Originally published In Press as doi:10.1074/jbc.M300671200 on May 23, 2003
J. Biol. Chem., Vol. 278, Issue 31, 28659-28667, August 1, 2003
Prostaglandin E2 Stimulates Bone Sialoprotein (BSP) Expression through cAMP and Fibroblast Growth Factor 2 Response Elements in the Proximal Promoter of the Rat BSP Gene*
Hiroshi Samoto
¶,
Emi Shimizu
¶,
Yuko Matsuda-Honjyo
,
Ryoichiro Saito ||,
Sumi Nakao
**,
Muneyoshi Yamazaki
||,
Shunsuke Furuyama

,
Hiroshi Sugiya

,
Jaro Sodek 
and
Yorimasa Ogata
¶¶
From the
Periodontology,
||Endodontics,
**Pharmacology,

Physiology, and
Research Institute of Oral Science, Nihon
University School of Dentistry at Matsudo, Chiba, 271-8587, Japan and the

Canadian Institutes of Health Research
Group in Matrix Dynamics, Faculty of Dentistry and Department of Biochemistry,
Faculty of Medicine, University of Toronto, Toronto, Ontario M5S 3E2,
Canada
Received for publication, January 21, 2003
, and in revised form, May 16, 2003.
 |
ABSTRACT
|
|---|
Bone sialoprotein (BSP), an early marker of osteoblast differentiation, has
been implicated in the nucleation of hydroxyapatite during de novo
bone formation. Prostaglandin E2 (PGE2) has anabolic
effects on proliferation and differentiation of osteoblasts via diverse signal
transduction systems. Because PGE2 increases the proportion of
functional osteoblasts in fetal rat calvarial cell cultures, we investigated
the regulation of BSP, as an osteoblastic marker, by PGE2.
Treatment of rat osteosarcoma UMR 106 cells with 3 µM, 300
nM, and 30 nM PGE2 increased the steady state
levels of BSP mRNA about 2.7-, 2.5-, and 2.4-fold after 12 h. From transient
transfection assays, the constructs including the promoter sequence of
nucleotides (nt) 116 to +60 (pLUC3) were found to enhance
transcriptional activity 3.8- and 2.2-fold treated with 3 µM and
30 nM PGE2 for 12 h. 2-bp mutations were made in an
inverted CCAAT box (between nt 50 and 46), a cAMP response
element (CRE; between nt 75 and 68), a fibroblast growth factor
2 response element (FRE; nt 92 to 85), and a pituitary-specific
transcription factor-1 motif (between nt 111 and 105) within
pLUC3 and pLUC7 constructs. Transcriptional stimulation by PGE2 was
almost completed abrogated in constructs that included 2-bp mutations in
either the CRE and FRE. In gel shift analyses an increased binding of nuclear
extract components to double-stranded oligonucleotide probes containing CRE
and FRE was observed following treatment with PGE2. These studies
show that PGE2 induces BSP transcription in UMR 106 cells through
juxtaposed CRE and FRE elements in the proximal promoter of the BSP gene.
 |
INTRODUCTION
|
|---|
Prostaglandins are considered important local factors that modulate bone
metabolism through their effects on osteoblastic cells and osteoclasts
(1,
2). Prostaglandin E2
(PGE2),1 a
major eicosanoid produced by osteoblasts, is a potent stimulator of bone
resorption (3) that can
stimulate the formation of osteoclast-like multinuclear cells in mouse bone
marrow cultures (4,
5). The effects of
PGE2 on osteoclastogenesis are, at least in part, mediated by
osteogenic cells, which express macrophage colony-stimulating factor
(6) and receptor activator of
nuclear factor
B ligand (RANKL)
(7) that promote, and
osteoprotegerin, a decoy receptor for RANKL
(8), that suppresses osteoclast
formation. PGE2 has been shown to stimulate RANKL and inhibit
osteoprotegerin production (7,
9) and also increases
production of interleukin-6, which can further enhance osteoclastogenesis
(1012).
In contrast, studies have revealed that PGE2 also has bone-forming
activity (2,
13). Treatment of male,
female, and overiectomized mice with PGE2 increases bone mass
in vivo (14), whereas
PGE2 stimulates collagen and DNA synthesis and induces bone growth
in calvarial organ (15) and
cell cultures in vitro
(16,
17). However, PGE2
can either stimulate or inhibit cellular growth and differentiation of
osteoblastic cells depending on PGE2 concentration
(15,
18,
19).
To explain the diverse effects of PGE2, the presence of multiple
receptors for PGE2 in osteoblasts was postulated. Recent cloning of
four subtypes of the PGE receptor has made it possible to analyze the PGE
receptor subtypes (EP1EP4) on osteoblasts
(3,
13). EP1 is coupled to
Ca2+ mobilization, EP2 and EP4 activate adenylate
cyclase, whereas EP3 inhibits adenylate cyclase
(2022).
An EP1 agonist stimulated cell growth and inhibited alkaline phosphatase
activity, whereas an EP4 agonist reduced cell growth and increased alkaline
phosphatase activity in MC3T3-E1 osteoblast-like cells
(23). These studies indicate
that osteoblasts express multiple subtypes of the PGE receptor and that each
subtype is might be linked to different aspects of PGE2 action.
Thus, activation of the EP4 receptor stimulates bone formation and prevents
bone loss (24), whereas bone
resorption by lipopolysaccharide is impaired in EP4 knockout mice
(25). Collectively, these
results show that PGE2 has anabolic effects on bone formation.
Bone sialoprotein (BSP) is a highly sulfated, phosphorylated, and
glycosylated protein that is characterized by its ability to bind to
hydroxyapatite through polyglutamic acid sequences and to mediate cell
attachment through an RGD sequence
(2628).
The temporospatial deposition of BSP into the extracellular matrix
(29,
30) and the ability of BSP to
nucleate hydroxyapatite crystal formation
(31) indicate a potential role
for this protein in the initial mineralization of bone, dentin, and cementum.
Recent studies have shown that BSP is also expressed by osteotropic cancers,
suggesting that BSP might play a role in the pathogenesis of bone metastases
(32,
33). Thus, regulation of the
BSP gene appears to be important in the differentiation of osteoblasts, in
bone matrix mineralization, and in tumor metastasis. The rat, human, and mouse
BSP genes have been cloned and partially characterized
(3437).
These promoters include a functional inverted TATA element (nt 24 to
19) (38), which
overlaps a vitamin D response element
(39), and an inverted CCAAT
box (50 to 46), which is required for basal transcription
(40,
41). In addition, a fibroblast
growth factor 2 (FGF2) response element (FRE; 92 to 85)
(42), a cAMP response element
(CRE; 75 to 68)
(43), a transforming growth
factor-
activation element (499 to 485)
(44), a pituitary-specific
transcription factor-1 (Pit-1) motif (111 to 105) that mediates
the stimulatory effects of parathyroid hormone
(45), and a homeodomain
binding element (199 to 192)
(46) have been characterized.
Further upstream, a glucocorticoid response element overlapping an AP-1 site
(27,
47) has also been
identified.
Because BSP is a marker of osteoblastic differentiation and bone formation,
we have analyzed the effects of PGE2 on BSP expression in UMR 106
cells. Our studies show that PGE2 increases transcription of the
BSP gene through cAMP-dependent protein kinase, tyrosine kinase, and MAP
kinase pathways and that the effects are mediated via CRE and FRE
transcriptional elements in the proximal promoter of the rat BSP gene.
 |
EXPERIMRNTAL PROCEDURES
|
|---|
MaterialsCell culture media, fetal bovine serum,
LipofectAMINE, penicillin and streptomycin, SuperScript one-step RT-PCR with
Platinum Taq, and trypsin were obtained from Invitrogen. DyNAmo SYBR
green qPCR Kit and Moloney murine leukemia virus reverse transcriptase RNase
H were from Finnzymes (Espoo, Finland). The pGL2-Promoter,
PGL3-Basic, pSV-
-galactosidase control vector, recombinant RNasin,
random hexamer, and MAP kinase kinase inhibitor U0126 were purchased from
Promega. The protein kinase inhibitors H89 and H7 were from Seikagaku
Corporation (Tokyo, Japan), and the tyrosine phosphatase inhibitor, sodium
orthovanadate, the tyrosine kinase inhibitor, herbimycin A, and the
serine-threonine phosphatase inhibitor okadaic acid were purchased from Wako
Pure Chemical Industries, Ltd. (Tokyo, Japan). Forskolin was from Sigma. PP1
was from Biomol Research Laboratories, Inc. PGE2, prostaglandin
E1 alcohol (EP2 and EP4 agonist), 17-phenyl trinor PGE2
(EP1 and EP3 agonist), and butaprost (EP2 agonist) were obtained from Cayman
Chemical. EP3 agonist ONO-AP-324-01 was kindly provided by Ono Pharmaceutical
Co., Ltd. (Osaka, Japan). All other chemicals were of analytical grade.
Cell CultureThe rat clonal cell line, UMR 106 cells
(generously provided by Dr. T. J. Martin) were cultured at 37 °C in 5%
CO2 air in
-minimum essential medium (
-MEM)
supplemented with 10% fetal bovine serum and used in these studies as an
osteoblastic cell line that synthesizes BSP
(27,
48). Rat stromal bone marrow
cells (49), were kindly
provided by Dr. S. Pitaru (Tel Aviv University, Tel Aviv, Israel). The cells
were first grown to confluence in 60-mm tissue culture dishes in
-MEM
medium containing 10% fetal bovine serum, then cultured in
-MEM without
serum, and incubated with prostaglandin E2. RNA was isolated from
triplicate cultures and analyzed for expression of BSP mRNA by RT-PCR and real
time PCR as described below.
RT-PCR and Real Time PCRFollowing treatment total RNA was
extracted from UMR 106 cells with guanidium thiocyanate at different times, as
described previously (44), and
1 µg was used as a template for one-step RT-PCR and cDNA synthesis. cDNA
was prepared using random hexamer and Moloney murine leukemia virus reverse
transcriptase RNase H. Conventional one-step RT-PCR was
performed using a SuperScript one-step RT-PCR kit. The primers were
synthesized on the basis of the reported rat cDNA sequences for BSP and
glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Sequences of the primers
used for PCR were as follow: BSP forward,
5'-CTGCTTTAATCTTGCTCTG-3'; BSP reverse,
5'-CCATCTCCATTTTCTTCC-3'; GAPDH forward,
5'-CCATGTTTGTGATGGGTGTG-3'; and GAPDH reverse,
5'-GGATGCAGGGATGATGTTCT-3'. cDNA synthesis and predenaturation was
performed for 1 cycle at 50 °C for 30 min and 94 °C for 2 min, and
amplification was carried out for 30 (BSP and GAPDH) cycles at 94 °C for
30 s, 55 °C for 30 s, and 72 °C for 30 s, and final extension was 94
°C for 10 min in a 50-µl reaction mixture. After amplification, 10
µl of each reaction mixture was analyzed by 2% agarose gel electrophoresis,
and the bands were then visualized by ethidium bromide staining. The expected
size of the PCR products for BSP and GAPDH were 211 and 264 bp, respectively.
Quantitative real time PCR was performed using the following primer sets:
BSP-R-T forward, 5'-TCCTCCTCTGAAACGGTTTCC-3'; BSP-R-T reverse,
5'-CGAACTATCGCCATCTCCATT-3'; GAPDH-R-T forward,
5'-AGATGGTGAAGGTCGGTGTC-3'; and GAPDH-R-T reverse,
5'-ATTGAACTTGCCGTGGGTAG-3' using the SYBR Green qPCR Kit in a DNA
Engine Opticon 2 continuous fluorescence detection system (MJ Research Inc.).
The expected size of the PCR products for BSP and GAPDH were 73 and 167 bp,
respectively. The amplification reactions were performed in 20 µl of final
volume containing 1x SYBR Green Master Mix, 0.25 µM primer
mixture, and 10 ng of cDNA. To reduce variability between replicates, PCR
premixes, which contain all of the reagents except for cDNA, were prepared and
aliquoted into 0.2-ml thin wall strip tubes (MJ Research Inc.). The thermal
cycling conditions were 40 cycles of the following protocol: 15 s of
denaturation at 95 °C, 50 s of annealing at 64 °C, followed by 12 s of
extension at 77 °C. Post-PCR melting curves confirmed the specificity of
single-target amplification, and fold expression of BSP relative to GAPDH was
determined in triplicate
(50).
Transient Transfection AssaysExponentially growing UMR 106
cells were used for transfection assays. 24 h after plating, the cells at
50
70% confluence were transfected using a LipofectAMINE reagent. The
transfection mixture included 1 µg of a luciferase (LUC) construct
(45) and 2 µg of
pSV-
-galactosidase vector as an internal transfection control. Two days
post-transfection, the cells were deprived of serum for 12 h, and 3
µM or 30 nM PGE2 or 3 µM of
the respective EP agonists were added for 12 h prior to harvesting. The
luciferase assay was performed according to the supplier's protocol (picaGene;
Toyo Inki) using a Luminescence reader BLR20 (Aloka) to measure the luciferase
activity. The protein kinase inhibitorsH89 (5 µM) and H7 (5
µM) were used to inhibit protein kinase A and C. Herbimycin A (1
µM) and PP1 (10 µM) were used for tyrosine kinase
and Src tyrosine kinase inhibition, respectively
(42,
51). U0126 (5
µM) was used to inhibit MAP kinase kinase activity
(52). Sodium orthovanadate (50
µM) and okadaic acid (50 nM) were used for tyrosine
phosphatase and serine-threonine phosphatase inhibition, respectively
(53,
54). Forskolin (1
µM) was used for activation of adenylate cyclase
(45). Oligonucleotide-directed
mutagenesis by PCR was utilized to introduce dinucleotide substitutions using
the QuikChange site-directed mutagenesis kit (Stratagene). All of the
constructs were sequenced as described previously
(42) to verify the fidelity of
the mutagenesis.
Gel Mobility Shift AssaysConfluent UMR 106 cells in T-75
flasks incubated for 6 and 12 h with 30 nM PGE2 in
-MEM without serum were used to prepare nuclear extracts. Nuclear
protein was extracted by the method of Dignam et al.
(55) with the addition of
extra proteinase inhibitors (the extraction buffer was 0.42 M NaCl,
1.5 mM MgCl2, 0.2 mM EDTA, 1 mM
dithiothreitol, 25% (v/v) glycerol, 0.5 mM phenylmethylsulfonyl
fluoride, 2 µg/ml leupeptin, 2 µg/ml pepstatin A, 1 µg/ml aprotinin,
pH 7.9). Protein concentration was determined by the Bradford assay
(56). Double-stranded
oligonucleotides encompassing the inverted CCAAT (nt 61 to 37,
5'-CCGTGACCGTGATTGGCTGCTGAGA), cAMP response element (CRE; nt
84 to 59, 5'-CCCACAGCCTGACGTCGCACCGGCCG), and FGF2
response element (FRE; nt 98 to 79,
5'-TTTTCTGGTGAGAACCCACA) in the BSP promoter were prepared by
Bio-Synthesis, Inc., whereas consensus CRE
(5'-AGAGATTGCCTGACGTCAGAGAGCTAG) was purchased from Promega. For
gel shift analysis the double-stranded oligonucleotides were end-labeled with
[
-32P]ATP and T4 polynucleotide kinase. Nuclear protein
extracts (3 µg) were incubated for 20 min at room temperature (21 °C)
with 0.1 pM radiolabeled double-stranded oligonucleotide in buffer
containing 50 mM KCl, 0.5 mM EDTA, 10 mM
Tris-HCl (pH 7.9), 1 mM dithiothreitol, 0.04% Nonidet P-40, 5%
glycerol, and 1 µg of poly(dI-dC). Following incubation, the protein-DNA
complexes were resolved by electrophoresis on 5% nondenaturing acrylamide gels
(38:2 acrylamide/bis-acrylamide) run at 150 V at room temperature. For
competition experiments unlabeled oligonucleotides for the CRE, mutation CRE
(5'-CCCACAGCCcGACGcCGCACCGGCCG), FRE, and mutated FRE
(5'-TTTTCTGGcaAGAACCCACA) were used at 20- and 40-fold molar
excess. After electrophoresis, the gels were dried, and the autoradiograms
were prepared and analyzed using an image analyzer. Supershift experiments
were performed with 12 µl of antibodies (Santa Cruz Biotechnology)
against CRE-binding protein (CREB-1; sc-58), c-Jun (sc-44), c-Fos (sc-253),
Pit-1 (sc-442), Oct-1 (sc-232), NF
B p65 (sc-109), NF
B p50
(sc-7178), and phospho-CREB (Upstate Biotechnology, Inc.; 06-519) separately
to each gel shift reaction. The extracts were incubated for 5 h at 4 °C
with the appropriate antibody before electrophoresis was performed under the
same conditions as described above.
[Ca2+]i
DeterminationConfluent cells were preincubated with 2
µM fura-2/acetoxymethylester in
-MEM for 30 min at 37
°C. After they were loaded with fura-2/acetoxymethylester, the cells were
detached from tissue culture flasks with the trypsin-EDTA solution, washed
twice, and suspended in fresh
-MEM. Just before
[Ca2+]i determination, the cells
were washed again and resuspended in Krebs-Ringer-HEPES solution (120
mM NaCl, 5 mM KCl, 1 mM MgSO4,
0.96 mM NaH2PO4, 0.2% glucose, 0.1% bovine
serum albumin, 20 mM HEPES (pH 7.4), and 1 mM
CaCl2). The fluorescence of fura-2-loaded cells was measured with a
CAF-110 spectrofluorometer (Nihon Bunkou, Tokyo, Japan) with excitation at 340
and 380 nm and emission at 500 nm.
[Ca2+]i was calculated from the
measurement of the ratio of fluorescence intensities
(57,
58). All of the experiments
were performed three times with different cell batches.
Statistical AnalysisTriplicate samples were analyzed for
each experiment, and the experiments were replicated to ensure consistency of
the responses to PGE2. Significant differences between control and
PGE2 treatment were determined using Student's t test.
 |
RESULTS
|
|---|
Stimulation of BSP mRNA Expression in UMR 106 Cells BSP
gene expression was investigated at 6 and 12 h after PGE2
stimulation by conventional (Fig.
1A) and real time PCR
(Fig. 1B). When
osteoblastic UMR 106 cells were exposed to 3 µM, 300
nM, and 30 nM PGE2, expression of BSP mRNA
was increased 2.3-, 2.0-, and 2.2-fold at 6 h and 2.7-, 2.5-, and 2.4-fold at
12 h, respectively, as shown by conventional RT-PCR
(Fig. 1A). To further
confirm the PGE2 effects on BSP transactivation, we applied real
time PCR to examine the mRNA expression level of BSP. As
Fig. 1B shows,
PGE2 (3 µM, 300 nM, and 30 nM)
can induce the mRNA expression of BSP.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 1. Effect of PGE2 on BSP mRNA levels. A,
conventional RT-PCR for BSP gene expression in UMR 106 cells treated with 3
µM, 300 nM, and 30 nM PGE2 for
6 and 12 h. Total RNA was extracted, and the expression of BSP and GAPDH mRNAs
in the cells were analyzed by one-step RT-PCR. The results were quantitated by
densitometry and normalized to the expression of GAPDH. B, relative
gene expression for BSP generated from real time PCR of UMR 106 cells treated
with 3 µM, 300 nM, and 30 nM
PGE2. The expression of GAPDH was also examined as control. The
relative amounts of mRNA of BSP to GAPDH were calculated. The experiments were
performed in triplicate for each data point, and the standard errors are shown
as error bars. Significant differences compared with controls are
shown at the following probability levels: #, p < 0.2; *,
p < 0.1; **, p < 0,05; ****, p < 0.01.
|
|
Transient Transfection Analysis of Rat BSP Promoter
ConstructsTo determine the site of PGE2-regulated
transcription in the 5'-flanking region of the BSP gene, various sized
promoter constructs ligated to a luciferase reporter gene were transiently
transfected into UMR 106 cells, and their transcriptional activity was
determined in the presence of PGE2. With the construct pLUC3,
encompassing BSP promoter nucleotides 116 to +60, transcription was
increased 3.8-fold with 3 µM PGE2 and 2.2-fold with
30 nM PGE2 after 12 h of treatment
(Fig. 2, A and
B). PGE2 also increased transcription of pLUC4
(425 to +60), pLUC5 (801 to +60), pLUC6 (938 to +60), and
pLUC7 (1149 to +60). In shorter constructs (pLUC1, 18 to +60;
pLUC2, 43 to +60), luciferase activities were not increased by
PGE2 (data not shown). When transcriptional activity in response to
30 nM PGE2 was analyzed in normal rat stromal bone
marrow cells (49), the
transcriptional activity of pLUC3 was increased 2-fold
(Fig. 2C). Within the
DNA sequence that is unique to pLUC3 (between nt116 and 43), an
inverted CCAAT box (ATTGG; between nt50 and 46), CRE (between
nt75 and 68), FRE (between nt92 and 85), and the
Pit-1 motif (between nt111 and 105) are present
(Fig. 3).

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 2. PGE2 up-regulates BSP promoter activity in UMR-106 cells.
A and B, transient transfections of UMR 106 cells in the
presence or absence of PGE2 (A, 3 µM;
B, 30 nM) for 12 h were used to determine transcriptional
activity of chimeric constructs that included various regions of the BSP
promoter ligated to a luciferase reporter gene. The results of transcriptional
activity obtained from three separate transfections with constructs, pLUC
basic (pLUCB) and pLUC3 to pLUC7, have been combined, and the values are
expressed with standard errors. Significant differences compared with controls
are shown at the following probability levels: #, p < 0.2; *,
p < 0.1; **, p < 0.05; ***, p < 0.02;
****, p < 0.01. C, transient transfections of rat stromal
bone marrow cells (SBMC) in the presence or absence of
PGE2 (30 nM) for 12 h were used to determine
transcriptional activity of chimeric constructs that included various regions
of the BSP promoter ligated to a luciferase reporter gene. The results of
transcriptional activity were obtained from three separate transfections with
constructs; pLUC basic (pLUCB) and pLUC3 have been combined, and the values
are expressed with standard errors. Significant difference compared with
control at the p < 0.1 level is shown (*).
|
|

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 3. Regulatory elements in the proximal rat BSP promoter. The positions
of the inverted TATA and CCAAT boxes, a CRE, a FRE, Pit-1, a homeobox-binding
site (HOX), a transforming growth factor- activation element
(TAE) overlapping with AP2, glucocorticoid response elements
(GRE) overlapping the AP1, and a vitamin D response element
(VDRE) that overlaps the inverted TATA box are shown in the proximal
promoter region of the rat BSP gene. The numbering of nucleotides is relative
to the transcription start site (+1).
|
|
Because PGE2 signaling activities are mediated by different
protein kinases, we investigated the effects of the protein kinase C inhibitor
H7 (5 µM), the cAMP-dependent protein kinase inhibitor H89 (5
µM), the tyrosine kinase inhibitor herbimycin A (1
µM), the Src kinase inhibitor PP1 (10 µM), and the
MAP kinase kinase inhibitor U0126 (5 µM) on
PGE2-mediated transcription to determine the signaling pathway.
Whereas PGE2-induced pLUC3 promoter activation was inhibited by
H89, herbimycin A, PP1, and U0126, no effect was observed for H7
(Fig. 4), indicating an
involvement of cAMP-dependent protein kinase, tyrosine kinase (Src), and MAP
kinases in mediating the effects on BSP transcription. To assay for the
responsiveness of the BSP promoter to serine-threonine phosphorylation,
tyrosine phosphorylation, or elevated intracellular cAMP level, we used the
serine-threonine phosphatase inhibitor okadaic acid, tyrosine phosphatase
inhibitor sodium orthovanadate, and also forskolin, which is known to
stimulate an adenylate cyclase. Vanadate (50 µM) and forskolin
(1 µM) stimulated pLUC3 promoter activity
1.6- and
1.7-fold, respectively, whereas okadaic acid (50 nM) was
without effect (Fig. 5).
Simultaneous stimulation with vanadate (50 µM) and
PGE2 (3 µM) up-regulated pLUC3 promoter activity
synergistically. However, a combination of forskolin and PGE2
increased pLUC3 transcription to the same level observed for PGE2
stimulation (Fig. 5).

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 4. Effect of kinase inhibitors on transcriptional activation by
PGE2. Transient transfection analysis of pLUC3 in the presence
or absence of PGE2 (3 µM) for 12 h in UMR 106 cells
is shown together with the effects of the protein kinase C inhibitor (H7, 5
µM), cAMP-dependent protein kinase inhibitor (H89, 5
µM), tyrosine kinase inhibitor (herbimycin A, HA, 1
µM), Src kinase inhibitor (PP1, 10 µM), and MAP
kinase kinase inhibitor (U0126, 5 µM). The results obtained from
three separate transfections were combined, and the values are expressed with
standard errors. Significant differences compared with controls are shown at
the following probability levels: **, p < 0,05; ****, p
< 0.01.
|
|

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 5. PGE2 and tyrosine phosphatase inhibitor (sodium
orthovanadate) synergistically up-regulate BSP transcription. pLUC3 was
analyzed for relative promoter activity after transfection into UMR 106 cells
and examined for induction in the presence of okadaic acid (OKA, 50
nM), sodium orthovanadate (VANA, 50 µM),
forskolin (FSK, 1 µM), and simultaneous stimulation of
each reagent with PGE2 (3 µM). The results of
transcriptional activity obtained from three separate transfections with
constructs pLUCB and pLUC3 were combined, and the values are expressed with
standard errors. Significant differences in the relative luciferase activities
obtained with pLUC3 are indicated at the following probability levels: #,
p < 0.2; **, p < 0,05; ***, p < 0.02.
|
|
To determine which PGE2 receptor subtype transduced the
PGE2 effects on BSP transcription, the following receptor agonists
were used in the transcription assays: 3 µM 17-phenyl trinor
PGE2 (for EP1 and EP3), ONO-AP-324-01 (for EP3), butaprost (for
EP2), and prostaglandin E1 alcohol (for EP2 and EP4)
(Fig. 6). Butaprost and
prostaglandin E1 alcohol stimulated pLUC3 promoter activity to a
similar extent as PGE2, whereas no significant increase in
transcription was observed with either 17-phenyl trinor and ONO-AP-324-01,
indicating that PGE2 activates BSP transcription by a mechanism
involving cAMP stimulation through EP2 and EP4 receptors.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 6. Effect of PGE agonists on the BSP promoter activity. Transient
transfection analysis of pLUC3 in the presence or absence of 3
µM PGE2, 17-phenyl trinor PGE2 (EP1 and
EP3 agonist), ONO-AP-324-01 (EP3 agonist), butaprost (EP2 agonist), and
prostaglandin E1 alcohol (EP2 and EP4 agonist) for 12 h in UMR 106
cells is shown. The results obtained from three separate transfections were
combined, and the values are expressed with standard errors. Significant
difference compared with controls is shown at the p < 0,05 level
(**).
|
|
To determine the regulatory element(s) between nt116 and 43
that is utilized by PGE2, a series of 5' deletion constructs
were prepared. Transcription by constructs116BSPLUC and
108BSPLUC was increased by PGE2, but no increase was seen
with 84BSPLUC. These results indicated that the element responding to
PGE2 was present between nt108 and 85 in the BSP
promoter (Fig. 7). Next we
introduced mutations in the possible response elements encoded within
nt116 to +60 of pLUC3. In addition, we examined whether these sites
function in the large promoter construct (nt 1149 to +60; pLUC7), as
shown in Fig. 8. Whereas
mutations in the Pit-1 had little effect on PGE2 stimulation and
mutation of the CCAAT box essentially abolished basal expression, mutations of
the CRE and especially the FRE significantly reduced the PGE2
effects on the transcriptional activities
(Fig. 8). Furthermore, when
both CRE and FRE sites were mutated, PGE2-induced luciferase
activity was completely abolished (Fig.
8). These results suggest that the FRE and possibly the CRE are
required as functional cis-elements for up-regulation of BSP
transcription by PGE2.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 7. Fine 5' deletion mapping of the nt116 to 43 element
in the BSP promoter. A series of rat BSP promoter 5' deletion
constructs were analyzed for relative promoter activity after transfection
into UMR 106 cells and examined for induction in the presence of
PGE2 (3 µM) for 12 h. The results of transcriptional
activity obtained from four separate transfections with constructs, 43
BSPLUC (43 to +60), 60 BSPLUC (60 to +60), 84
BSPLUC (84 to +60), 108BSPLUC (108 to +60), and
116 BSPLUC (116 to +60), have been combined, and the values are
expressed with standard errors. Significant differences compared with controls
are shown at the following probability levels: *, p < 0.1; ***,
p < 0.02.
|
|

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 8. Site mutation analysis of luciferase activities in response to
PGE2. Dinucleotide substitutions were made within context of
the homologous 116 to +60 (pLUC3) and 1149 to +60 (pLUC7) BSP
promoter fragments. M-CCAAT (ATTtt), M-CRE (cGACGcCG),
M-FRE (GGcaAGAA), M-PIT (TTacAGT), and double-mutated constructs
(M-CRE and M-FRE) were analyzed for relative promoter activity after
transfection into UMR 106 cells and examined for induction in the presence of
PGE2 (A, 3 µM; B, 30 nM)
for 12 h. The results of transcriptional activity obtained from three separate
transfections with constructs were combined, and the values are expressed with
standard errors. Significant differences compared with controls are shown at
the following probability levels: #, p < 0.2; *, p <
0.1; **, p < 0.05; ****, p < 0.01.
|
|
Gel Mobility Shift AssaysTo identify nuclear proteins whose
binding to the CRE and FRE elements might be modulated by PGE2,
double-stranded oligonucleotides were end-labeled and incubated with equal
amounts (3 µg) of nuclear proteins extracted from confluent UMR 106 cells
that were either not treated (control) or treated with 30 nM
PGE2 for 6 and 12 h. When the CRE and FRE were used as probes, the
formation of FRE-protein complexes (Fig.
9, lanes 46) and slowly migrating CRE-protein
complexes were increased by PGE2
(Fig. 9, lanes
13). That these DNA-protein complexes represent specific
interactions was demonstrated by competition experiments in which 20- and
40-fold molar excess of CRE and consensus CRE
(Fig. 10, lanes 3, 4,
7, and 8) and FRE double-stranded oligonucleotides
(Fig. 11, lanes 3 and
4) reduced by the amount of complex formation dose-dependently. In
contrast, mutated CRE, FRE, and inverted CCAAT
(Fig. 10, lanes 5, 6,
and 912) and mutated FRE, CRE, consensus CRE, and inverted
CCAAT oligonucleotides (Fig.
11, lanes 512) did not compete with CRE-protein
and FRE-protein complex formation. To verify that the PGE2 was
operating through CRE and FRE, we also used gel mobility shift analyses to
evaluate the potential effects of PGE2 on the nearby inverted CCAAT
and consensus CRE sites. When we used the inverted CCAAT sequence as a probe,
the CCAAT-NF-Y protein complex
(40,
41,
59) did not change after
PGE2 stimulation (Fig.
12, lanes 13). In comparison, CRE binding was
increased by PGE2 (Fig.
12, lanes 46). Notably, a stronger shift was
obtained with the concensus CRE compared with the CRE in the proximal promoter
of the BSP gene.

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 9. PGE2 up-regulates a nuclear protein that recognizes the CRE
and FRE. Radiolabeled double-stranded CRE
(84CCCACAGCCTGACGTCGCACCGGCCG59)
and FRE oligonucleotides
(98TTTTCTGGTGAGAACCCACA79)
were incubated for 20 min at 21 °C with nuclear protein extracts (3 µg)
obtained from UMR 106 cells incubated without (lanes 1 and
4) or with PGE2 at 30 nM for 6 h (lanes
2 and 5) and 12 h (lanes 3 and 6). DNA-protein
complexes were separated on 5% polyacrylamide gel in low ionic strength Tris
borate buffer, dried under vacuum, and exposed to an imaging plate for
quantitation using an image analyzer.
|
|

View larger version (60K):
[in this window]
[in a new window]
|
FIG. 10. Specific binding of nuclear proteins to the CRE. Radiolabeled
double-stranded CRE was incubated for 20 min at 21 °C with nuclear protein
extracts (3 µg) obtained from UMR 106 cells stimulated in the absence
(control; lane 1) or presence (lanes 212) of
PGE2 (30 nM) for 12 h. Competition reactions were
performed using a 20- and 40-fold molar excess of unlabeled CRE
(84CCCACAGCCTGACGTCGCACCGGCCG59;
lanes 3 and 4), mutation CRE (m-CRE;
CCCACAGCCcGACGcCGCACCGGCCG; lanes 5 and 6), consensus
CRE (AGAGATTGCCTGACGTCAGAGAGCTAG; lanes 7 and 8), FRE
(98TTTTCTGGTGAGAACCCACA79;
lanes 9 and 10), and inverted CCAAT
(61CCGTGACCGTGATTGGCTGCTGAGA37;
lanes 11 and 12). DNA-protein complexes were separated on 5%
polyacrylamide gel in low ionic strength Tris borate buffer, dried under
vacuum, and exposed to an imaging plate for quantitation using an imaging
analyzer.
|
|

View larger version (48K):
[in this window]
[in a new window]
|
FIG. 11. Specific binding of nuclear proteins to the FRE. Radiolabeled
double-stranded FRE was incubated for 20 min at 21 °C with nuclear protein
extracts (3 µg) obtained from UMR 106 cells stimulated in the absence
(control; lane 1) or presence (lanes 212) of
PGE2 (30 nM) for 12 h. Competition reactions were
performed using a 20- and 40-fold molar excess of unlabeled FRE
(98TTTTCTGGTGAGAACCCACA79;
lanes 3 and 4), mutation FRE (m-FRE;
TTTTCTGGcaAGAACCCACA; lanes 5 and 6), CRE
(84CCCACAGCCTGACGTCGCACCGGCCG59;
lanes 7 and 8), consensus CRE
(AGAGATTGCCTGACGTCAGAGAGCTAG; lanes 9 and 10), and
inverted CCAAT
(61CCGTGACCGTGATTGGCTGCTGAGA37;
lanes 11 and 12). DNA-protein complexes were separated on 5%
polyacrylamide gel in low ionic strength Tris borate buffer, dried under
vacuum, and exposed to an imaging plate for quantitation using an imaging
analyzer.
|
|

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 12. Comparison of CCAAT and consensus CRE DNA-protein complexes.
Radiolabeled double-stranded CCAAT oligonucleotide
(61CCGTGACCGTGATTGGCTGCTGAGA37)
and consensus CRE (5'-AGAGATTGCCTGACGTCAGAGAGCTAG) were incubated
with nuclear protein extracts (3 µg) obtained from UMR 106 cells incubated
without (lanes 1 and 4) or with PGE2 at 30
nM for6h(lanes 2 and 5) and 12 h (lanes
3 and 6). DNA-protein complexes were separated on 5%
polyacrylamide gel in low ionic strength Tris borate buffer, dried under
vacuum, and exposed to an imaging plate for quantitation using an imaging
analyzer. Control, nuclear extract from control confluent cells.
|
|
To further characterize the proteins in the complexes formed with the CRE
and FRE, we used antibodies for several transcription factors. The addition of
antibody to CREB disrupted the formation of the CRE DNA-protein complexes
(Fig. 13, lane 4),
whereas incubation of nuclear extracts with anti-phospho-CREB antibody
produced a visible supershift complex
(Fig. 13, lane 5).
FRE-nuclear protein complex was not disrupted or supershifted by antibodies to
CREB, c-Jun, c-Fos, Pit-1, Oct-1, NF
B p65, and NF
B p50 (data not
shown).

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 13. Specific binding of nuclear proteins to the CRE. Radiolabeled
double-stranded CRE oligonucleotide
(84CCCACAGCCTGACGTCGCACCGGCCG59)
was incubated with nuclear protein extracts (3 µg) obtained from UMR 106
cells incubated without (lane 1) or with PGE2 (30
nM, lanes 25) for 12 h. Supershift experiments were
performed with 12 µl of antibodies against CREB-1 (lane 4)
and phospho-CREB (lane 5) added separately to each gel shift
reaction.
|
|
 |
DISCUSSION
|
|---|
Prostaglandins are among the most potent regulators of bone cell function
(4,
17). Extensive studies have
demonstrated that PGE2 has both anabolic and catabolic effects on
osteoblastic cells (13,
18). Although the effects on
bone resorption are indirect, involving the expression of cytokines such as
RANKL, which promote osteoclast formation
(7), prostaglandins can
directly stimulate osteoblastic cells to differentiate and form bone
(2,
13). The expression of BSP,
which is essentially specific to mineralized tissues and is expressed by newly
formed osteoblasts coincident with mineralization, provides a valuable marker
for osteogenic differentiation and bone formation
(28). Our studies show that
PGE2, consistent with its promoting osteogenesis, increases
expression of BSP by activation of EP2 and EP4 receptors in UMR 106 cells.
Transduction of the PGE2 signaling is mediated by cyclic
AMP-dependent protein kinase A, Src tyrosine kinase, and MAP kinase, which
target nuclear proteins that bind to CRE and FRE elements in the proximal
promoter of the BSP gene.
Prostaglandins, acting through different cell surface receptors on
osteoblastic cells, stimulate bone remodeling by promoting both anabolic and
catabolic responses, the relative responses being dependent on the target cell
population and the concentration of PGE2. In bone marrow cells,
which are targets for the anabolic actions of PGE2
(60), PGE2 can
stimulate both phospholipase C and adelylate cyclase pathways in osteoblasts
(2,
10). The stimulation of
phospholipase C results in the breakdown of phospholipid to form
diacylglycerol, which activates protein kinase C
(61), and inositol phosphates,
which cause the release of intracellular concentration of free calcium
([Ca2+]i)
(58). Although 3
µM PGE2 evoked an increase in
[Ca2+]i in UMR 106 cells, 30
nM and lower concentrations of PGE2 could not induce
[Ca2+]i (data not shown), suggesting
that PGE2 stimulation of BSP transcription is independent of
Ca2+ signaling. In contrast, stimulation of BSP
transcription appears to utilize the cAMP-dependent protein-tyrosine kinase
pathway because transcription is inhibited by herbimycin A and stimulated by
vanadate and forskolin. Moreover, BSP transcription is mediated by EP2 and EP4
receptors (Fig. 6), through
which cAMP production is stimulated
(21). That transcription is
suppressed by Src inhibitors to Src kinase and MAP kinase
(Fig. 4) further implicates
these enzymes in the signaling pathway.
BSP has been characterized as a unique marker of osteogenic differentiation
that can regulate the formation of mineral crystals
(28). In this study, we have
identified response elements in the BSP gene promoter that mediate the
PGE2 action on BSP transcription. In UMR 106 cells, PGE2
(3 µM and 30 nM) stimulated BSP promoter activity
(pLUC3)
3.8- and 2.2-fold (Fig. 2,
A and B), comparable with the increase in BSP
mRNA levels of
2.7- and 2.4-fold by conventional RT-PCR
(Fig. 1A) and
3.6- and 3.7-fold by real time PCR
(Fig. 1B).
PGE2 also induced BSP transcription in stromal bone marrow cells
(Fig. 2C), indicating
that the increased BSP expression occurs in normal osteoprogenitor cells and
is not a specific feature of transformed UMR 106 cells. From transient
transfection assays we initially located the PGE2-responsive region
to the proximal promoter (nt116 and 43;
Fig. 2) of the BSP gene, which
encompasses an inverted CCAAT box (nt50 and 46), a putative CRE
(nt75 and 68), a FGF2 response element (FRE; nt92 and
85), and a Pit-1 (nt111 and 105) motif
(Fig. 3). The results of
luciferase analyses using fine 5' deletion constructs between
nt116 to 43 in the BSP promoter show that the PGE2
effects are targeted to a region encompassed by nt108 and 43
(Fig. 7). Whereas mutation of
the Pit-1 element was without effect, mutation of the CCAAT element resulted
in the loss of basal transcriptional activity, as reported previously
(40,
43). As a consequence the
involvement of the inverted CCAAT was difficult to ascertain. However, the
lack of PGE2-induced transcription with constructs 84BSPLUC
and 60BSPLUC (Fig. 7)
indicate that the CCAAT is not a target of PGE2 regulation. In
comparison, mutations in the CRE and FRE sites suggest that they are required
for the induction of BSP expression by the PGE2. The involvement of
the FRE and CRE elements is further supported by EMSA analyses in which
proteins from nuclear extracts formed complexes with the FRE and CRE elements
that were increased by PGE2
(Fig. 9). However, although the
luciferase assays show a much reduced PGE2-stimulated transcription
when the individual CRE and FRE sites are mutated and the combined mutations
show total abrogation, the formation of CRE-nuclear factor complexes is weak
compared with results obtained with a concensus CRE (Figs.
9 and
12). Moreover, there is no
significant increase in transcription with the 84BSPLUC construct
(Fig. 7), which omits the FRE
but retains the CRE element. In comparison, the FRE clearly shows increased
binding of the nuclear protein in response to PGE2. Thus, our
studies suggest that transcriptional activation is mediated by the juxtaposed
FRE and CRE elements, with the FRE being the predominant target of the
PGE2 effects.
Although the CRE element binding of nuclear protein was not strong, the
binding protein was, nevertheless up-regulated by PGE2
(Fig. 9) and could be
identified as CREB by antibody interference
(Fig. 13). Moreover,
phosphorylation of the CREB was induced by PGE2
(Fig. 13). Although
cAMP-dependent protein kinase signaling does not affect CREB binding to its
cognate CRE element, it can direct phosphorylation of CREB, which is required
for transcriptional activation
(62,
63). In comparison, the
nuclear factor binding to the FRE element, which is regulated by tyrosine
kinase, has yet to be characterized and is the focus of current studies
because of its potential role in regulating basal and FGF2-induced
transcription of BSP in osteoblasts
(42), as well as mediating the
PGE2 effects.
The molecular pathways of PGE2 regulation of BSP gene
transcription are identified in these studies. PGE2 acting through
EP2 and EP4 prostaglandin receptors on osteoblastic cells activates signaling
pathways involving cAMP generation and tyrosine phosphorylation
(protein-tyrosine kinase), which activate MAP kinase to phosphorylate CREB and
thereby transactivate BSP transcription through the CRE. Whether this same
pathway also activates the FRE response through the same or a linked pathway
or whether there is a concerted action on the CRE and FRE through a single
pathway is difficult to discern at this time because the FRE-binding nuclear
protein is yet to be characterized.
In conclusion, our study has identified CRE and FRE elements in the rat BSP
proximal promoter that mediate BSP transcription induced by PGE2
and that the PGE2 increases the nuclear protein binding activities
of CRE and FRE and enhances CREB phosphorylation. Because BSP is expressed by
differentiated osteoblasts and PGE2 is a crucial factor for bone
metabolism, it is conceivable that these two response elements may contribute
to the cell-specific expression of the BSP gene during the formation of the
mineralized extracellular matrix of bone.
 |
FOOTNOTES
|
|---|
* This work was supported in part by Grants-in-aid for Scientific Research
09771650, 12671865, 14571988, and 14571989 from the Ministry of Education,
Science, and Culture of Japan, by Nihon University Multidisciplinary Research
Grant for 2002 and 2003, by a Suzuki Memorial Grant of Nihon University School
of Dentistry at Matsudo (General Individual Research Grant for 2002 and
Research Grant for Assistants for 2003), and by a Grant from the Ministry of
Education, Culture, Sports, Science, and Technology to promote the 2001
Multidisciplinary Research Project. The costs of publication of this article
were defrayed in part by the payment of page charges. This article must
therefore be hereby marked "advertisement" in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact. 
¶ These authors contributed equally to this work. 
¶¶
To whom correspondence should be addressed: Dept. of Periodontology, Nihon
University School of Dentistry at Matsudo, Chiba, 271-8587, Japan. Tel.:
81-47-360-9362; Fax: 81-47-360-9362; E-mail:
ogata{at}mascat.nihon-u.ac.jp.
1 The abbreviations used are: PGE2, prostaglandin E2;
BSP, bone sialoprotein; CRE, cyclic AMP response element; CREB, cAMP response
element-binding protein; LUC, luciferase; FRE, FGF2 response element; nt,
nucleotide(s); MAP, mitogen-activated protein; Pit-1, pituitary-specific
transcription factor-1; FGF2, fibroblast growth factor 2; RANKL, receptor
activator of nuclear factor
B ligand; RT, reverse transcription;
-MEM,
-minimum essential medium; GAPDH,
glyceraldehyde-3-phosphate dehydrogenase. 
 |
REFERENCES
|
|---|
- Hakeda, Y., Nakatani, Y., Hiramatsu, M., Kurihara, N., Tsunoi, M.,
Ikeda, E., and Kumegawa, M. (1985) J. Biochem.
(Tokyo) 97,
97104[Abstract/Free Full Text]
- Kaneki, H., Takasugi, I., Fujieda, M., Kiriu, M., Mizuoch, S., and
Ide, H. (1999) J. Cell. Biochem.
73,
3648[CrossRef][Medline]
[Order article via Infotrieve]
- Suzawa, T., Miyaura, C., Inada, M., Maruyama, T., Sugimoto, Y.,
Ushikubo, F., Ichikaw, a A., Narumiya, S., and Suda, T. (2000)
Endocrinology 141,
15541559[Abstract/Free Full Text]
- Akatsu, T., Takahashi, N., Debari, K., Morita, I., Murota, S.,
Nagata, N., Takatani, O., and Suda, T. (1989) J. Bone
Miner. Res. 4,
2935[Medline]
[Order article via Infotrieve]
- Li, X., Okada, Y., Pilbeam, C. C., Lorenzo, J. A., Kennedy, C. R.
J., Breyer, R. M., and Raisz, L. G. (2000)
Endocrinology 141,
20542061[Abstract/Free Full Text]
- Hattersley, G., Owens, J., Flanagan, A. M., and Chambers, T. J.
(1991) Biochem. Biophys. Res. Commun.
177,
526531[CrossRef][Medline]
[Order article via Infotrieve]
- Yasuda, H., Shima, N., Nakagawa, N., Yamaguchi, K., Kinisaki, M.,
Mochizuki, S., Tomoyasu, A., Yano, K., Goto, M., Murakami, A., Tsuda, E.,
Morinaga, T., Higashio, K., Udagawa, N., Takahashi, N., and Suda, T.
(1998) Proc. Natl. Acad. U. S. A.
95,
35973602[Abstract/Free Full Text]
- Simonet, W. S., Lacey, D. L., Dunstan, C. R., Kelley, M., Chang, M.
S., Luthy, R., Nguyen, H. Q., Wooden, S., Bennett, L., Boone, T., Shimamoto,
G., DeRose, M., Elliott, R., Colombero, A., Tan, H. L., Trail, G., Sullivan,
J., Davy, E., Bucay, N., Renshaw-Gegg, L., Hughes, T. M., Hill, D., Pattison,
W., Campbell, P., Sander, S., Van, G., Tarpley, J., Derby, P., and Lee, R.
(1997) Cell
89,
309319[CrossRef][Medline]
[Order article via Infotrieve]
- Kanematsu, M., Sato, T., Takai, H., Watanabe, K., Ikeda, K., and
Yamada, Y. (2000) J. Bone Miner. Res.
15,
13211329[CrossRef][Medline]
[Order article via Infotrieve]
- Kozawa, O., Suzuki, A., Tokuda, H., Kaida, T., and Uematsu, T.
(1998) Bone
22,
355360[Medline]
[Order article via Infotrieve]
- Millet, I., Mccarthy, T. L., and Vignery, A. (1998)
J. Bone Miner. Res. 13,
10921100[CrossRef][Medline]
[Order article via Infotrieve]
- Gruber, R., Nothegger, G., Ho, G., Willheim, M., and Peterlik, M.
(2000) Biochem. Biophys. Res. Commun.
270,
10801085[CrossRef][Medline]
[Order article via Infotrieve]
- Weinreb, M., Machwate, M., Shir, N., Abramovitz, M. Rodan, G. A.,
and Harada, S. (2001) Bone
28,
275281[Medline]
[Order article via Infotrieve]
- Opas, E. E., Gentile, M. A., Rossert, J. A., de Crombrugghe, B.,
Rodan, G. A., and Schmidt, A. (2000) Bone
26,
2732[Medline]
[Order article via Infotrieve]
- Raisz, L. G., and Fall, P. M. (1990)
Endocrinology 126,
16541659[Abstract]
- Flanagan, A. M., and Chambers, T. J. (1992)
Endocrinology 130,
443448[Abstract]
- Nagata, T., Kaho, K., Nishikawa, S., Shinihara, H., Wakano, Y., and
Ishida, H. (1994) Calcif. Tissue Int.
55,
451457[CrossRef][Medline]
[Order article via Infotrieve]
- Raisz, L. G., Fall, P. M., Petersem, D. N., Lichtler, A., and
Kream, B. E. (1993) Mol. Endocrinol.
7,
1722[Abstract]
- Fall, P. M., Breault, D. T., and Raisz, L. G. (1994)
J. Bone Miner. Res. 9,
19351943[Medline]
[Order article via Infotrieve]
- Watabe, A., Sugimoto, Y., Honda, A., Irie, A., Namba, T., Negishi,
M., Ito, S., Narumiya, S., and Ichikawa, A. (1993) J.
Biol. Chem. 268,
2017520178[Abstract/Free Full Text]
- Katsuyama, M., Nishigaki, N., Sugimoto, Y., Morimoto, K., Negishi,
M., Narumiya, S., and Ichikawa, A. (1995) FEBS
Lett. 372,
151156[CrossRef][Medline]
[Order article via Infotrieve]
- Sugimoto, Y., Namba, T., Honda, A., Hayashi, Y., Negishi, M.,
Ichikawa, A., and Narumiya, S. (1992) J. Biol.
Chem. 267,
64636466[Abstract/Free Full Text]
- Suda, M., Tanaka, K., Natsui, K., Usui, T., Tanaka, I., Fukushima,
M., Shigeno, C., Konishi, J., Narumiya, S., Chikawa, A., and Nakao, K.
(1996) Endocrinology
137,
16981705[Abstract]
- Yoshida, K., Oida, H., Kobayashi, T., Maruyama, T., Tanaka, M.,
Katayama, T., Yamaguchi, K., Segi, E., Tsuboyama, T., Matsushita, M., Ito, K.,
Ito, Y., Sugimoto, Y., Ushikubo, F., Ohchida, S., Kondo, K., Nakamura, T., and
Narumiya, S. (2002) Proc. Natl. Acad. U. S.
A. 99,
45804585[Abstract/Free Full Text]
- Sakuma, Y., Tanaka, K., Suda, M., Komatsu, Y., Yasoda, A., Miura,
M., Ozawa, A., Narumiya, S., Sugimoto, Y., Ichikawa, A., Ushikubo, F., and
Nakao, K. (2000) Infect. Immun.
68,
68196825[Abstract/Free Full Text]
- Oldberg, Å., Franzén, A., and Heinegård, D.
(1988) J. Biol. Chem.
263,
1943019432[Abstract/Free Full Text]
- Ogata, Y., Yamauchi, M., Kim, R. H., Li, J. J., Freedman, L. P.,
and Sodek, J. (1995) Eur. J. Biochem.
230,
183192[Medline]
[Order article via Infotrieve]
- Ganss, B., Kim, R. H., and Sodek, J. (1999)
Crit. Rev. Oral Biol. Med.
10,
7998[Abstract]
- Chen, J., Shapiro, H. S., Wrana, J. L., Reimer, S., Heersche, J. N.
M., and Sodek, J. (1991) Matrix
11,
133143[Medline]
[Order article via Infotrieve]
- Chen, J., Shapiro, H. S., and Sodek, J. (1992)
J. Bone Miner. Res. 7,
987997[Medline]
[Order article via Infotrieve]
- Hunter, G. K., and Goldberg, H. A. (1993)
Proc. Nathl. Acad. Sci. U. S. A.
90,
85628565[Abstract/Free Full Text]
- Waltregny, D., Bellahcène, A., de Leval, X., Florkin, B.,
Weidle, U., and Castronovo, V. (2000) J. Bone Miner.
Res. 15,
834843[CrossRef][Medline]
[Order article via Infotrieve]
- Ibrahim, T., Leong, I., Sanchez-Sweatman, O., Khokha, R., Sodek,
J., Tenenbaum, H. C., Ganss, B., and Cheifetz, S. (2000)
Clin. Exp. Metastasis
18,
253260[CrossRef][Medline]
[Order article via Infotrieve]
- Li, J. J., and Sodek, J. (1993) Biochem.
J. 289,
625629[Medline]
[Order article via Infotrieve]
- Kerr, J. M., Fisher, L. W., Termine, J. D., Wang, M. G., Mcbride,
O. W., and Young, M. F. (1993) Genomics
17,
408415[CrossRef][Medline]
[Order article via Infotrieve]
- Kim, R. H., Shapiro, H. S., Li, J. J., Wrana, J. L., and Sodek, J.
(1994) Matrix Biol.
14,
3140[CrossRef][Medline]
[Order article via Infotrieve]
- Benson, M. D., Aubin, J. E., Xiao, G., Thomas, P. E., and
Franceschi, R. T. (1999) J. Bone Miner.
Res. 14,
396405[CrossRef][Medline]
[Order article via Infotrieve]
- Li, J. J., Kim, R. H., and Sodek, J. (1995)
Biochem. J. 310,
3340[Medline]
[Order article via Infotrieve]
- Kim, R. H., Li, J. J., Ogata, Y., Yamauchi, M., Freedman, L. P.,
and Sodek, J. (1996) Biochem. J.
318,
219226[Medline]
[Order article via Infotrieve]
- Kim, R. H., and Sodek, J. (1999) Cancer
Res. 59,
565571[Abstract/Free Full Text]
- Shimizu, E., and Ogata, Y. (2002) J. Cell.
Biochem. 86,
3544[CrossRef][Medline]
[Order article via Infotrieve]
- Shimizu-Sasaki, E., Yamazaki, M., Furuyama, S., Sugiya, H., Sodek,
J., and Ogata, Y. (2001) J. Biol. Chem.
276,
54595466[Abstract/Free Full Text]
- Samoto, H., Shimizu, E., Matsuda-Honjyo, Y., Saito, R., Yamazaki,
M., Kasai, K., Furuyama, S., Sugiya, H., Sodek, J., and Ogata, Y.
(2002) J. Cell. Biochem.
87,
313323[CrossRef][Medline]
[Order article via Infotrieve]
- Ogata, Y., Niisato, N., Furuyama, S., Cheifetz, S., Kim, R. H.,
Sugiya, H., and Sodek, J. (1997) J. Cell.
Biochem. 65,
501512[CrossRef][Medline]
[Order article via Infotrieve]
- Ogata, Y., Nakao, S., Kim, R. H., Li, J. J., Furuyama, S., Sugiya,
H., and Sodek, J. (2000) Matrix Biol.
19,
395407[CrossRef][Medline]
[Order article via Infotrieve]
- Benson, M. D., Bargeon, J. L., Xiao, G., Thomas, P. E., Kim, A.,
Cui, Y., and Franceschi, R. T. (2000) J. Biol.
Chem. 275,
1390713917[Abstract/Free Full Text]