JBC Transcription and Nuclear Factor Monoclonals

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M304568200 on May 21, 2003

J. Biol. Chem., Vol. 278, Issue 31, 28765-28770, August 1, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/31/28765    most recent
M304568200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhao, A.
Right arrow Articles by Cui, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhao, A.
Right arrow Articles by Cui, J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Human Kininogen Gene Is Transactivated by the Farnesoid X Receptor*

Annie Zhao {ddagger}, Jane-L. Lew {ddagger}, Li Huang {ddagger}, Jinghua Yu {ddagger}, Theresa Zhang §, Yaroslav Hrywna ¶, John R. Thompson ¶, Nuria de Pedro ||, Richard A. Blevins §, Fernando Peláez ||, Samuel D. Wright {ddagger} and Jisong Cui {ddagger} **

From the Departments of {ddagger}Atherosclerosis and Endocrinology, §Bioinformatics, and Molecular Profiling, Merck Research Laboratories, Rahway, New Jersey 07065 and ||Merck Sharp & Dohme de España, S. A. Josefa Valcarcel 38, 28027 Madrid, Spain

Received for publication, May 1, 2003


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Human kininogen belongs to the plasma kallikreinkinin system. High molecular weight kininogen is the precursor for two-chain kinin-free kininogen and bradykinin. It has been shown that the two-chain kinin-free kininogen has the properties of anti-adhesion, anti-platelet aggregation, and anti-thrombosis, whereas bradykinin is a potent vasodilator and mediator of inflammation. In this study we show that the human kininogen gene is strongly up-regulated by agonists of the farnesoid X receptor (FXR), a nuclear receptor for bile acids. In primary human hepatocytes, both the endogenous FXR agonist chenodeoxycholate and synthetic FXR agonist GW4064 increased kininogen mRNA with a maximum induction of 8–10-fold. A more robust induction of kininogen expression was observed in HepG2 cells, where kininogen mRNA was increased by chenodeoxycholate or GW4064 up to 130–140-fold as shown by real time PCR. Northern blot analysis confirmed the up-regulation of kininogen expression by FXR agonists. To determine whether kininogen is a direct target of FXR, we examined the sequence of the kininogen promoter and identified a highly conserved FXR response element (inverted repeat, IR-1) in the proximity of the kininogen promoter (–66/–54). FXR/RXR{alpha} heterodimers specifically bind to this IR-1. A construct of a minimal promoter with the luciferase reporter containing this IR-1 was transactivated by FXR. Deletion or mutation of this IR-1 abolished FXR-mediated promoter activation, indicating that this IR-1 element is responsible for the promoter transactivation by FXR. We conclude that kininogen is a novel and direct target of FXR, and bile acids may play a role in the vasodilation and anti-coagulation processes.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Human kininogens are multi-domain plasma proteins that are primarily synthesized in the liver (1, 2). Both high molecular weight and low molecular weight kininogens are transcribed from a single gene via alternative splicing (3, 4). Human high molecular weight kininogen (HK)1 serves as a cofactor for activation of prekallikrein and Factor XI (5, 6). Activated prekallikrein cleaves HK, producing the two-chain kinin-free kininogen (HKa) and sequentially releasing the short-lived vasoactive agent bradykinin (7, 8). HKa has properties of anti-adhesion, anti-platelet aggregation, and anti-thrombosis, whereas bradykinin is a potent vasodilator and mediator of inflammation (9).

In the process of identifying a serum marker for activation of the farnesoid X receptor (FXR), we observed that expression of the human kininogen gene was significantly increased by FXR agonists in primary human hepatocytes and in HepG2 cells.2 Northern blot analysis confirmed the up-regulation of kininogen expression by FXR agonists.

FXR is a nuclear receptor for bile acids. The ligand-activated FXR regulates expression of a number of genes that are critically important for bile acid and cholesterol hemostasis (1013). FXR heterodimerizes with the 9-cis-retinoic acid receptor (RXR{alpha}) (14, 15), and the FXR/RXR{alpha} heterodimer activates gene transcription via binding to a specific DNA sequence comprised of two inverted hexamer-repeats separated by one nucleotide (IR-1) in the target promoter. To date, there is only one reported case where FXR down-regulates gene expression (apoA-I) via FXR monomer or homodimer binding to an IR-1 (16).

To determine whether the kininogen gene is a direct target of FXR, we first cloned the kininogen promoter and then identified an IR-1 element in the promoter. We further demonstrate that the FXR/RXR{alpha} heterodimer binds to the IR-1 in the kininogen promoter, and this binding is essential for FXR-mediated promoter activation. Mutation of this IR-1 abolished its binding to FXR/RXR{alpha} heterodimer and also abolished FXR mediated promoter activation. We conclude that the human kininogen gene is directly transactivated by FXR via the IR-1 element in the kininogen promoter. Results from this study suggest that FXR and bile acids may play an important role in regulation of the plasma kallikrein-kinin system.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Reagents—The following reagents were obtained from Invitrogen: DMEM and Optimem I; regular fetal bovine serum (FBS) and charcoal-stripped FBS (CS-FBS); TRIZOL reagents; T4 polynucleotide kinase; PCR Supermix; oligonucleotide primers for gene cloning. [{gamma}-32P]ATP (3000 mCi/mmol) was obtained from Amersham Biosciences. The TNT T7 quick coupled transcription/translation kit was from Promega (Madison, WI). The QuikChange mutagenesis kit was obtained from Stratagene Inc. FuGENE 6 transfection reagent was obtained from Roche Applied Science. The reagents for {beta}-galactosidase and luciferase assays were purchased from Promega. CDCA was obtained from Steraloids, Inc. (Newport, RI). GW4064 was synthesized at Merck. TaqMan reagents for cDNA synthesis and real time PCR and TaqMan oligonucleotide primers and probes for human kininogen were purchased from Applied Biosystems (Foster City, CA).

Kininogen Promoter and Reporter Plasmid Constructs—Comparison of human kininogen cDNA sequence by the BLAST search revealed that one BAC clone (GenBankTM accession number NT_005962 [GenBank] ) contained region 5'-upstream to the untranslated cDNA sequence. The 1-kb fragment (–962/+142) containing the kininogen promoter was amplified by PCR and subcloned into the pGL3 enhancer plasmid vector (Promega) at the NheI/HindIII sites. Similarly, the –106/+142 and –54/+142 fragments were also amplified by PCR and subcloned into the pGL3 enhancer plasmid. The integrity of sequence for all constructs was confirmed by DNA sequencing. The expression vector pcDNA3.1-hFXR was constructed by inserting the cDNA fragment encoding the full-length human FXR (accession number NP_005114 [GenBank] ) into pcDNA3.1 at NheI/HindIII. pGST-hFXR-LBD, pcDNA3.1-hRXR{alpha}, and pCMV-lacZ were described previously (17).

Kininogen Promoter Mutants—FXRE in the kininogen promoter was mutated using the QuikChange mutagenesis kit (Stratagene). PCRs were carried out according to the manufacturer's directions. The sense primer was 5'-ATGCAAATGAGCAAATTAACAATTCCAGTGTTGC-3' and the antisense primer was 5'-GCAACACTGGAATTGTTAATTTGCTCATTTGCAT-3' (the altered bases are in bold and underlined type).

Electrophoretic Mobility Shift Assays (EMSAs)—cDNA encoding human FXR or RXR{alpha} was transcribed and translated using the TNT quick coupled transcription/translation system (Promega) according to the manufacturer's instructions. Double-stranded oligonucleotide probes for the EMSAs were end-labeled with [{gamma}-32P]ATP (3000 mCi/mmol) by T4 polynucleotide kinase. The EMSA was performed as previously described (18) with minor modifications. Briefly, 2 µl of the in vitro translated FXR or RXR protein alone or together were added to 20 µl of reaction containing 10 mM Tris (pH 8.0), 40 mM KCl, 0.05% Nonidet P-40, 6% glycerol, 1 mM dithiothreitol, and 1 µg of poly(dI-dC). Cold competitor oligonucleotides including the wild type kininogen FXRE (5'-CAAATGAGCAGGTTAACAACCCCAGTG-3'), mutated kininogen FXRE (5'-ATGCAAATGAGCAaaTTAACAAttCCAGTGTTGC-3') or idealized IR-1 containing an IR-1 consensus (5'-GATGGGCCAAGGTCAATGACCTCGGGG-3') were added in 50x, 100x, and 200x excess. After a 20-min incubation on ice, 10 fmol of the 5' end-labeled kininogen FXRE probes were added and continuously incubated for an additional 20 min on ice. DNA-protein complexes were resolved by electrophoresis on a 4% native polyacrylamide gel containing 0.5x TBE (0.89 M Tris, 0.89 M boric acid, 0.02 M disodium EDTA for 10x TBE). The gel was dried and exposed to x-ray film.

FXR Transactivation—HepG2 cells were transfected in 96-well plates using the FuGENE 6 transfection reagent as previously described (17). Transfection mixes for each well contained 0.405 µl of FuGENE 6, 10.4 ng of pcDNA3.1-hFXR, 10.4 ng of pcDNA3.1-hRXR{alpha}, 10.4 ng of pGL3 enhancer-kininogen-Promoter-Luc, and 103.8 ng of pCMV-lacZ. The treatment of transfected cells with various FXR ligands, assays for luciferase, and {beta}-galactosidase activities were performed following the same protocols as previously described (17). This assay was performed at Merck Sharp & Dohme de España in Spain.

Treatment of HepG2 Cells for Gene Expression—HepG2 cells were maintained in DMEM containing 10% FBS, 1% penicillin/streptomycin, 1 mM sodium pyruvate, and 5 mM HEPES. For determination of gene specific expression by TaqMan analysis, the cells were seeded in 6-well plates at a density of 1 million cells/well in DMEM containing 10% FBS, 1% penicillin/streptomycin, and 25 mM HEPES. 24 h after seeding, the cells were treated with various concentrations of compounds in DMEM containing 0.5% CS-FBS, 1% penicillin/streptomycin, and 5 mM HEPES. Unless specified, the cells were treated for 24 h.

RNA Isolation and Real Time Quantitative PCR—Total RNA was extracted from the cultured cells using the TRIZOL reagent according to the manufacturer's instructions. Reverse transcription reactions and TaqMan PCRs were performed according to the manufacturer's instructions (Applied Biosystems). Sequence-specific amplification was detected with an increased fluorescent signal of carboxyfluorescein (reporter dye) during the amplification cycles. Amplification of human 18 S RNA was used in the same reaction of all samples as an internal control. Gene-specific mRNA was subsequently normalized to 18 S RNA. Levels of human kininogen mRNA were expressed as fold difference of compound-treated cells against Me2SO-treated cells.

Northern Blot Analysis—Protocols for treatment of HepG2 cells and isolation of total RNA were similar to that used in real time quantitative PCR. Total RNA (8 µg) was separated by electrophoresis on a 1% denaturing agarose gel with 1x formaldehyde/MOPS (Ambion) and then transferred to a nylon membrane (Nytran SuPerCharge; Schleicher & Schuell). The blots were hybridized with 32P-labeled cDNA probe of the human kininogen gene (GenBankTM accession number K02566 [GenBank] , bases 717–1274) and then reprobed with a radiolabeled cDNA probe of the {beta}-actin gene (Ambion).

TaqMan Primers and Probes—Oligonucleotide primers and probe for human kininogen were designed using Primer Express program and were synthesized by Applied Biosystems. These sequences (5' to 3') are as follows: forward primer, AGACACGGCATTCAGTACTTTAACA; probe, 6-carboxyfluorescein-CAACACTCAACATTCCTCCCTCTTCATGC-N,N,N,N-tetramethyl-6-carboxyrhodamine; and reverse primer, TGGGCCCGTTTTACTTCATT. Primers and probe for human 18 S RNA were also purchased from Applied Biosystems.

Sequence Analysis of the Genomic Region of Kininogen—BLAST searches were performed to identify mRNAs and expressed sequence tags of kininogen and to identify genomic regions encoding human and mouse kininogen (19). The genomic sequences of human and mouse kininogen were compared using GLASS (20). Putative binding sites for transcription factors were identified by searching against the TRANS-FAC data base (21) and the position weight matrices constructed internally.

Previous studies have identified multiple transcription start sites for human kininogen (4, 22). To better define the transcription start sites of kininogen, we blasted the known human kininogen mRNA, NM_000893 [GenBank] , against human mRNA and expressed sequence tag data bases. More than 40 transcripts were identified. Mapping those transcripts to human genome indicated about 10 putative transcription start sites, among which the most upstream transcription start site was located 185 bp upstream from the translation start site. In our study, we refer to this site as the transcription start site of human kininogen.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Endogenous Expression of Kininogen Is Increased by FXR Agonists in Primary Human Hepatocytes—Microarray analysis revealed that expression of kininogen is up-regulated by FXR agonists.2 To confirm this observation, primary human hepatocytes were treated with various concentrations of CDCA, the most potent bile acid agonist of FXR, and the endogenous expression of kininogen was determined by real time PCR (TaqMan). Consistent with the microarray result, kininogen mRNA was increased by CDCA in a dose-dependent manner with a half maximum (EC50) around 25 µM and a maximum induction of 8–10-fold (Fig. 1A). This EC50 value correlates with the EC50 of CDCA in the FXR transactivation assay (23).



View larger version (40K):
[in this window]
[in a new window]
 
FIG. 1.
Induction of human kininogen mRNA by FXR agonists in primary human hepatocytes. Primary human hepatocytes at a density of 2 million cells/well in 6-well plates were treated with various concentrations of CDCA (A) or GW4064 (B) for 24 h or treated with 60 µM CDCA or 5 µM GW4064 at various time points (C) in DMEM containing 0.5% CS-FBS. Total RNA was prepared and kininogen mRNA was analyzed by TaqMan PCR as described under "Materials and Methods." The results are normalized as fold of control (treated cells versus vehicle). Each value represents the mean ± S.D. of duplicate determinations.

 

GW4064 is a potent and selective synthetic agonist of FXR (24). To confirm that kininogen up-regulation by CDCA was mediated through FXR, primary human hepatocytes were treated with GW4064 and assayed for kininogen expression. Similar to the results of CDCA treatment, GW4064 also effectively increased kininogen mRNA in a dose-dependent manner with an EC50 about 0.1 µM (Fig. 1B). Again, this value correlates well with the potency in FXR transactivation (23). Taken together, these results suggest that kininogen up-regulation is mediated by FXR.

Primary human hepatocytes were treated with 60 µM CDCA and 5 µM GW4064 for 3, 6, 12, 24, and 48 h to define the time kinetics for FXR-mediated kininogen gene regulation. Up-regulation was readily detectable within 3 h with a maximum induction of 1.5–1.8-fold, which increased to 3-fold at 6 h and 3.8-fold at 12 h (Fig. 1C). 24-h treatment yielded a 4–5-fold induction, which increased slightly at 48 h (Fig. 1C). The fact that kininogen up-regulation by FXR agonists was readily detectable at as early as 3 h suggests kininogen as a direct target of FXR.

Endogenous Expression of Kininogen Is Increased by FXR Agonists in HepG2 Cells—HepG2 is a human hepatoma cell line that has been used to study FXR-mediated gene regulation. In HepG2, kininogen was expressed at a moderate level with an average threshold cycle of 24 in untreated cells (data not shown). This level of expression was comparable with that in primary hepatocytes (data not shown). Despite the relatively high basal expression in HepG2 cells, kininogen mRNA was robustly up-regulated by the FXR agonist CDCA or GW4064 in a dose-dependent fashion with a maximum induction of 130–140-fold (Fig. 2).



View larger version (18K):
[in this window]
[in a new window]
 
FIG. 2.
Induction of human kininogen mRNA by FXR agonists in HepG2 cells. HepG2 cells at a density of 1 million cells/well in 6-well plates were treated with various concentrations of CDCA (A) or GW4064 (B) for 24 h in DMEM containing 0.5% CS-FBS. Total RNA was prepared, and kininogen mRNA was analyzed by TaqMan PCR as described under "Materials and Methods." The results are normalized as fold of control (treated cells versus vehicle). Each value represents the mean ± S.D. of four determinations.

 

Northern blot analysis was also carried out to confirm the results obtained from the real time PCR. Treatment of HepG2 cells with 50 µM CDCA or 1 µM GW4064 resulted in an over 100-fold increase of two RNA bands at 3.6 and 1.5 kb, respectively, when probed with the radiolabeled human kininogen cDNA probe (Fig. 3). The size of these two bands are consistent with those previously reported for high molecular weight and low molecular weight kininogen mRNA (22). One minor band at 2.6 kb was also slightly induced by FXR agonists (Fig. 3). This RNA species is presumably the result of an alternative splicing of the kininogen gene. Northern blot analyses confirm that endogenous expression of kininogen is induced by FXR agonists.



View larger version (59K):
[in this window]
[in a new window]
 
FIG. 3.
Northern blot analysis for induction of human kininogen mRNA by FXR agonists. HepG2 cells at a density of 7 million cells/75-cm2 flask were treated with 50 µM CDCA or 1 µM GW4064 for 24 h in DMEM containing 0.5% CS-FBS. Total RNA was isolated, and 8 µg was separated on an 1% agarose/formaldehyde gel, transferred to nylon membrane, and hybridized to the kininogen or {beta}-actin radiolabeled cDNA probe as described under "Materials and Methods." DMSO, dimethyl sulfoxide.

 

The Kininogen Promoter Contains an IR-1 That Binds Specifically to the FXR/RXR{alpha} Heterodimer—The FXR/RXR{alpha} heterodimer binds to specific DNA sequences in promoters of target genes to regulate gene transcription. The DNA sequences recognized by the heterodimer comprise of an inverted repeat separated by a single nucleotide (IR-1). A data base search using the IR-1 consensus sequence identified a highly conserved IR-1 element in the proximal promoter of kininogen (–66 to –54). To examine whether the FXR/RXR{alpha} heterodimer binds to this IR-1 element, an EMSA was performed using the 32P-labeled IR-1 from the human kininogen promoter in the presence of in vitro translated human FXR and/or human RXR{alpha} proteins. The results of EMSAs are shown in Fig. 4A. Neither FXR nor RXR{alpha} alone bound to the probe (lanes 1 and 2). However, when both FXR and RXR{alpha} proteins were present, a complex was formed, indicating that it is the FXR/RXR{alpha} heterodimer that is bound by the IR-1 element (lane 3). Competition analysis showed that an unlabeled IR-1 oligonucleotide from kininogen promoter (Fig. 4B, WT) at a 50-, 100-, or 200-fold molar excess was able to compete for binding in a dose-dependent manner (lanes 4–6), whereas the same molar excess of a mutated oligonucleotide (Fig. 4B, Mut) failed to compete for binding (lanes 7–9). Moreover, an ideal IR-1 sequence (Fig. 4B, IR-1) efficiently competed for binding at a 50-, 100-, or 200-fold molar excess (lanes 10–12). These results indicate that the IR-1 element in the kininogen promoter is an authentic FXR/RXR{alpha} binding cis-element.



View larger version (45K):
[in this window]
[in a new window]
 
FIG. 4.
IR-1 element in human kininogen promoter binds to FXR/RXR{alpha} heterodimer. A, EMSAs were performed as described under "Materials and Methods" with in vitro translated FXR (lane 1), RXR{alpha} (lane 2), or FXR/RXR{alpha} (lanes 3–12) with the wild type IR-1 in human kininogen promoter as probe. Competition analysis was performed with a 50-, 100-, or 200-fold excess of wild-type kininogen IR-1 (WT, lanes 4–6), mutated IR-1 (Mut, lanes 7–9) or idealized IR-1 (IR-1, lanes 10–12). Sp, specific DNA-protein complex; NSp, nonspecific complex. B, the sequences of oligonucleotides used in this study. The IR-1 element is underlined, and the altered bases are shown with lowercase letters.

 

The IR-1 Element in Human Kininogen Promoter Is Necessary for FXR/RXR{alpha}-mediated Promoter Activation—To determine whether the IR-1 element is necessary for FXR/RXR{alpha}-mediated kininogen promoter activation, an 1104-bp fragment of the kininogen promoter (–962 to +142) was cloned upstream of a luciferase reporter gene (Fig. 5A). This construct (Kin962-Luc) was transiently transfected into HepG2 cells together with FXR and RXR{alpha} expression vectors in the presence or absence of 60 µM CDCA (Fig. 5B) or 1 µM GW4064 (Fig. 5C). Luciferase activity was markedly induced by 60 µM CDCA (12–13-fold) and 1 µM GW4064 (15–17-fold) compared with the Me2SO control.



View larger version (28K):
[in this window]
[in a new window]
 
FIG. 5.
Deletion-mutation analysis of the human kininogen promoter. A, schematic presentation of different kininogen promoter constructs. The constructs of Kin962-Luc and Kin106-Luc contain the IR-1 sequence localized between –66 and –54. The Kin52-Luc construct is a deletion of the 5' end of the promoter that lacks the IR-1. The Kinmut-Luc construct is the same as Kin106-Luc but with a mutated IR-1 (mutation underlined). B and C, HepG2 cells (3.2 x 104 cells/well of 96-well plates) were co-transfected with FXR and RXR{alpha} expression vectors and the different kininogen promoter construct as indicated A. The cells were then treated with 60 µM CDCA (B) or 1 µM GW4064 (C) for 40–48 h, and the cell lysate was used for determination of luciferase and {beta}-galactosidase activities as described under "Materials and Methods." The luciferase activities were normalized to {beta}-galactosidase activities individually for each well. Each value represents the mean ± S.D. of six determinations. DMSO, dimethyl sulfoxide.

 

To further define the importance of IR-1 element in kininogen promoter activation, two other reporter constructs, Kin106-Luc and Kin52-Luc, were also generated (Fig. 5A). Kin106-Luc is a minimal promoter that contained the IR-1 element, whereas Kin52-Luc contained the deletion of IR-1 and upstream sequences (Fig. 5A). HepG2 cells were transfected with each of the constructs along with FXR and RXR{alpha} expression vectors. Luciferase activity was significantly induced by 60 µM CDCA (10–11-fold) or 1 µM GW4064 (15–17-fold) for the Kin106-Luc construct, whereas only minimal induction was observed for Kin52-Luc, which was similar to that of the pGL3 vector control (Fig. 5, B and C). These results indicate that the IR-1 element is necessary for FXR ligand-induced kininogen promoter activation.

Mutation of Kininogen IR-1 Abolishes Promoter Transactivation by FXR/RXR{alpha}To demonstrate further that the IR-1 element at –66 to –54 is responsible for the transactivation of the kininogen promoter, mutations in both halves of the IR-1 element (AGGTTAACAACCC to AaaTTAACAAttC; mutated bases in lowercase type) were created in the Kin106-Luc construct using site-directed mutagenesis, and the mutant construct (Kinmut-Luc) was transfected into HepG2 cells together with FXR and RXR{alpha} expression vectors. Compared with Kin106-Luc, Kinmut-Luc only showed a modest residual induction by 60 µM CDCA (Fig. 5B) and 1 µM GW4064 (Fig. 5C). This induction was indistinguishable from that of the construct lacking the IR-1 element (Kin52-Luc) and the pGL3 vector control (Figs. 5, B and C). This result indicates that the integrity of the IR-1 element in the kininogen promoter is essential for the promoter transactivation by FXR/RXR{alpha}.

The FXR and RXR{alpha} Ligands Additively Activate the Kininogen Promoter—It has been previously shown that several FXR targets are regulated by both bile acids and the RXR ligand, 9-cis-retinoic acid (RA) (18, 25). To determine whether the kininogen promoter is also regulated by the RXR{alpha} ligand, the Kin106-Luc construct (a minimal promoter containing the IR-1 element) was transiently transfected into HepG2 cells together with the FXR and RXR{alpha} expression vectors. As expected, 9-cis-RA alone efficaciously increased the luciferase activity in a dose-dependent manner with an EC50 of 296 nM and a maximum induction of 20-fold (Fig. 6). In the presence of 50 nM GW4064, this induction was further increased by 2–3-fold compared with that induced by 9-cis-RA alone (Fig. 6), indicating that FXR and RXR{alpha} ligands work additively on activation of kininogen promoter. These results confirm that FXR is a permissive receptor and that it is the FXR/RXR{alpha} heterodimer that transactivates the kininogen promoter.



View larger version (25K):
[in this window]
[in a new window]
 
FIG. 6.
GW4064 and 9-cis-RA additively increase transcription of the kininogen promoter. HepG2 cells (3.2 x 104 cells/well of 96-well plates) were co-transfected with FXR/RXR{alpha} expression vectors and the Kin106-Luc construct (see Fig 5A). The cells were then treated with various concentrations of 9-cis-RA in the presence or absence of 50 nM GW4064 for 40–48 h, and the cell lysate was used for determination of luciferase and {beta}-galactosidase activities as described under "Materials and Methods." Luciferase activities were normalized to {beta}-galactosidase activities individually for each well. Each value represents the mean ± S.D. of six determinations.

 


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
HKa has been shown to exert important functions in anti-adhesion (2629), anti-inflammation (30), and anti-platelet aggregation (31). In addition, HKa has also been shown to be a mediator and modulator of vascular inflammation and local injury (9). The short-lived vasodilator bradykinin stimulates the bradykinin B2 receptor on endothelial cells to produce nitric oxide (32, 33). Bradykinin was reported to significantly affect renal hemodynamic and excretory function (34).

Although the structure and function of human kininogens have been extensively studied for over three decades, little is known about the gene regulation. Glucocorticoid was reported to increase HK synthesis in cultured hepatocytes (35). Here we report the discovery of the kininogen gene as a novel direct target of FXR.

FXR, a bile acid sensor, regulates expression of many genes whose products control bile acid and cholesterol homeostasis (1013). It has been shown that FXR decreases transcription of cholesterol 7{alpha}-hydroxylase (3639), sterol 12 {alpha}-hydroxylase (40), the Na+/taurocholate co-transporting polypeptide (41), and apolipoprotein A-I (16). FXR induces expression of intestinal bile acid binding protein (18), phospholipid transfer protein (42), bile salt export pump (23, 25), dehydroepiandrosterone sulfotransferase (43), and apolipoprotein C-II (44).

Microarray analysis indicated that expression of the kininogen gene was significantly increased by FXR agonists.2 Consistent with the microarray results, we have demonstrated here that the endogenous kininogen mRNA was effectively increased by FXR agonists in primary human hepatocytes and HepG2 cells. We further demonstrate that the kininogen promoter is transactivated by FXR and that the IR-1 element in the kininogen promoter is necessary and essential for this gene regulation.

One potential physiological role for FXR mediated up-regulation of the kininogen expression may be to increase bradykinin, resulting in modulation of renal excretory function. It has been previously documented that bradykinin stimulates water transport in feline gallbladder (45). It is possible that when hepatic bile acid concentration is high, activated FXR on the one hand shuts down bile acid synthesis by down-regulation of cholesterol 7{alpha}-hydroxylase, whereas on the other hand increases bile acid secretion via up-regulation of bile salt export pump and increases fluid transport by up-regulation of kininogen mRNA to increase production of bradykinin. In addition to the role of bradykinin in the gallbladder, the increased production of HKa upon FXR activation may be beneficial for anti-adhesion and anti-thrombosis. More studies are needed to elucidate this aspect of FXR function. Taken together, the findings described in this study increase the understanding of the physiological consequences of FXR activation and implicate a coordinated regulation in bile acid/cholesterol metabolism, fluid transport, inflammation, and thrombosis.


    FOOTNOTES
 
* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

** To whom correspondence should be addressed: Dept. of Atherosclerosis and Endocrinology, Merck Research Laboratories, 126 E. Lincoln Ave., P.O. Box 2000, RY80W-107, Rahway, NJ 07065. Tel.: 732-594-6369; Fax: 732-594-7926; E-mail: jisong_cui{at}merck.com.

1 The abbreviations used are: HK, high molecular weight kininogen; HKa, two-chain kinin-free kininogen; FXR, the farnesoid X receptor; FXRE, FXR response element; CDCA, chenodeoxycholate; RXR{alpha}, retinoid X receptor {alpha}; IR-1, inverted repeat separated by a single nucleotide; EMSA, electrophoretic mobility shift assay; FBS, fetal bovine serum; CS-FBS, charcoal-stripped FBS; DMEM, Dulbecco's modified Eagle's medium; MOPS, 4-morpholinepropanesulfonic acid; RA, retinoic acid. Back

2 J. Cui, L. Huang, A. Zhao, J. Lew, and S. Wright, unpublished data. Back


    ACKNOWLEDGMENTS
 
We thank Dr. Jilly Evans for critically reading the manuscript.



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Schmaier, A. H., Zuckerberg, A., Silverman, C., Kuchibhotla, J., Tuszynski, G. P., and Colman, R. W. (1983) J. Clin. Invest. 71, 1477–1489[Medline] [Order article via Infotrieve]
  2. Gustafson, E. J., Schmaier, A. H., Wachtfogel, Y. T., Kaufman, N., Kucich, U., and Colman, R. W. (1989) J. Clin. Invest. 84, 28–35[Medline] [Order article via Infotrieve]
  3. Fong, D., Smith, D. I., and Hsieh, W. T. (1991) Hum. Genet. 87, 189–192[CrossRef][Medline] [Order article via Infotrieve]
  4. Kitamura, N., Kitagawa, H., Fukushima, D., Takagaki, Y., Miyata, T., and Nakanishi, S. (1985) J. Biol. Chem. 260, 8610–8617[Abstract/Free Full Text]
  5. Scott, C. F., and Colman, R. W. (1980) J. Clin. Invest. 65, 413–421[Medline] [Order article via Infotrieve]
  6. Thompson, R. E., Mandle, R., Jr., and Kaplan, A. P. (1977) J. Clin. Invest. 60, 1376–1380[Medline] [Order article via Infotrieve]
  7. Scott, C. F., Silver, L. D., Schapira, M., and Colman, R. W. (1984) J. Clin. Invest. 73, 954–962[Medline] [Order article via Infotrieve]
  8. Nishikawa, K., Shibayama, Y., Kuna, P., Calcaterra, E., Kaplan, A. P., and Reddigari, S. R. (1992) Blood 80, 1980–1988[Abstract/Free Full Text]
  9. Margolius, H. S. (1995) Hypertension 26, 221–229[Abstract/Free Full Text]
  10. Makishima, M., Okamoto, A. Y., Repa, J. J., Tu, H., Learned, R. M., Luk, A., Hull, M. V., Lustig, K. D., Mangelsdorf, D. J., and Shan, B. (1999) Science 284, 1362–1365[Abstract/Free Full Text]
  11. Parks, D. J., Blanchard, S. G., Bledsoe, R. K., Chandra, G., Consler, T. G., Kliewer, S. A., Stimmel, J. B., Willson, T. M., Zavacki, A. M., Moore, D. D., and Lehmann, J. M. (1999) Science 284, 1365–1368[Abstract/Free Full Text]
  12. Wang, H., Chen, J., Hollister, K., Sowers, L. C., and Forman, B. M. (1999) Mol. Cell 3, 543–553[Medline] [Order article via Infotrieve]
  13. Tu, H., Okamoto, A. Y., and Shan, B. (2000) Trends Cardiovasc. Med. 10, 30–35[CrossRef][Medline] [Order article via Infotrieve]
  14. Forman, B. M., Goode, E., Chen, J., Oro, A. E., Bradley, D. J., Perlmann, T., Noonan, D. J., Burka, L. T., McMorris, T., and Lamph, W. W. (1995) Cell 81, 687–693[CrossRef][Medline] [Order article via Infotrieve]
  15. Zavacki, A. M., Lehmann, J. M., Seol, W., Willson, T. M., Kliewer, S. A., and Moore, D. D. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 7909–7914[Abstract/Free Full Text]
  16. Claudel, T., Sturm, E., Duez, H., Torra, I. P., Sirvent, A., Kosykh, V., Fruchart, J. C., Dallongeville, J., Hum, D. W., Kuipers, F., and Staels, B. (2002) J. Clin. Invest. 109, 961–971[CrossRef][Medline] [Order article via Infotrieve]
  17. Cui, J., Heard, T. S., Yu, J., Lo, J. L., Huang, L., Li, Y., Schaeffer, J. M., and Wright, S. D. (2002) J. Biol. Chem. 277, 25963–25969[Abstract/Free Full Text]
  18. Grober, J., Zaghini, I., Fujii, H., Jones, S. A., Kliewer, S. A., Willson, T. M., Ono, T., and Besnard, P. (1999) J. Biol. Chem. 274, 29749–29754[Abstract/Free Full Text]
  19. Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D. J. (1997) Nucleic Acids Res. 25, 3389–3402[Abstract/Free Full Text]
  20. Batzoglou, S., Pachter, L., Mesirov, J. P., Berger, B., and Lander, E. S. (2000) Genome Res. 10, 950–958[Abstract/Free Full Text]
  21. Wingender, E., Chen, X., Fricke, E., Geffers, R., Hehl, R., Liebich, I., Krull, M., Matys, V., Michael, H., Ohnhauser, R., Pruss, M., Schacherer, F., Thiele, S., and Urbach, S. (2001) Nucleic Acids Res. 29, 281–283[Abstract/Free Full Text]
  22. Takagaki, Y., Kitamura, N., and Nakanishi, S. (1985) J. Biol. Chem. 260, 8601–8609[Abstract/Free Full Text]
  23. Yu, J., Lo, J. L., Huang, L., Zhao, A., Metzger, E., Adams, A., Meinke, P. T., Wright, S. D., and Cui, J. (2002) J. Biol. Chem. 277, 31441–31447[Abstract/Free Full Text]
  24. Willson, T. M., Jones, S. A., Moore, J. T., and Kliewer, S. A. (2001) Med. Res. Rev. 21, 513–522[CrossRef][Medline] [Order article via Infotrieve]
  25. Ananthanarayanan, M., Balasubramanian, N., Makishima, M., Mangelsdorf, D. J., and Suchy, F. J. (2001) J. Biol. Chem. 276, 28857–28865[Abstract/Free Full Text]
  26. Chavakis, T., Pixley, R. A., Isordia-Salas, I., Colman, R. W., and Preissner, K. T. (2002) J. Biol. Chem. 277, 32677–32682[Abstract/Free Full Text]
  27. Chavakis, T., Kanse, S. M., Lupu, F., Hammes, H. P., Muller-Esterl, W., Pixley, R. A., Colman, R. W., and Preissner, K. T. (2000) Blood 96, 514–522[Abstract/Free Full Text]
  28. Asakura, S., Hurley, R. W., Skorstengaard, K., Ohkubo, I., and Mosher, D. F. (1992) J. Cell Biol. 116, 465–476[Abstract/Free Full Text]
  29. Asakura, S., Yang, W., Sottile, J., Zhang, Q., Jin, Y., Ohkubo, I., Sasaki, M., Matsuda, M., Hirata, H., and Mosher, D. F. (1998) J. Biochem. (Tokyo) 124, 473–484[Abstract/Free Full Text]
  30. Chavakis, T., Kanse, S. M., Pixley, R. A., May, A. E., Isordia-Salas, I., Colman, R. W., and Preissner, K. T. (2001) FASEB J. 15, 2365–2376[Abstract/Free Full Text]
  31. Kunapuli, S. P., Bradford, H. N., Jameson, B. A., DeLa Cadena, R. A., Rick, L., Wassell, R. P., and Colman, R. W. (1996) J. Biol. Chem. 271, 11228–11235[Abstract/Free Full Text]
  32. Zhao, Y., Qiu, Q., Mahdi, F., Shariat-Madar, Z., Rojkjaer, R., and Schmaier, A. H. (2001) Am. J. Physiol. 280, H1821–H1829
  33. Palmer, R. M., Ferrige, A. G., and Moncada, S. (1987) Nature 327, 524–526[CrossRef][Medline] [Order article via Infotrieve]
  34. Majima, M., Yoshida, O., Mihara, H., Muto, T., Mizogami, S., Kuribayashi, Y., Katori, M., and Oh-ishi, S. (1993) Hypertension 22, 705–714[Abstract/Free Full Text]
  35. Nakanishi, S. (1987) Physiol. Rev. 67, 1117–1142[Free Full Text]
  36. Chiang, J. Y., Kimmel, R., Weinberger, C., and Stroup, D. (2000) J. Biol. Chem. 275, 10918–10924[Abstract/Free Full Text]
  37. Bramlett, K. S., Yao, S., and Burris, T. P. (2000) Mol. Genet. Metab. 71, 609–615[CrossRef][Medline] [Order article via Infotrieve]
  38. Goodwin, B., Jones, S. A., Price, R. R., Watson, M. A., McKee, D. D., Moore, L. B., Galardi, C., Wilson, J. G., Lewis, M. C., Roth, M. E., Maloney, P. R., Willson, T. M., and Kliewer, S. A. (2000) Mol. Cell 6, 517–526[CrossRef][Medline] [Order article via Infotrieve]
  39. Lu, T. T., Makishima, M., Repa, J. J., Schoonjans, K., Kerr, T. A., Auwerx, J., and Mangelsdorf, D. J. (2000) Mol. Cell 6, 507–515[CrossRef][Medline] [Order article via Infotrieve]
  40. Zhang, M., and Chiang, J. Y. (2001) J. Biol. Chem. 276, 41690–41699[Abstract/Free Full Text]
  41. Denson, L. A., Sturm, E., Echevarria, W., Zimmerman, T. L., Makishima, M., Mangelsdorf, D. J., and Karpen, S. J. (2001) Gastroenterology 121, 140–147[CrossRef][Medline] [Order article via Infotrieve]
  42. Urizar, N. L., Dowhan, D. H., and Moore, D. D. (2000) J. Biol. Chem. 275, 39313–39317[Abstract/Free Full Text]
  43. Song, C. S., Echchgadda, I., Baek, B. S., Ahn, S. C., Oh, T., Roy, A. K., and Chatterjee, B. (2001) J. Biol. Chem. 276, 42549–42556[Abstract/Free Full Text]
  44. Kast, H. R., Nguyen, C. M., Sinal, C. J., Jones, S. A., Laffitte, B. A., Reue, K., Gonzalez, F. J., Willson, T. M., and Edwards, P. A. (2001) Mol. Endocrinol. 15, 1720–1728[Abstract/Free Full Text]
  45. German, D., Barcia, J., Brems, J., Merenda, G., and Kaminski, D. L. (1989) Dig. Dis. Sci. 34, 1770–1776[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
A. Das, M. E. Fernandez-Zapico, S. Cao, J. Yao, S. Fiorucci, R. P. Hebbel, R. Urrutia, and V. H. Shah
Disruption of an SP2/KLF6 Repression Complex by SHP Is Required for Farnesoid X Receptor-induced Endothelial Cell Migration
J. Biol. Chem., December 22, 2006; 281(51): 39105 - 39113.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
A. M. Anisfeld, H. R. Kast-Woelbern, H. Lee, Y. Zhang, F. Y. Lee, and P. A. Edwards
Activation of the nuclear receptor FXR induces fibrinogen expression: a new role for bile acid signaling
J. Lipid Res., March 1, 2005; 46(3): 458 - 468.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Shimamoto, J. Ishida, K. Yamagata, T. Saito, H. Kato, T. Matsuoka, K. Hirota, H. Daitoku, M. Nangaku, K. Yamagata, et al.
Inhibitory Effect of the Small Heterodimer Partner on Hepatocyte Nuclear Factor-4 Mediates Bile Acid-induced Repression of the Human Angiotensinogen Gene
J. Biol. Chem., February 27, 2004; 279(9): 7770 - 7776.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/31/28765    most recent
M304568200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhao, A.
Right arrow Articles by Cui, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhao, A.
Right arrow Articles by Cui, J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.