![]()
|
|
||||||||
J. Biol. Chem., Vol. 278, Issue 31, 28765-28770, August 1, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||







**
From the
Departments of
Atherosclerosis and
Endocrinology,
Bioinformatics, and
¶Molecular Profiling, Merck Research
Laboratories, Rahway, New Jersey 07065 and ||Merck
Sharp & Dohme de España, S. A. Josefa Valcarcel 38, 28027 Madrid,
Spain
Received for publication, May 1, 2003
| ABSTRACT |
|---|
|
|
|---|
heterodimers
specifically bind to this IR-1. A construct of a minimal promoter with the
luciferase reporter containing this IR-1 was transactivated by FXR. Deletion
or mutation of this IR-1 abolished FXR-mediated promoter activation,
indicating that this IR-1 element is responsible for the promoter
transactivation by FXR. We conclude that kininogen is a novel and
direct target of FXR, and bile acids may play a role in the vasodilation and
anti-coagulation processes. | INTRODUCTION |
|---|
|
|
|---|
In the process of identifying a serum marker for activation of the farnesoid X receptor (FXR), we observed that expression of the human kininogen gene was significantly increased by FXR agonists in primary human hepatocytes and in HepG2 cells.2 Northern blot analysis confirmed the up-regulation of kininogen expression by FXR agonists.
FXR is a nuclear receptor for bile acids. The ligand-activated FXR
regulates expression of a number of genes that are critically important for
bile acid and cholesterol hemostasis
(1013).
FXR heterodimerizes with the 9-cis-retinoic acid receptor
(RXR
) (14,
15), and the FXR/RXR
heterodimer activates gene transcription via binding to a specific DNA
sequence comprised of two inverted hexamer-repeats separated by one nucleotide
(IR-1) in the target promoter. To date, there is only one reported case where
FXR down-regulates gene expression (apoA-I) via FXR monomer or
homodimer binding to an IR-1
(16).
To determine whether the kininogen gene is a direct target of FXR,
we first cloned the kininogen promoter and then identified an IR-1
element in the promoter. We further demonstrate that the FXR/RXR
heterodimer binds to the IR-1 in the kininogen promoter, and this
binding is essential for FXR-mediated promoter activation. Mutation of this
IR-1 abolished its binding to FXR/RXR
heterodimer and also abolished
FXR mediated promoter activation. We conclude that the human
kininogen gene is directly transactivated by FXR via the IR-1 element
in the kininogen promoter. Results from this study suggest that FXR
and bile acids may play an important role in regulation of the plasma
kallikrein-kinin system.
| MATERIALS AND METHODS |
|---|
|
|
|---|
-32P]ATP (3000 mCi/mmol) was obtained from Amersham
Biosciences. The TNT T7 quick coupled transcription/translation kit was from
Promega (Madison, WI). The QuikChange mutagenesis kit was obtained from
Stratagene Inc. FuGENE 6 transfection reagent was obtained from Roche Applied
Science. The reagents for
-galactosidase and luciferase assays were
purchased from Promega. CDCA was obtained from Steraloids, Inc. (Newport, RI).
GW4064 was synthesized at Merck. TaqMan reagents for cDNA synthesis and real
time PCR and TaqMan oligonucleotide primers and probes for human
kininogen were purchased from Applied Biosystems (Foster City,
CA).
Kininogen Promoter and Reporter Plasmid
ConstructsComparison of human kininogen cDNA sequence by
the BLAST search revealed that one BAC clone (GenBankTM accession number
NT_005962
[GenBank]
) contained region 5'-upstream to the untranslated cDNA
sequence. The 1-kb fragment (962/+142) containing the kininogen
promoter was amplified by PCR and subcloned into the pGL3 enhancer plasmid
vector (Promega) at the NheI/HindIII sites. Similarly, the
106/+142 and 54/+142 fragments were also amplified by PCR and
subcloned into the pGL3 enhancer plasmid. The integrity of sequence for all
constructs was confirmed by DNA sequencing. The expression vector
pcDNA3.1-hFXR was constructed by inserting the cDNA fragment encoding
the full-length human FXR (accession number NP_005114
[GenBank]
) into pcDNA3.1
at NheI/HindIII. pGST-hFXR-LBD,
pcDNA3.1-hRXR
, and pCMV-lacZ were described
previously (17).
Kininogen Promoter MutantsFXRE in the kininogen promoter was mutated using the QuikChange mutagenesis kit (Stratagene). PCRs were carried out according to the manufacturer's directions. The sense primer was 5'-ATGCAAATGAGCAAATTAACAATTCCAGTGTTGC-3' and the antisense primer was 5'-GCAACACTGGAATTGTTAATTTGCTCATTTGCAT-3' (the altered bases are in bold and underlined type).
Electrophoretic Mobility Shift Assays (EMSAs)cDNA encoding
human FXR or RXR
was transcribed and translated using
the TNT quick coupled transcription/translation system (Promega) according to
the manufacturer's instructions. Double-stranded oligonucleotide probes for
the EMSAs were end-labeled with [
-32P]ATP (3000 mCi/mmol) by
T4 polynucleotide kinase. The EMSA was performed as previously described
(18) with minor modifications.
Briefly, 2 µl of the in vitro translated FXR or RXR protein alone
or together were added to 20 µl of reaction containing 10 mM
Tris (pH 8.0), 40 mM KCl, 0.05% Nonidet P-40, 6% glycerol, 1
mM dithiothreitol, and 1 µg of poly(dI-dC). Cold competitor
oligonucleotides including the wild type kininogen FXRE
(5'-CAAATGAGCAGGTTAACAACCCCAGTG-3'), mutated
kininogen FXRE
(5'-ATGCAAATGAGCAaaTTAACAAttCCAGTGTTGC-3') or idealized
IR-1 containing an IR-1 consensus
(5'-GATGGGCCAAGGTCAATGACCTCGGGG-3') were added in
50x, 100x, and 200x excess. After a 20-min incubation on
ice, 10 fmol of the 5' end-labeled kininogen FXRE probes were
added and continuously incubated for an additional 20 min on ice. DNA-protein
complexes were resolved by electrophoresis on a 4% native polyacrylamide gel
containing 0.5x TBE (0.89 M Tris, 0.89 M boric
acid, 0.02 M disodium EDTA for 10x TBE). The gel was dried
and exposed to x-ray film.
FXR TransactivationHepG2 cells were transfected in 96-well
plates using the FuGENE 6 transfection reagent as previously described
(17). Transfection mixes for
each well contained 0.405 µl of FuGENE 6, 10.4 ng of
pcDNA3.1-hFXR, 10.4 ng of pcDNA3.1-hRXR
, 10.4 ng of
pGL3 enhancer-kininogen-Promoter-Luc, and 103.8 ng of
pCMV-lacZ. The treatment of transfected cells with various FXR
ligands, assays for luciferase, and
-galactosidase activities were
performed following the same protocols as previously described
(17). This assay was performed
at Merck Sharp & Dohme de España in Spain.
Treatment of HepG2 Cells for Gene ExpressionHepG2 cells were maintained in DMEM containing 10% FBS, 1% penicillin/streptomycin, 1 mM sodium pyruvate, and 5 mM HEPES. For determination of gene specific expression by TaqMan analysis, the cells were seeded in 6-well plates at a density of 1 million cells/well in DMEM containing 10% FBS, 1% penicillin/streptomycin, and 25 mM HEPES. 24 h after seeding, the cells were treated with various concentrations of compounds in DMEM containing 0.5% CS-FBS, 1% penicillin/streptomycin, and 5 mM HEPES. Unless specified, the cells were treated for 24 h.
RNA Isolation and Real Time Quantitative PCRTotal RNA was extracted from the cultured cells using the TRIZOL reagent according to the manufacturer's instructions. Reverse transcription reactions and TaqMan PCRs were performed according to the manufacturer's instructions (Applied Biosystems). Sequence-specific amplification was detected with an increased fluorescent signal of carboxyfluorescein (reporter dye) during the amplification cycles. Amplification of human 18 S RNA was used in the same reaction of all samples as an internal control. Gene-specific mRNA was subsequently normalized to 18 S RNA. Levels of human kininogen mRNA were expressed as fold difference of compound-treated cells against Me2SO-treated cells.
Northern Blot AnalysisProtocols for treatment of HepG2
cells and isolation of total RNA were similar to that used in real time
quantitative PCR. Total RNA (8 µg) was separated by electrophoresis on a 1%
denaturing agarose gel with 1x formaldehyde/MOPS (Ambion) and then
transferred to a nylon membrane (Nytran SuPerCharge; Schleicher &
Schuell). The blots were hybridized with 32P-labeled cDNA probe of
the human kininogen gene (GenBankTM accession number K02566
[GenBank]
,
bases 7171274) and then reprobed with a radiolabeled cDNA probe of the
-actin gene (Ambion).
TaqMan Primers and ProbesOligonucleotide primers and probe for human kininogen were designed using Primer Express program and were synthesized by Applied Biosystems. These sequences (5' to 3') are as follows: forward primer, AGACACGGCATTCAGTACTTTAACA; probe, 6-carboxyfluorescein-CAACACTCAACATTCCTCCCTCTTCATGC-N,N,N,N-tetramethyl-6-carboxyrhodamine; and reverse primer, TGGGCCCGTTTTACTTCATT. Primers and probe for human 18 S RNA were also purchased from Applied Biosystems.
Sequence Analysis of the Genomic Region of KininogenBLAST searches were performed to identify mRNAs and expressed sequence tags of kininogen and to identify genomic regions encoding human and mouse kininogen (19). The genomic sequences of human and mouse kininogen were compared using GLASS (20). Putative binding sites for transcription factors were identified by searching against the TRANS-FAC data base (21) and the position weight matrices constructed internally.
Previous studies have identified multiple transcription start sites for human kininogen (4, 22). To better define the transcription start sites of kininogen, we blasted the known human kininogen mRNA, NM_000893 [GenBank] , against human mRNA and expressed sequence tag data bases. More than 40 transcripts were identified. Mapping those transcripts to human genome indicated about 10 putative transcription start sites, among which the most upstream transcription start site was located 185 bp upstream from the translation start site. In our study, we refer to this site as the transcription start site of human kininogen.
| RESULTS |
|---|
|
|
|---|
|
GW4064 is a potent and selective synthetic agonist of FXR (24). To confirm that kininogen up-regulation by CDCA was mediated through FXR, primary human hepatocytes were treated with GW4064 and assayed for kininogen expression. Similar to the results of CDCA treatment, GW4064 also effectively increased kininogen mRNA in a dose-dependent manner with an EC50 about 0.1 µM (Fig. 1B). Again, this value correlates well with the potency in FXR transactivation (23). Taken together, these results suggest that kininogen up-regulation is mediated by FXR.
Primary human hepatocytes were treated with 60 µM CDCA and 5 µM GW4064 for 3, 6, 12, 24, and 48 h to define the time kinetics for FXR-mediated kininogen gene regulation. Up-regulation was readily detectable within 3 h with a maximum induction of 1.51.8-fold, which increased to 3-fold at 6 h and 3.8-fold at 12 h (Fig. 1C). 24-h treatment yielded a 45-fold induction, which increased slightly at 48 h (Fig. 1C). The fact that kininogen up-regulation by FXR agonists was readily detectable at as early as 3 h suggests kininogen as a direct target of FXR.
Endogenous Expression of Kininogen Is Increased by FXR Agonists in HepG2 CellsHepG2 is a human hepatoma cell line that has been used to study FXR-mediated gene regulation. In HepG2, kininogen was expressed at a moderate level with an average threshold cycle of 24 in untreated cells (data not shown). This level of expression was comparable with that in primary hepatocytes (data not shown). Despite the relatively high basal expression in HepG2 cells, kininogen mRNA was robustly up-regulated by the FXR agonist CDCA or GW4064 in a dose-dependent fashion with a maximum induction of 130140-fold (Fig. 2).
|
Northern blot analysis was also carried out to confirm the results obtained from the real time PCR. Treatment of HepG2 cells with 50 µM CDCA or 1 µM GW4064 resulted in an over 100-fold increase of two RNA bands at 3.6 and 1.5 kb, respectively, when probed with the radiolabeled human kininogen cDNA probe (Fig. 3). The size of these two bands are consistent with those previously reported for high molecular weight and low molecular weight kininogen mRNA (22). One minor band at 2.6 kb was also slightly induced by FXR agonists (Fig. 3). This RNA species is presumably the result of an alternative splicing of the kininogen gene. Northern blot analyses confirm that endogenous expression of kininogen is induced by FXR agonists.
|
The Kininogen Promoter Contains an IR-1 That Binds Specifically to the
FXR/RXR
HeterodimerThe FXR/RXR
heterodimer binds to specific DNA sequences in promoters of target genes to
regulate gene transcription. The DNA sequences recognized by the heterodimer
comprise of an inverted repeat separated by a single nucleotide (IR-1). A data
base search using the IR-1 consensus sequence identified a highly conserved
IR-1 element in the proximal promoter of kininogen (66 to
54). To examine whether the FXR/RXR
heterodimer binds to this
IR-1 element, an EMSA was performed using the 32P-labeled IR-1 from
the human kininogen promoter in the presence of in vitro
translated human FXR and/or human RXR
proteins. The results of EMSAs
are shown in Fig. 4A.
Neither FXR nor RXR
alone bound to the probe (lanes 1 and
2). However, when both FXR and RXR
proteins were present, a
complex was formed, indicating that it is the FXR/RXR
heterodimer that
is bound by the IR-1 element (lane 3). Competition analysis showed
that an unlabeled IR-1 oligonucleotide from kininogen promoter
(Fig. 4B, WT)
at a 50-, 100-, or 200-fold molar excess was able to compete for binding in a
dose-dependent manner (lanes 46), whereas the same molar
excess of a mutated oligonucleotide (Fig.
4B, Mut) failed to compete for binding
(lanes 79). Moreover, an ideal IR-1 sequence
(Fig. 4B,
IR-1) efficiently competed for binding at a 50-, 100-, or 200-fold
molar excess (lanes 1012). These results indicate that the
IR-1 element in the kininogen promoter is an authentic FXR/RXR
binding cis-element.
|
The IR-1 Element in Human Kininogen Promoter Is Necessary for
FXR/RXR
-mediated Promoter ActivationTo
determine whether the IR-1 element is necessary for FXR/RXR
-mediated
kininogen promoter activation, an 1104-bp fragment of the
kininogen promoter (962 to +142) was cloned upstream of a
luciferase reporter gene (Fig.
5A). This construct (Kin962-Luc) was
transiently transfected into HepG2 cells together with FXR and RXR
expression vectors in the presence or absence of 60 µM CDCA
(Fig. 5B) or 1
µM GW4064 (Fig.
5C). Luciferase activity was markedly induced by 60
µM CDCA (1213-fold) and 1 µM GW4064
(1517-fold) compared with the Me2SO control.
|
To further define the importance of IR-1 element in kininogen
promoter activation, two other reporter constructs,
Kin106-Luc and Kin52-Luc, were also
generated (Fig. 5A).
Kin106-Luc is a minimal promoter that contained the IR-1
element, whereas Kin52-Luc contained the deletion of IR-1
and upstream sequences (Fig.
5A). HepG2 cells were transfected with each of the
constructs along with FXR and RXR
expression vectors. Luciferase
activity was significantly induced by 60 µM CDCA
(1011-fold) or 1 µM GW4064 (1517-fold) for the
Kin106-Luc construct, whereas only minimal induction was observed
for Kin52-Luc, which was similar to that of the pGL3
vector control (Fig. 5, B and
C). These results indicate that the IR-1 element is
necessary for FXR ligand-induced kininogen promoter activation.
Mutation of Kininogen IR-1 Abolishes Promoter Transactivation by
FXR/RXR
To demonstrate further that the
IR-1 element at 66 to 54 is responsible for the transactivation
of the kininogen promoter, mutations in both halves of the IR-1
element (AGGTTAACAACCC to AaaTTAACAAttC; mutated bases
in lowercase type) were created in the Kin106-Luc
construct using site-directed mutagenesis, and the mutant construct
(Kinmut-Luc) was transfected into HepG2 cells together
with FXR and RXR
expression vectors. Compared with
Kin106-Luc, Kinmut-Luc only showed a
modest residual induction by 60 µM CDCA
(Fig. 5B) and 1
µM GW4064 (Fig.
5C). This induction was indistinguishable from that of
the construct lacking the IR-1 element (Kin52-Luc) and the
pGL3 vector control (Figs. 5, B
and C). This result indicates that the integrity of the
IR-1 element in the kininogen promoter is essential for the promoter
transactivation by FXR/RXR
.
The FXR and RXR
Ligands Additively Activate the
Kininogen PromoterIt has been previously shown that several FXR
targets are regulated by both bile acids and the RXR ligand,
9-cis-retinoic acid (RA)
(18,
25). To determine whether the
kininogen promoter is also regulated by the RXR
ligand, the
Kin106-Luc construct (a minimal promoter containing the
IR-1 element) was transiently transfected into HepG2 cells together with the
FXR and RXR
expression vectors. As expected, 9-cis-RA alone
efficaciously increased the luciferase activity in a dose-dependent manner
with an EC50 of 296 nM and a maximum induction of
20-fold (Fig. 6). In the
presence of 50 nM GW4064, this induction was further increased by
23-fold compared with that induced by 9-cis-RA alone
(Fig. 6), indicating that FXR
and RXR
ligands work additively on activation of kininogen
promoter. These results confirm that FXR is a permissive receptor and that it
is the FXR/RXR
heterodimer that transactivates the kininogen
promoter.
|
| DISCUSSION |
|---|
|
|
|---|
Although the structure and function of human kininogens have been extensively studied for over three decades, little is known about the gene regulation. Glucocorticoid was reported to increase HK synthesis in cultured hepatocytes (35). Here we report the discovery of the kininogen gene as a novel direct target of FXR.
FXR, a bile acid sensor, regulates expression of many genes whose products
control bile acid and cholesterol homeostasis
(1013).
It has been shown that FXR decreases transcription of cholesterol
7
-hydroxylase
(3639),
sterol 12
-hydroxylase
(40), the
Na+/taurocholate co-transporting polypeptide
(41), and apolipoprotein A-I
(16). FXR induces expression
of intestinal bile acid binding protein
(18), phospholipid transfer
protein (42), bile salt export
pump (23,
25), dehydroepiandrosterone
sulfotransferase (43), and
apolipoprotein C-II (44).
Microarray analysis indicated that expression of the kininogen gene was significantly increased by FXR agonists.2 Consistent with the microarray results, we have demonstrated here that the endogenous kininogen mRNA was effectively increased by FXR agonists in primary human hepatocytes and HepG2 cells. We further demonstrate that the kininogen promoter is transactivated by FXR and that the IR-1 element in the kininogen promoter is necessary and essential for this gene regulation.
One potential physiological role for FXR mediated up-regulation of the
kininogen expression may be to increase bradykinin, resulting in
modulation of renal excretory function. It has been previously documented that
bradykinin stimulates water transport in feline gallbladder
(45). It is possible that when
hepatic bile acid concentration is high, activated FXR on the one hand shuts
down bile acid synthesis by down-regulation of cholesterol
7
-hydroxylase, whereas on the other hand increases bile acid secretion
via up-regulation of bile salt export pump and increases fluid transport by
up-regulation of kininogen mRNA to increase production of bradykinin.
In addition to the role of bradykinin in the gallbladder, the increased
production of HKa upon FXR activation may be beneficial for anti-adhesion and
anti-thrombosis. More studies are needed to elucidate this aspect of FXR
function. Taken together, the findings described in this study increase the
understanding of the physiological consequences of FXR activation and
implicate a coordinated regulation in bile acid/cholesterol metabolism, fluid
transport, inflammation, and thrombosis.
| FOOTNOTES |
|---|
** To whom correspondence should be addressed: Dept. of Atherosclerosis and Endocrinology, Merck Research Laboratories, 126 E. Lincoln Ave., P.O. Box 2000, RY80W-107, Rahway, NJ 07065. Tel.: 732-594-6369; Fax: 732-594-7926; E-mail: jisong_cui{at}merck.com.
1 The abbreviations used are: HK, high molecular weight kininogen; HKa,
two-chain kinin-free kininogen; FXR, the farnesoid X receptor; FXRE, FXR
response element; CDCA, chenodeoxycholate; RXR
, retinoid X receptor
; IR-1, inverted repeat separated by a single nucleotide; EMSA,
electrophoretic mobility shift assay; FBS, fetal bovine serum; CS-FBS,
charcoal-stripped FBS; DMEM, Dulbecco's modified Eagle's medium; MOPS,
4-morpholinepropanesulfonic acid; RA, retinoic acid. ![]()
2 J. Cui, L. Huang, A. Zhao, J. Lew, and S. Wright, unpublished data. ![]()
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
A. Das, M. E. Fernandez-Zapico, S. Cao, J. Yao, S. Fiorucci, R. P. Hebbel, R. Urrutia, and V. H. Shah Disruption of an SP2/KLF6 Repression Complex by SHP Is Required for Farnesoid X Receptor-induced Endothelial Cell Migration J. Biol. Chem., December 22, 2006; 281(51): 39105 - 39113. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Anisfeld, H. R. Kast-Woelbern, H. Lee, Y. Zhang, F. Y. Lee, and P. A. Edwards Activation of the nuclear receptor FXR induces fibrinogen expression: a new role for bile acid signaling J. Lipid Res., March 1, 2005; 46(3): 458 - 468. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Shimamoto, J. Ishida, K. Yamagata, T. Saito, H. Kato, T. Matsuoka, K. Hirota, H. Daitoku, M. Nangaku, K. Yamagata, et al. Inhibitory Effect of the Small Heterodimer Partner on Hepatocyte Nuclear Factor-4 Mediates Bile Acid-induced Repression of the Human Angiotensinogen Gene J. Biol. Chem., February 27, 2004; 279(9): 7770 - 7776. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |