear factor binding to the FRE element, which is regulated by tyrosine kinase, has yet to be characterized and is the focus of current studies because of its potential role in regulating basal and FGF2-induced transcription of BSP in osteoblasts (42), as well as mediating the PGE2 effects.

The molecular pathways of PGE2 regulation of BSP gene transcription are identified in these studies. PGE2 acting through EP2 and EP4 prostaglandin receptors on osteoblastic cells activates signaling pathways involving cAMP generation and tyrosine phosphorylation (protein-tyrosine kinase), which activate MAP kinase to phosphorylate CREB and thereby transactivate BSP transcription through the CRE. Whether this same pathway also activates the FRE response through the same or a linked pathway or whether there is a concerted action on the CRE and FRE through a single pathway is difficult to discern at this time because the FRE-binding nuclear protein is yet to be characterized.

In conclusion, our study has identified CRE and FRE elements in the rat BSP proximal promoter that mediate BSP transcription induced by PGE2 and that the PGE2 increases the nuclear protein binding activities of CRE and FRE and enhances CREB phosphorylation. Because BSP is expressed by differentiated osteoblasts and PGE2 is a crucial factor for bone metabolism, it is conceivable that these two response elements may contribute to the cell-specific expression of the BSP gene during the formation of the mineralized extracellular matrix of bone.


    FOOTNOTES
 
* This work was supported in part by Grants-in-aid for Scientific Research 09771650, 12671865, 14571988, and 14571989 from the Ministry of Education, Science, and Culture of Japan, by Nihon University Multidisciplinary Research Grant for 2002 and 2003, by a Suzuki Memorial Grant of Nihon University School of Dentistry at Matsudo (General Individual Research Grant for 2002 and Research Grant for Assistants for 2003), and by a Grant from the Ministry of Education, Culture, Sports, Science, and Technology to promote the 2001 Multidisciplinary Research Project. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

These authors contributed equally to this work. Back

¶¶ To whom correspondence should be addressed: Dept. of Periodontology, Nihon University School of Dentistry at Matsudo, Chiba, 271-8587, Japan. Tel.: 81-47-360-9362; Fax: 81-47-360-9362; E-mail: ogata{at}mascat.nihon-u.ac.jp.

1 The abbreviations used are: PGE2, prostaglandin E2; BSP, bone sialoprotein; CRE, cyclic AMP response element; CREB, cAMP response element-binding protein; LUC, luciferase; FRE, FGF2 response element; nt, nucleotide(s); MAP, mitogen-activated protein; Pit-1, pituitary-specific transcription factor-1; FGF2, fibroblast growth factor 2; RANKL, receptor activator of nuclear factor {kappa}B ligand; RT, reverse transcription; {alpha}-MEM, {alpha}-minimum essential medium; GAPDH, glyceraldehyde-3-phosphate dehydrogenase. Back



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMRNTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Hakeda, Y., Nakatani, Y., Hiramatsu, M., Kurihara, N., Tsunoi, M., Ikeda, E., and Kumegawa, M. (1985) J. Biochem. (Tokyo) 97, 97–104[Abstract/Free Full Text]
  2. Kaneki, H., Takasugi, I., Fujieda, M., Kiriu, M., Mizuoch, S., and Ide, H. (1999) J. Cell. Biochem. 73, 36–48[CrossRef][Medline] [Order article via Infotrieve]
  3. Suzawa, T., Miyaura, C., Inada, M., Maruyama, T., Sugimoto, Y., Ushikubo, F., Ichikaw, a A., Narumiya, S., and Suda, T. (2000) Endocrinology 141, 1554–1559[Abstract/Free Full Text]
  4. Akatsu, T., Takahashi, N., Debari, K., Morita, I., Murota, S., Nagata, N., Takatani, O., and Suda, T. (1989) J. Bone Miner. Res. 4, 29–35[Medline] [Order article via Infotrieve]
  5. Li, X., Okada, Y., Pilbeam, C. C., Lorenzo, J. A., Kennedy, C. R. J., Breyer, R. M., and Raisz, L. G. (2000) Endocrinology 141, 2054–2061[Abstract/Free Full Text]
  6. Hattersley, G., Owens, J., Flanagan, A. M., and Chambers, T. J. (1991) Biochem. Biophys. Res. Commun. 177, 526–531[CrossRef][Medline] [Order article via Infotrieve]
  7. Yasuda, H., Shima, N., Nakagawa, N., Yamaguchi, K., Kinisaki, M., Mochizuki, S., Tomoyasu, A., Yano, K., Goto, M., Murakami, A., Tsuda, E., Morinaga, T., Higashio, K., Udagawa, N., Takahashi, N., and Suda, T. (1998) Proc. Natl. Acad. U. S. A. 95, 3597–3602[Abstract/Free Full Text]
  8. Simonet, W. S., Lacey, D. L., Dunstan, C. R., Kelley, M., Chang, M. S., Luthy, R., Nguyen, H. Q., Wooden, S., Bennett, L., Boone, T., Shimamoto, G., DeRose, M., Elliott, R., Colombero, A., Tan, H. L., Trail, G., Sullivan, J., Davy, E., Bucay, N., Renshaw-Gegg, L., Hughes, T. M., Hill, D., Pattison, W., Campbell, P., Sander, S., Van, G., Tarpley, J., Derby, P., and Lee, R. (1997) Cell 89, 309–319[CrossRef][Medline] [Order article via Infotrieve]
  9. Kanematsu, M., Sato, T., Takai, H., Watanabe, K., Ikeda, K., and Yamada, Y. (2000) J. Bone Miner. Res. 15, 1321–1329[CrossRef][Medline] [Order article via Infotrieve]
  10. Kozawa, O., Suzuki, A., Tokuda, H., Kaida, T., and Uematsu, T. (1998) Bone 22, 355–360[Medline] [Order article via Infotrieve]
  11. Millet, I., Mccarthy, T. L., and Vignery, A. (1998) J. Bone Miner. Res. 13, 1092–1100[CrossRef][Medline] [Order article via Infotrieve]
  12. Gruber, R., Nothegger, G., Ho, G., Willheim, M., and Peterlik, M. (2000) Biochem. Biophys. Res. Commun. 270, 1080–1085[CrossRef][Medline] [Order article via Infotrieve]
  13. Weinreb, M., Machwate, M., Shir, N., Abramovitz, M. Rodan, G. A., and Harada, S. (2001) Bone 28, 275–281[Medline] [Order article via Infotrieve]
  14. Opas, E. E., Gentile, M. A., Rossert, J. A., de Crombrugghe, B., Rodan, G. A., and Schmidt, A. (2000) Bone 26, 27–32[Medline] [Order article via Infotrieve]
  15. Raisz, L. G., and Fall, P. M. (1990) Endocrinology 126, 1654–1659[Abstract/Free Full Text]
  16. Flanagan, A. M., and Chambers, T. J. (1992) Endocrinology 130, 443–448[Abstract/Free Full Text]
  17. Nagata, T., Kaho, K., Nishikawa, S., Shinihara, H., Wakano, Y., and Ishida, H. (1994) Calcif. Tissue Int. 55, 451–457[CrossRef][Medline] [Order article via Infotrieve]
  18. Raisz, L. G., Fall, P. M., Petersem, D. N., Lichtler, A., and Kream, B. E. (1993) Mol. Endocrinol. 7, 17–22[Abstract/Free Full Text]
  19. Fall, P. M., Breault, D. T., and Raisz, L. G. (1994) J. Bone Miner. Res. 9, 1935–1943[Medline] [Order article via Infotrieve]
  20. Watabe, A., Sugimoto, Y., Honda, A., Irie, A., Namba, T., Negishi, M., Ito, S., Narumiya, S., and Ichikawa, A. (1993) J. Biol. Chem. 268, 20175–20178[Abstract/Free Full Text]
  21. Katsuyama, M., Nishigaki, N., Sugimoto, Y., Morimoto, K., Negishi, M., Narumiya, S., and Ichikawa, A. (1995) FEBS Lett. 372, 151–156[CrossRef][Medline] [Order article via Infotrieve]
  22. Sugimoto, Y., Namba, T., Honda, A., Hayashi, Y., Negishi, M., Ichikawa, A., and Narumiya, S. (1992) J. Biol. Chem. 267, 6463–6466[Abstract/Free Full Text]
  23. Suda, M., Tanaka, K., Natsui, K., Usui, T., Tanaka, I., Fukushima, M., Shigeno, C., Konishi, J., Narumiya, S., Chikawa, A., and Nakao, K. (1996) Endocrinology 137, 1698–1705[Abstract]
  24. Yoshida, K., Oida, H., Kobayashi, T., Maruyama, T., Tanaka, M., Katayama, T., Yamaguchi, K., Segi, E., Tsuboyama, T., Matsushita, M., Ito, K., Ito, Y., Sugimoto, Y., Ushikubo, F., Ohchida, S., Kondo, K., Nakamura, T., and Narumiya, S. (2002) Proc. Natl. Acad. U. S. A. 99, 4580–4585[Abstract/Free Full Text]
  25. Sakuma, Y., Tanaka, K., Suda, M., Komatsu, Y., Yasoda, A., Miura, M., Ozawa, A., Narumiya, S., Sugimoto, Y., Ichikawa, A., Ushikubo, F., and Nakao, K. (2000) Infect. Immun. 68, 6819–6825[Abstract/Free Full Text]
  26. Oldberg, Å., Franzén, A., and Heinegård, D. (1988) J. Biol. Chem. 263, 19430–19432[Abstract/Free Full Text]
  27. Ogata, Y., Yamauchi, M., Kim, R. H., Li, J. J., Freedman, L. P., and Sodek, J. (1995) Eur. J. Biochem. 230, 183–192[Medline] [Order article via Infotrieve]
  28. Ganss, B., Kim, R. H., and Sodek, J. (1999) Crit. Rev. Oral Biol. Med. 10, 79–98[Abstract/Free Full Text]
  29. Chen, J., Shapiro, H. S., Wrana, J. L., Reimer, S., Heersche, J. N. M., and Sodek, J. (1991) Matrix 11, 133–143[Medline] [Order article via Infotrieve]
  30. Chen, J., Shapiro, H. S., and Sodek, J. (1992) J. Bone Miner. Res. 7, 987–997[Medline] [Order article via Infotrieve]
  31. Hunter, G. K., and Goldberg, H. A. (1993) Proc. Nathl. Acad. Sci. U. S. A. 90, 8562–8565[Abstract/Free Full Text]
  32. Waltregny, D., Bellahcène, A., de Leval, X., Florkin, B., Weidle, U., and Castronovo, V. (2000) J. Bone Miner. Res. 15, 834–843[CrossRef][Medline] [Order article via Infotrieve]
  33. Ibrahim, T., Leong, I., Sanchez-Sweatman, O., Khokha, R., Sodek, J., Tenenbaum, H. C., Ganss, B., and Cheifetz, S. (2000) Clin. Exp. Metastasis 18, 253–260[CrossRef][Medline] [Order article via Infotrieve]
  34. Li, J. J., and Sodek, J. (1993) Biochem. J. 289, 625–629[Medline] [Order article via Infotrieve]
  35. Kerr, J. M., Fisher, L. W., Termine, J. D., Wang, M. G., Mcbride, O. W., and Young, M. F. (1993) Genomics 17, 408–415[CrossRef][Medline] [Order article via Infotrieve]
  36. Kim, R. H., Shapiro, H. S., Li, J. J., Wrana, J. L., and Sodek, J. (1994) Matrix Biol. 14, 31–40[CrossRef][Medline] [Order article via Infotrieve]
  37. Benson, M. D., Aubin, J. E., Xiao, G., Thomas, P. E., and Franceschi, R. T. (1999) J. Bone Miner. Res. 14, 396–405[CrossRef][Medline] [Order article via Infotrieve]
  38. Li, J. J., Kim, R. H., and Sodek, J. (1995) Biochem. J. 310, 33–40[Medline] [Order article via Infotrieve]
  39. Kim, R. H., Li, J. J., Ogata, Y., Yamauchi, M., Freedman, L. P., and Sodek, J. (1996) Biochem. J. 318, 219–226[Medline] [Order article via Infotrieve]
  40. Kim, R. H., and Sodek, J. (1999) Cancer Res. 59, 565–571[Abstract/Free Full Text]
  41. Shimizu, E., and Ogata, Y. (2002) J. Cell. Biochem. 86, 35–44[CrossRef][Medline] [Order article via Infotrieve]
  42. Shimizu-Sasaki, E., Yamazaki, M., Furuyama, S., Sugiya, H., Sodek, J., and Ogata, Y. (2001) J. Biol. Chem. 276, 5459–5466[Abstract/Free Full Text]
  43. Samoto, H., Shimizu, E., Matsuda-Honjyo, Y., Saito, R., Yamazaki, M., Kasai, K., Furuyama, S., Sugiya, H., Sodek, J., and Ogata, Y. (2002) J. Cell. Biochem. 87, 313–323[CrossRef][Medline] [Order article via Infotrieve]
  44. Ogata, Y., Niisato, N., Furuyama, S., Cheifetz, S., Kim, R. H., Sugiya, H., and Sodek, J. (1997) J. Cell. Biochem. 65, 501–512[CrossRef][Medline] [Order article via Infotrieve]
  45. Ogata, Y., Nakao, S., Kim, R. H., Li, J. J., Furuyama, S., Sugiya, H., and Sodek, J. (2000) Matrix Biol. 19, 395–407[CrossRef][Medline] [Order article via Infotrieve]
  46. Benson, M. D., Bargeon, J. L., Xiao, G., Thomas, P. E., Kim, A., Cui, Y., and Franceschi, R. T. (2000) J. Biol. Chem. 275, 13907–13917[Abstract/Free Full Text]
  47. Yamauchi, M., Ogata, Y., Kim, R. H., Li, J. J., Freedman, L. P., and Sodek, J. (1996) Matrix Biol. 15, 119–130[CrossRef][Medline] [Order article via Infotrieve]
  48. Partridge, N. C. Alcorn, D., Michelangeli, V. P., Ryan, G., and Martin, T. J. (1983) Cancer Res. 43, 4308–4314[Abstract/Free Full Text]
  49. Pitaru, S., Kotev-Emeth, S., Noff, D., Kaffuler, S., and Savion, N. (1993) J. Bone Miner. Res. 8, 919–929[Medline] [Order article via Infotrieve]
  50. Muller, P. Y., Janovjak, H., Miserez A. R., and Dobbie Z. (2002) BioTechniques 32, 1372–1379[Medline] [Order article via Infotrieve]
  51. Hanke, J. H., Gardner, J. P., Dow, R. L. Changelian, P. S., Brissette, W. H., Weringer, E. J., Pollok, B. A., and Connelly, P. A. (1996) J. Biol. Chem. 271, 695–701[Abstract/Free Full Text]
  52. Favata, M. F., Horiuchi, K. Y., Manos, E. J., Daulerio, A. J., Stradley, D. A., Feeser, W. S., Van Dyke, D. E., Pitts, W. J., Earl, R. A., Hobbs, F., Copeland, R. A., Magolda, R. L., Scherle, P. A., and Trzaskos, J. M. (1998) J. Biol. Chem. 273, 18623–18632[Abstract/Free Full Text]
  53. Nakao, S., Ogata, Y., Shimizu-Sasaki, E., Yamazaki, M. Furuyama, S., and Sugiya, H. (2000) Mol. Cell. Biochem. 209, 113–118[CrossRef][Medline] [Order article via Infotrieve]
  54. Newberry, E. P., Boudreaux, J. M., and Towler, D. A. (1996) Mol. Endocrinol. 10, 1029–1040[Abstract/Free Full Text]
  55. Dignam, J. D., Lebovitz, R. M., and Roeder, R. G. (1993) Nucleic Acids Res. 11, 1475–1489[CrossRef]
  56. Bradford, M. M. (1976) Anal. Biochem. 72, 248–254[CrossRef][Medline] [Order article via Infotrieve]
  57. Grynkiewicz, G., Poenie, M., and Tsien, R. Y. (1985) J. Biol. Chem. 260, 3440–3450[Abstract/Free Full Text]
  58. Niisato, N., Ogata, Y., Furuyama, S., and Sugiya, H. (1996) Biochem. Pharacol. 52, 1015–1023[CrossRef]
  59. Tezuka, K., Denhardt, D. T., Rodan, G. A., and Harada, S. (1996) J. Biol. Chem. 271, 22713–22717[Abstract/Free Full Text]
  60. Scutt, A., and Bertram, P. (1995) J. Bone Miner. Res. 10, 474–487[Medline] [Order article via Infotrieve]
  61. Berridge, M. J. (1984) Biochem. J. 220, 345–360[Medline] [Order article via Infotrieve]
  62. Lee, C. Q., Yun, Y. D., Hoeffler, J. P., and Habener, J. F. (1990) EMBO J. 9, 4455–4465[Medline] [Order article via Infotrieve]
  63. Pearman, A. T., Chou, W., Bergman, K. D., Pulumati, M. R., and Partridge, N. C. (1996) J. Biol. Chem. 271, 25715–25721[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
S. M. S. Miguel, M. Namdar-Attar, T. Noh, B. Frenkel, and I. Bab
ERK1/2-activated de Novo Mapkapk2 Synthesis Is Essential for Osteogenic Growth Peptide Mitogenic Signaling in Osteoblastic Cells
J. Biol. Chem., November 11, 2005; 280(45): 37495 - 37502.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C.-H. Tang, R.-S. Yang, and W.-M. Fu
Prostaglandin E2 Stimulates Fibronectin Expression through EP1 Receptor, Phospholipase C, Protein Kinase C{alpha}, and c-Src Pathway in Primary Cultured Rat Osteoblasts
J. Biol. Chem., June 17, 2005; 280(24): 22907 - 22916.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
W.-C. Huang, Z. Xie, H. Konaka, J. Sodek, H. E. Zhau, and L. W.K. Chung
Human Osteocalcin and Bone Sialoprotein Mediating Osteomimicry of Prostate Cancer Cells: Role of cAMP-Dependent Protein Kinase A Signaling Pathway
Cancer Res., March 15, 2005; 65(6): 2303 - 2313.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Salih and R. Fluckiger
Complete Topographical Distribution of Both the in Vivo and in Vitro Phosphorylation Sites of Bone Sialoprotein and Their Biological Implications
J. Biol. Chem., May 7, 2004; 279(19): 19808 - 19815.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/31/28659    most recent
M300671200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Samoto, H.
Right arrow Articles by Ogata, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Samoto, H.
Right arrow Articles by Ogata, Y.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement