HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 278, Issue 32, 29400-29409, August 8, 2003

This Article Abstract Full Text (PDF) All Versions of this Article: 278/32/29400    most recent M304572200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Gokool, S. Search for Related Content PubMed PubMed Citation Articles by Gokool, S. Social Bookmarking                      What's this?

1- and µ1-Adaptin Homologues of Leishmania mexicana Are Required for Parasite Survival in the Infected Host^*

Suzanne Gokool 

From the Max-Planck-Institut für Biologie, Abteilung Membranbiochemie, Corrensstrasse 38, D-72076 Tübingen, Germany

Received for publication, May 1, 2003

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
The sorting of membrane-bound proteins from the trans-Golgi network to lysosomal/endosomal compartments is achieved by preferential inclusion into clathrin-coated vesicles. Contained within the cytoplasmic domains of such proteins, specific sequence motifs have been identified (tyrosine-based and/or di-leucine-based) that are essential for targeting and are recognized by a family of heterotetrameric adaptor complexes, which then recruit clathrin. These cytosolic protein complexes, which have been found in a wide variety of higher eukaryotic organisms, are essential for the development of multicellular organisms. In trypanosomatids, the adaptin-mediated sorting of proteins is largely uncharacterized. In order to identify components of the adaptor-complex machinery, this study reports the cloning and characterization of 1- and µ1-adaptin gene homologues from the eukaryotic protozoan parasite, Leishmania mexicana. Generation of 1- and µ1-adaptin gene deletion mutants shows that these promastigote parasites are viable in culture, but are unable to establish infection of macrophages or mice, indicating that adaptin function is crucial for pathogenesis in these unicellular organisms.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Several coat proteins have been described that are involved in the formation of carrier vesicles at different points in the secretory and endocytic trafficking pathways (1–3). Clathrin-coated vesicles (CCVs),¹ which were the first coated transport vesicles to be identified, belong to one of the major classes of transport vesicles for the trafficking of proteins from the trans-Golgi network (TGN) and plasma membrane (PM) to the endosomal/lysomal system (4). Essential to vesicle trafficking is the initiating step of cargo recognition by heterotetrameric adaptor protein (AP) complexes in association with regulatory molecules, followed by the recruitment of clathrin to the membrane for budding and vesicle formation (5, 6). Each heterotetramer of the TGN- and PM-associated AP complexes, AP-1 and AP-2 respectively, consist of two large adaptins ( and are found together with 1 and 2, respectively, 100 kDa), one medium-sized adaptin (µ1or µ2, 50 kDa) and one small adaptin (1or 2, 20 kDa) (2, 6, 7). The corresponding subunits of each AP complex are homologous to one another (25–84% amino acid identity), which suggest functional similarity, and each adaptin has been shown to fulfill a different function. Their predominant role is as follows: the subunits are important for clathrin binding (8, 9); - and -adaptins target the AP complexes to specific membranes (10, 11); µ-adaptins recognize and bind cargo for selection into CCVs via distinct sorting signals found in the cytoplasmic domains of certain transmembrane proteins: tyrosine-based motifs YXX (where is a bulky hydrophobic residue) or NPXY and di-leucine/acidic residues (12). To date there is no function assigned to the subunits. Recently, two structurally related AP complexes, AP-3 and AP-4 have been identified (2, 3). Previously, the functional roles of the AP complexes were based on biochemical and morphological experiments; however, more recent investigations have used targeted disruptions or naturally occurring mutants for the study of the physiological roles of these adaptor proteins (13). In contrast to Saccharomyces cerevisiae where AP-1 and AP-2 are not essential for cell viability, it has been demonstrated that AP-1, although not required for cell viability in culture, is essential for the development of Caenorhabditis elegans and mice, and AP-2 is necessary for C. elegans embryonal development (14–17).

Leishmania are kinetoplastid protozoan parasites that are responsible for several important human diseases, ranging from mild skin ulcers to fatal visceral disease. These organisms lead a digenetic life style, where several forms of extracellular, flagellated, motile promastigotes colonize the digestive tract of vector sandflies. Upon transmission to the mammalian host during bloodfeeding by the insect, the promastigotes transform to non-flagellated, intracellular amastigotes, which reside in the phagolysosomes of macrophages (18). Extensive studies have shown that the cell surface of both life cycle stages of these pathogens are coated with high levels of varying GPI-anchored glycoprotein, glycoconjugates, and glycolipids, which, depending on the Leishmania species studied, are vital for survival and virulence in the harsh environments that are encountered by the parasite (19–21).

Leishmania cells are highly polarized structures with an elongated shape in most life cycle stages. A microtubular corset lines the plasma membrane maintaining the morphology of the cell and appears to prohibit membrane fusion. All endocytosis and exocytosis occurs at an anterior specialized invagination of the cell surface membrane at the point of the emerging flagellum, termed the flagellar pocket (22, 23). Organelles involved in the secretory/endocytic pathways are located between the flagellar pocket and the nucleus (24). These morphological features make Leishmania and related organisms, such as Trypansoma brucei, interesting models for protein trafficking studies. For both Leishmania and T. brucei, several transmembrane proteins have been identified that have the potential to be used in protein trafficking studies (23). In particular, a membrane-bound acid phosphatase of L. mexicana contains within its cytoplasmic domain both tyrosine-based and diisoleucine sorting signals (25) and in T. brucei, p67, a lysosomal membrane glycoprotein contains within its carboxyl terminus two di-leucine motifs (26). Both of these proteins localize to endosomal/lysosomal compartments of each respective organism, but little is known about their intracellular trafficking. The presence of these putative sorting motifs suggests that the molecular machinery for adaptin-mediated sorting maybe conserved in these highly divergent group of unicellular eukaryotes. With the recent advent of the genome sequencing projects for both L. major and T. brucei, several sequences encoding potential components of the secretory/endocytic pathways have been identified. Homologues for several Rab proteins and clathrin of T. brucei are now being used as markers for the identification of subcellular compartments involved in protein trafficking (27, 28).

In order to identify components of the adaptor-complex machinery of L. mexicana, a PCR-based homology approach was used. This article describes the cloning and initial characterization of two AP complex subunits of L. mexicana that are potential 1- and µ1-adaptins, due to their significant homology to other adaptins of these classes.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Parasite Maintenance and Transfections—L. mexicana promastigotes (MNYC/BZ/62/M379 strain) and derived gene deletion mutant cell lines were maintained in vitro at 27 °C in semidefined medium 79 (SDM-79) supplemented with 5% heat-inactivated fetal calf serum (Invitrogen, Inc.) and 8 µg/ml hemin (Sigma). Transfections were performed as described previously (29), and recombinant clones were isolated by limiting dilution on 96-well plates in SDM medium containing the appropriate drug for the selectable markers, used at the following concentrations of 32 µg/ml hygromycin (Sigma), 2.5 µg/ml phleomycin (Sigma), and 80 µM puromycin (Sigma).

DNA Techniques—Restriction enzyme digests, DNA ligations, transformation of Escherichia coli, isolation of -phage and colony lifts, agarose gel electrophoresis, Southern blotting were performed according to standard methods (30). Large- and small-scale parasite genomic DNA were purified according to protocols previously described (31, 32). Plasmid DNA and DNA fragments from agarose gels were isolated using commercial kits according to the manufacturer's instructions (Qiagen). Polymerase chain reactions (PCR) were performed using the Expand^TM high fidelity PCR system (Roche Applied Science). All PCR products were subcloned into the TA cloning vector (Invitrogen) and sequenced by the dideoxy chain termination method using an ALFexpress automated sequencer (Amersham Biosciences). DNA probes were generated using a PCR-DIG labeling kit (Roche Applied Science). On nucleic acid blots the labeled DNA was detected using anti-DIG-Fab fragments coupled to alkaline phosphatase (Roche Applied Science) and CDP-Star^TM as the chemiluminescent substrate according to the manufacturer's instructions.

Cloning of the L. mexicana Lmx1-ADAPTIN Gene and Generation of Deletion and Addback Constructs—The Block Maker program (www.blocks.fhcrc.org) was used to align ungapped, highly conserved regions of the 1 subunit amino acid sequence from the organisms (SWISS-PROT accession codes given in parentheses): Homo sapiens (P56377 [GenBank] ), Mus musculus (Q00382 [GenBank] ), S. cerevisiae (P35181 [GenBank] ), and Arabidopsis thaliana (AAB96887 [GenBank] ). Peptide sequences from the resulting conserved blocks were used to design a series of degenerate primers: 5'-CA(A/G)GG(A/G/C/T)AA(A/G)ITICG(A/G/C/T)CT(A/G/C/T)I(A/C)IAA(A/G)TGGTA, CA(A/G)GG(A/G/C/T)AA(A/G)ITICG(A/G/C/T)TT(A/G)I(A/C)IAA(A/G)TGGTA, CA(A/G)GG(A/G/C/T)AA(A/G)ITIAG(A/G)CT(A/G/C/T)I(A/C)IAA(A/G)TGGTA, CA(A/G)GG(A/G/C/T)AA(A/G)ITIAG(A/G)TT(A/G)I(A/C)IAA(A/G)TGGTA, and 3'-AA(A/G/T)AT(A/G/T)AT(A/G)TC(A/G/C/T)AG(C/T)TC(A/G)CA(A/G/C/T)AC. PCR was performed using this mixture of oligonucleotides with L. mexicana genomic DNA, and the derived 284-bp fragment was subcloned into the TA cloning vector (Invitrogen) and sequenced. This DIG-labeled PCR product was used to screen a -DashII L. mexicana genomic DNA library (25), and a 3.3-kb NotI fragment from positive clones was subcloned into pBSK+ (Stratgene) and sequenced on both strands. Using data base searches the ORF corresponding to Lmx1-ADAPTIN was identified by homology to other known -adaptins. The sequence data for the Lmx1-ADAPTIN-containing genomic DNA fragment has been submitted to the DDBJ/EMBL/GenBank^TM data base under accession code AF514805 [GenBank] . For the derivation of double targeting gene replacement cassettes, PCR was carried out for amplification of the 5'-upstream region of Lmx1-ADAPTIN using the primers GTCGAGCGGCCGCGCGGCCTCGCCG and CCATGCCATGGCGCCCACACGCGCGTGCAG (where a NcoI restriction site was introduced at the translation initiation codon of Lmx1-ADAPTIN ORF), and for the 3'-downstream region ATACGCCCTAGGGGGTGTAGGTTGCCCGTC (where an AvrII site was inserted at the stop codon of the Lmx1-ADAPTIN ORF) and ACGCGTCGACGCGGCCGCGCCTCGTCTGCA. The NotI/NcoI-digested Lmx1-ADAPTIN 5'-upstream, the AvrII/NotI-digested Lmx1-ADAPTIN 3'-downstream PCR DNA fragments and a NcoI/AvrII DNA fragment encoding the hygromycin phosphotransferase ORF (HYG) (33) were consecutively ligated into pBSK+. A NcoI/AvrII DNA fragment containing the phleomycin gene (PHLEO) was used for the second Lmx1-ADAPTIN gene replacement construct. For chromosomal integration, linear DNA fragments for transfection of L. mexicana promastigotes containing the HYG- and PHLEO- Lmx1-ADAPTIN gene replacement cassettes were excised by NotI digestion. For episomal and chromosomal protein expression in the gene deletion mutant background, vectors containing the ORF were constructed. The Lmx1-ADAPTIN ORF obtained by PCR (see "Antibodies" below), was excised from the TA cloning vector by BamHI digestion and subcloned into the pX63PAC episomal vector (34). For protein expression under the control of the rRNA promoter, PCR was performed with the following primers: ATCGATATGATTCAGTTCCTG and TCTAGATCATACACCCTTGATGGC and a Lmx1-ADAPTIN gene containing DNA fragment, to introduce ClaI and XbaI restriction enzymes sites for subcloning of the ORF into the pSSU-int plasmid (35). The integration cassette was excised by digestion with PacI and PmeI for transfection of L. mexicana promastigotes.

Cloning of the L. mexicana Lmxµ1-ADAPTIN Gene and Generation of Deletion and Addback Constructs—A potential partial µ1-adaptin L. major sequence was found using the keyword search of the Leishmania Proteome data base (www.ebi.ac.uk/parasite/LGN/Proteome/proteome.html), deposited in the GenBank^TM data base under the accession code AQ846242 [GenBank] . Based on this sequence, the following primers were designed and used in PCR with L. mexicana genomic DNA: TACACCTTCGTGCGCGAGAA and ATCGAGCAGGTCGACATGCT. After subcloning into the TA cloning vector (Invitrogen) and sequencing of the derived 410-bp PCR product, this DIG-labeled DNA fragment was used to screen a -DashII L. mexicana genomic DNA library (25) and a 6-kb EcoRI fragment from positive clones was subcloned into pBSK+ (Stratgene) and sequenced on both strands. Using data base searches the ORF corresponding to Lmxµ1-ADAPTIN was identified by homology to other known µ1-adaptins. The sequence data for the Lmxµ1-ADAPTIN-containing genomic DNA fragment has been submitted to the DDBJ/EMBL/GenBank^TM data base under accession code AF514806 [GenBank] . For the construction of double targeting gene replacement cassettes, PCR was carried out for amplification of the 5'-upstream region of Lmxµ1-ADAPTIN using the primers GCGGCCGCTGGATGTGTGTGCAT and CCATGGCACCTGCGGACGTAC (where a NotI restriction site was introduced at the 5'-end of this fragment, and a NcoI site was introduced at the translation initiation codon of Lmxµ1-ADAPTIN ORF). For the 3'-downstream region the primers pairs CCTAGGGACGGAATGATGGGC and GCGGCCGCACGCACTGCAGCTGC (where at the 5'-end of this DNA fragment an AvrII site was inserted at the stop codon of the Lmxµ1-ADAPTIN ORF and a NotI site at the 3'end) were used. The NotI/NcoI digested Lmxµ1-ADAPTIN 5'-upstream, the AvrII/NotI-digested Lmxµ1-ADAPTIN 3'-downstream PCR DNA fragments and a NcoI/AvrII DNA fragment encoding the hygromycin phosphotransferase ORF (HYG) (33) were consecutively ligated into pBSK+. A NcoI/AvrII DNA fragment containing the phleomycin gene (PHLEO) was used for the second Lmxµ1-ADAPTIN gene replacement construct. For chromosomal integration, linear DNA fragments for transfection of L. mexicana promastigotes containing the HYG- and PHLEO- Lmxµ1-ADAPTIN gene replacement cassettes were excised by NotI digestion. For episomal and chromosomal protein expression in the gene deletion mutant background, vectors containing the ORF were constructed. The amplified Lmxµ1-ADAPTIN ORF (see "Antibodies" section below) was excised from the TA cloning vector by BamHI/HindIII digestion and the ends filled in with Klenow enzyme (Roche Applied Science) to yield a blunt-ended fragment, followed by ligation into BamHI-digested/ends-filled-in pX63PAC episomal vector (34). For protein expression under the control of the rRNA promoter this blunt-ended Lmxµ1-ADAPTIN ORF-containing DNA fragment was subcloned into ClaI/XbaI-digested/ends-filled-in pSSU-int plasmid (35). The integration cassette was excised by digestion with PacI and PmeI for transfection of L. mexicana promastigotes.

Antibodies—For high level expression and purification of L. mexicana 1- and µ1-ADAPTIN recombinant proteins the pQE-8 vector (Qiagen) was used. In order to subclone the full-length ORFs into the BamHI/HindIII sites of this plasmid, PCR was carried out to introduce these restriction sites using the primer pairs: CGCGGATCCATGATTCAGTTCCTGCTG and AAGCTTTCATACACCCTTGATGGCGTT for Lmx1-ADAPTIN and GGATCCATGGCGTCGGTGCTGTA and AAGCTTTCAGTCCGTTCGTAT for Lmxµ1-ADAPTIN. To avoid sequencing the entire Lmxµ1-ADAPTIN amplified ORF, an internal AatII/BspEI of this PCR product was replaced by the same DNA fragment excised from the genomic subclone. The sequences of these constructs were verified and used for transformation of competent E. coli M15 cells. Cell culture, induction of recombinant protein expression, and batch purification of solubilized inclusion bodies (8 M urea) by Ni-nitrilotriacetic acid-agarose chromatography were performed according to the manufacturer's instructions (Qiagen). Rabbits were immunized with 200 µg of each purified recombinant protein or with 300 µg of a 15-residue peptide corresponding to the carboxyl terminus of Lmx1-ADAPTIN (coupled to KLH (Calbiochem) via an inserted amino-terminal cysteine residue as described previously, Ref. 30), emulsified with 50% (v/v) complete Freund's adjuvant for primary immunizations and with 50% (v/v) incomplete Freund's adjuvant for all subsequent boosts. Polyclonal antisera were collected 14 days after each booster immunization. Anti-Lmx1-ADAPTIN peptide antibodies were affinity-purified using as the ligand the peptide immobilized to SulfoLink^TM coupling gel (Pierce) according to the supplier's instructions. In order to remove unspecific antibodies, antisera raised against the L. mexicana 1- and µ1-ADAPTIN full-length ORFs were absorbed using the respective L. mexicana-null mutant cell lines. Late logarithmic phase promastigotes were harvested, followed by a fixation step (rotating for 1 h at room temperature in PBS containing 0.05% glutaraldehyde and 2% formaldehyde), centrifuged at 30,000 x g for 1 h, permeabilized (rotating for 1 h at room temperature in PBS containing 1% skimmed milk powder, 0.5% bovine serum albumin, and 0.1% saponin) and centrifuged as before. The pellets were resuspended in the permeabilization buffer, and an aliquot of this was added to antiserum, rotated for 1 h at room temperature or overnight at 4 °C, followed by centrifugation. This latter step was repeated several times using a fresh portion of permeabilized cells added to the resulting supernatant. The final supernatant was ultracentrifuged at 140,000 x g for 30 min.

Analytic Procedures—To obtain protein for Western blot analysis, L. mexicana parasites were washed twice in PBS, followed by extraction of lipids by addition of CHCl₃-CH₃OH-H₂O at a ratio of 1:2:0.8. Cells were immediately vortexed, incubated at room temperature for 30 min then centrifuged at 10,000 rpm in a benchtop microcentrifuge at room temperature. Solvents were removed from pellets by evaporation at 30 °C. The protein was then resuspended at the equivalent of 5 x 10⁸ cells/ml in 50 mM Tris-HCl pH 8.0 containing 5 mM MgCl₂, 0.5 mM phenylmethysulfonyl fluoride, 20 µM leupeptin, 5 mM o-phenanthroline, and 100 units/ml benzonuclease (Merck). After incubation at 37 °C for 30 min to digest nucleic acids, one-fifth volume of 5x sample buffer (30) was added. Discontinuous SDS-PAGE on 4% stacking gels over 7.5–20% resolving gradient gels, electrotransfer of proteins onto polyvinylidene difluoride membranes (Millipore) and incubations of the membranes with primary and secondary antibodies were performed as described previously (36). Horseradish peroxidase-labeled antibodies were detected using the ECL system (Amersham Biosciences) and stripping of blots for re-probing were both carried out according to the manufacturer's instructions.

Infections of Mice and Peritoneal Macrophages—For mouse infection studies, groups of four Balb/c mice were used for each cell line. These experiments were performed in duplicate. The left hind footpad was injected with 10⁷ stationary phase promastigotes resuspended in 30 µl of PBS. Using a caliper slide, the course of infections was followed by measuring footpad lesion size relative to the uninfected right hind footpad at 7–14-day intervals. For macrophage infection experiments, peritoneal cells were isolated from Balb/c mice by peritoneal lavage and seeded onto coverslips (13-mm diameter) at 2.5 x 10⁵ to 10⁶ cells per coverslip in complete Dulbecco's modified Eagle's medium (DMEM), which contained 10% heat-inactivated fetal calf serum, 100 µg/ml penicillin/streptomycin, and 2 mM glutamine. After overnight incubation at 37 °C with 5% CO₂ in air, non-adherent cells were removed by three washes of the coverslips with pre-warmed complete DMEM. Approximately 50% of the cells, which had adhered to the coverslips, judged as peritoneal macrophages by their morphology, were infected with stationary phase promastigotes, which had been washed and resuspended in complete DMEM, at a parasite to macrophage ratio of 2:1. Two coverslips were used per cell line. Following incubation overnight at 33 °C with 5% CO₂ in air, residual-free promastigotes were removed by three washes using pre-warmed complete DMEM. Incubation at 33 °C with 5% CO₂ in air was continued and coverslips removed at the required time points, washed with pre-warmed PBS, and fixed and stained with DAPI (see below). The number of parasitized macrophages and the number of L. mexicana amastigotes per host cell were counted by inspection with a fluorescence microscope.

Immunofluorescence Microscopy—Coverslips containing parasitised peritoneal macrophages were washed three times with pre-warmed PBS, fixed by submerging in PBS containing 2% formaldehyde and 0.05% glutaraldehyde for 30 min, washed twice with room temperature PBS, incubated at room temperature for 30 min with DAPI (10 µg/ml) in blocking solution of PBS containing 2% bovine serum albumin and 0.05 M NH₄Cl, followed by three washes with room temperature PBS. The coverslips were mounted using Mowiol/Dabco and inspected by fluorescence microscopy. As duplicate infections were performed for each cell line, 300 macrophages were counted per coverslip, grouped according to parasite burden and the average taken.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Cloning of the L. mexicana 1- and µ1-ADAPTIN Genes—For the cloning of the L. mexicana 1-ADAPTIN gene, 1-adaptin protein sequences from other organisms were used to find conserved blocks. A series of degenerate oligonucleotides were designed based on the peptide sequences QGK(V/F)RL(T/Q/K)KWY and VCELDIIF and used in PCR with L. mexicana genomic DNA as the template. Sequencing of the amplified DNA identified a partial ORF with high homology to -adaptins. This PCR product was DIG-labeled and used to screen a -DashII L. mexicana genomic DNA library. Sequencing of a Lmx-ADAPTIN gene-containing subcloned DNA fragment showed the presence of an ORF of 495 base pairs (bp, Fig. 2C) encoding a protein of a predicted molecular mass of 19.2 kDa (Figs. 1A and 3A) and a calculated isoelectric point of 7.9. Data base searches with the Lmx-ADAPTIN ORF displayed significant homology of this sequence with other AP complex -adaptins from various organisms. Phylogenetic analysis of these sequences showed that the Lmx-ADAPTIN ORF is grouped within the 1 family of adaptins. The complied sequences of this group are shown in Fig. 1A, where the sequence identities range between 44 and 52% from S. cerevisiae to H. sapiens. All of these sequences contain a segment that is considered a signature for the small chains () of adaptor-like complexes, according to the PROSITE data base (indicated by a line in Fig. 1A).

View larger version (61K): [in this window] [in a new window]   FIG. 2. Southern analysis of chromosomal DNA from wild-type L. mexicana, targeted gene replacement, and gene complementation of the 1- and µ1-adaptin alleles. For Southern blot analyses all digested genomic DNAs (5 µg) were resolved on 0.8% agarose gels, blotted onto nylon membrane and probed with DIG-labeled DNA fragments corresponding to the Lmx 1- and µ1-ADAPTIN ORFs (panels A and B, respectively). The sizes of DNA standards are indicated in kilobases. A, lanes 1–11: wild-type L. mexicana chromosomal DNA digested with the restrictions enzymes ApaI (1), AvaI (2), EcoRI (3), EcoRII (4), HinfI (5), NotI (6), PstI (7), SacI (8), SalI (9), XbaI (10), XhoI (11). Lanes 12–15, genomic DNAs digested with ApaI derived from the cell lines: wild-type L. mexicana (12), 1 (13), 1+cRIB1 (14), 1+pX1 (15). B, lanes 1–7 wild-type L. mexicana DNA digested with the restrictions enzymes HindIII/EcoRI (1), EcoRI (2), EcoRII (3), HinfI (4), NruI (5), PstI (6), PvuII (7). Lanes 8–11, genomic DNAs digested with PvuII derived from the cell lines: wild-type L. mexicana (8), µ1 (9), µ1+cRIBµ1 (10), µ1+pXµ1 (11). C and D, restriction maps of the Lmx1- and µ1-ADAPTIN loci where the ORFs are highlighted in black, and restriction sites relevant for Southern blot analyses are indicated. The resistance genes HYG and PHLEO and the 5'- and 3'-flanking regions (marked by dashed lines) used for the construction of gene deletion cassettes are also shown.

View larger version (36K): [in this window] [in a new window]   FIG. 1. Comparison of the primary structures of L. mexicana 1 and µ1 with those from various organisms of the adaptor small chain (1) and medium chain (µ1) family, respectively. Sequences were aligned using the PILEUP program, where dashes represent spaces inserted for maximum alignment. Residues that are conserved across all five species are indicated by asterisks. The numbering corresponds to the number of amino acids of the L. mexicana sequences and those shown in parentheses indicate those from the other species. A, multiple sequence alignment of the L. mexicana 1-ADAPTIN with H. sapiens, M. musculus (Mus mus.), A. thaliana (A. thal.), and S. cerevisiae (S. cere.) with respective GenBankTM accession codes: AB015320 [GenBank] , M62418 [GenBank] , U92084 [GenBank] , and Z30314 [GenBank] . The overlined region corresponds to the adaptor complex small chain signature (PROSITE accession code PS00989). B, multiple sequence alignment of the L. mexicana µ1-ADAPTIN with D. melanogaster (D. mel.), M. musculus (Mus mus.), C. elegans (C. eleg.), and A. thaliana (A. thal.) with respective GenBankTM Accession Codes: AJ006219 [GenBank] , M62419 [GenBank] , L26291 [GenBank] , and AF009631 [GenBank] . The overlined regions correspond to the adaptor complex medium chain signatures (PROSITE accession codes PS00990 and PS00991), and the amino acids involved in the binding of the tyrosine motif is highlighted in bold lettering.

View larger version (36K): [in this window] [in a new window]   FIG. 3. Expression of 1- and µ1-ADAPTINS in different life cycle stages of L. mexicana WT, 1, and µ1 and the respective complemented null mutant cell lines. For Western blot analyses all L. mexicana cell lysates were resolved on 7.5–20% gradient gels and immunoblotted onto polyvinylidene difluoride membranes. Molecular mass standards are indicated in kDa. A, blot probed with purified rabbit anti-Lmx1-ADAPTIN antibodies. Lane 1, lesion-derived WT amastigotes; lane 2, WT promastigotes; lane 3, 1; lane 4-1+cRIB1; lane 5, 1+pX1; lane 6, µ1; lane 7-µ1+cRIBµ1. B, blot probed with purified rabbit anti-Lmxµ1-ADAPTIN antisera. Lane 1, lesion-derived WT amastigotes; lane 2, WT promastigotes; lane 3, µ1; lane 4, µ1+cRIBµ1; lane 5, µ1+pXµ1; lane 6, 1; lane 7, 1+cRIB1. For both blots each lane was loaded with 88 µg of total protein from promastigote and amastigote cell lysates (equivalent to 2 x 107 promastigotes and 7.3 x 107 amastigotes). Strips shown below each immunoblot in panels A and B confirmed equivalent loading of parasite proteins, as the blots were stripped and reprobed with anti-LmxGDPMP (for promastigote lysates) and anti-LmxPMM (for amastigote and promastigote blots) antisera (40). C, WT promastigotes were lysed in a KCl-containing buffer and lysed in a KCl- and 0.8 M Tris-HCl (pH 7.5)-containing buffer (D). Supernatant (S) and pellet (P) fractions prepared by ultracentrifugation, and equivalent amounts of the cytosolic and membrane preparation derived from 2 x 107 parasites were loaded onto each lane. In each panel the blots on the left and right were probed with purified anti-Lmx1-ADAPTIN and anti-Lmxµ1-ADAPTIN antisera, respectively.

A search of the Leishmania major sequencing project data base revealed a partial µ1-adaptin sequence that was used to synthesize degenerate primer pairs for the cloning of the Lmxµ1-ADAPTIN gene. PCR was performed using these primers with L. mexicana genomic DNA as the template. Sequencing of the amplified DNA identified a partial ORF with high homology to other µ-adaptins. This PCR product was DIG-labeled and used to screen a -DashII L. mexicana genomic DNA library. An ORF of 1299 bp (Fig. 2D) was identified upon sequencing the Lmxµ-ADAPTIN gene-containing DNA fragment. This protein had a calculated molecular mass of 49.1 kDa (Figs. 1B and 3B) and a pI of 6.9. Phylogenetic analysis grouped the Lmxµ-ADAPTIN ORF within the µ1-adaptin family with amino acid identities of 37–46% from A. thaliana to Drosophila melanogaster. Sequence alignments of this group are shown in Fig. 1B where the signature sequences for the medium chains (µ) of adaptor-like complexes are overlined (according to the PROSITE data base).

Targeted Gene Replacement of L. mexicana 1- and µ1- ADAPTINs—Southern analysis with a range of restriction enzymes showed that the Lmx1- and µ1-ADAPTIN genes are present at one copy per haploid genome, as all the hybridizing fragments could be accounted for by the restriction maps of both loci (Fig. 2). This observation made it feasible to investigate the phenotypic effect of creating null mutants for these gene products. Two rounds of targeted gene replacement for the 1- and µ1-ADAPTIN genes were performed on wild-type (WT) L. mexicana, using the antibiotic resistance markers HYG and PHLEO (Fig. 2, C and D). A series of clones were isolated that lacked both alleles of the 1-ADAPTIN ORF (L. mexicana 1::HYG1::PHLEO, further on referred to as 1) (Figs. 2A, lane 13 and 3A, lane 3)orthe µ1-ADAPTIN ORF (L. mexicana µ1::HYG µ1::PHLEO, hereafter referred to as µ1) (Figs. 2B, lane 9 and 3B, lane 3). All clones showed normal growth in standard culture medium compared with the parental WT strain or complemented null mutant cell lines (data not shown).

Biochemical Characterization of the L. mexicana 1- and µ1-ADAPTIN Gene Products—For the characterization of the Lmx1- and µ1-ADAPTIN gene products, rabbit polyclonal antibodies were raised against 15 residues corresponding to the carboxyl terminus of Lmx1-ADAPTIN, which should have no correlate to other L. mexicana -ADAPTIN sequences (Fig. 1A), or full-length, His-tagged recombinant Lmxµ1-ADAPTIN. Irrelevant antibodies were removed by absorption of the antisera against each respective null mutant cell line, 1 and µ1. The specificity of each antibody is shown by immunoblotting in Fig. 3. The anti-Lmx1-ADAPTIN antibody detected one protein species of 19 kDa in WT promastigotes, which was absent in 1 cells (see Fig. 3A, lanes 2 and 3). No protein was detected in µ1 parasites using anti-Lmxµ1-ADAPTIN antiserum, but a molecular mass species of 47 kDa was recognized in WT promastigotes (see Fig. 3B, lanes 2 and 3). Both of these adaptins subunits were found to be of similar abundance and the same, respective molecular weight in both life cycle stages (Fig. 3, A and B, lanes 1 and 2). By comparison of the signal generated on immunoblots from a known number of parasites to that obtained for each recombinant protein as a standard, both Lmx1- and µ1-ADAPTIN were estimated to be present at 1 x 10⁴ copies per Leishmania cell (data not shown).

It appeared that with loss of the Lmxµ1-ADAPTIN gene, the stability of Lmx1-ADAPTIN was affected, as only low quantities of this protein were detected in µ1 parasites using anti-Lmx1-ADAPTIN antiserum, but expression was restored in the complemented null mutant cell line (µ1+cRIBµ1) (Fig. 3A, lanes 6 and 7). In contrast, Lmxµ1-ADAPTIN was detected in 1 cells at levels similar to WT and the 1+cRIB1 complemented null mutant cell lines (Fig. 3B, lanes 2, 6, and 7).

To assess whether the Lmx1- and µ1-ADAPTINs were either cytosolic or membrane-associated, WT promastigotes were disrupted in a KCl-containing buffer and both of these proteins were found to partition into both fractions (Fig. 3C). In an attempt to study the nature of the association of these proteins with membranes, the total membrane fraction was incubated with different concentrations of salts and detergents, however the membrane forms of these proteins were resistant to extraction (data not shown). In contrast, lysis of the WT promastigotes in the presence of a KCl- and 0.8 M Tris-HCl (pH 7.5)-containing buffer released almost the total of the cellular pool into the soluble fraction (Fig. 3D).

The antisera failed in immunolocalization experiments, as staining of WT cells was not significantly different to that observed with the null mutant cell lines. This may be due to the low abundance of antigens or to a poor recognition of the native proteins by antibodies raised against the recombinant proteins.

Attempts to Demonstrate LmxMBAP Adaptor Complex Interaction—With the finding that LmxMBAP contains putative sorting signals in its carboxyl terminus, two alternative approaches for the detection of adaptor complex/subunits were taken. First, a biochemical affinity purification strategy was used. Using a synthetic peptide corresponding to the last 20 amino acids of the LmxMBAP, which contains the sorting signals YMKF and II, coupled to an affinity matrix via an inserted amino-terminal cysteine residue, following binding of Leishmania promastigote cytosolic extracts, eluted proteins profiles were assessed for potential binding proteins. However, by comparison to eluates from a glutathione-Sepharose column, used as a negative control, no novel bands were detected which could be used for further analysis. Second, the yeast two-hybrid system was used with the cytoplasmic domain of LmxMBAP as bait to screen both promastigote and amastigote cDNA libraries. These experiments proved to be unsuccessful as many false-positives were identified with sequencing of isolated clones. Once the deletion mutants became available, it could be demonstrated by immunofluorescence studies that the absence of the Lmx1- and µ1-ADAPTINs did not change the endosomal/lysosomal localization of LmxMBAP (data not shown and see Ref. 25). It may be added, that characterization of the 1 and µ1 cell lines for the presence of the GPI-anchored surface molecules, which have been implicated as being important for virulence, LPG, GP63, and PPGs (19, 21, 37), was performed using immunofluorescence with a panel of monoclonal antibodies directed against epitopes of these molecules (described in Ref. 38). By comparison to WT cells, the null mutants also displayed these molecules on their surface (data not shown).

Null Mutant 1 and µ1 L. mexicana Parasites Are Not Infectious for Macrophages or Mice—By comparison to WT L. mexicana parasites, 1 and µ1 promastigotes were unable to establish infection of in vitro cultured macrophages (Fig. 4, A and B). This effect was directly correlated with the loss of the L. mexicana 1- and µ1-ADAPTIN gene products as shown by the ability of the complemented null mutant cell lines to infect the host cells. In the case of the complemented 1 mutants, expression under the control of the ribosomal promoter (1+cRIB1) showed that 86% of the macrophages were parasitized, whereas only 62% of the macrophages were infected with the episomally complemented 1 mutant (1+pX1, Fig. 4A). The results obtained with the complemented µ1 cell lines (µ1+cRIBµ1 and µ1+pXµ1) were comparable to that of the WT parental strain (Fig. 4B). To assess whether the null mutants were non-infectious due to a lack of attachment and invasion of macrophages, time course experiments were performed. The null mutant parasites proved to be just as efficient as the L. mexicana wild-type cells and the complemented null mutants with regard to their uptake by macrophages. Fig. 5 shows representative pictures of fixed macrophages stained for nucleic acid taken at various times. After 1 day, all cell lines had invaded macrophages; however, the percentage of infected macrophages was lower for the null mutants compared with the WT (Fig. 4, C and D). By day 3, macrophages harboring WT cells showed the formation of the parasitophorous vacuole (PV); however, at this time point the number of macrophages infected with the 1 and µ1 mutant cell lines had significantly decreased and those parasites seen in macrophages appeared to be in very small vacuoles (Figs. 4, C and D and 5). Subsequent time points showed colonized macrophages, infected with WT and and the complemented null mutant (1+cRIB1 and µ1+pXµ1) cells lines, contained mature parasite-harboring compartments, where the ovoid-shaped parasites were close to the membrane of the organelle, a characteristic feature for Leishmania mexicana PVs. In contrast, by day 4 and day 5 most of the 1 and µ1 mutant parasites had been cleared, respectively.

View larger version (26K): [in this window] [in a new window]   FIG. 4. Analysis of macrophage and mouse infections by promastigotes of L. mexicana WT, 1, and µ1 and the respective complemented null mutant cell lines. Peritoneal macrophages were infected at a ratio of two stationary phase promastigotes per cell. The percentage of parasitised host cells (sample size 300) was counted 6-days postinfection. The bars represent the average of duplicate determinations, and S.E. are indicated. A, infection of peritoneal macrophages by L. mexicana WT, 1, 1+cRIB1 and 1+pX1. B, infection of peritoneal macrophages by L. mexicana WT, µ1, µ1+cRIBµ1, and µ1+pXµ1. Time course of infection of peritoneal macrophages after challenge by L. mexicana WT, 1, 1+cRIB1 (C) and WT, µ1, and µ1+pXµ1 (D). The ratio of infected to uninfected macrophages was determined at days 1, 2, 3, 4, 5, and 7 postinfection. For mouse infections, Balb/c mice were challenged with 107 promastigotes in the left hind footpad. The swellings caused by L. mexicana WT, 1, 1+cRIB1, and 1+pX1 (E) and L. mexicana WT, µ1, µ1+cRIBµ1, and µ1+pXµ1 (F) were measured relative to the uninfected right hind footpad. These experiments were performed in duplicate, using four mice in each group, and S.E. are shown.

View larger version (98K): [in this window] [in a new window]   FIG. 5. Time course experiment of macrophages infected with promastigotes of L. mexicana WT, null mutants, and the complemented null mutant cell lines. Peritoneal macrophages were infected at a ratio of two stationary phase promastigotes per cell. At each time point, indicated on the left column, cells were fixed and nucleic acid stained with DAPI. Large arrows indicate parasites, and arrowheads show the vacuoles, which are formed where the parasites are closely associated with the vacuole membrane. The cell lines used are indicated at the top of each column.

Several previous studies have shown that in vitro macrophage infection experiments correlate with in vivo mouse infectivity (20, 39–41). In this study this correlation holds true, as the 1 and µ1 L. mexicana parasites proved to be avirulent to Balb/c mice even at the high parasite dose (10⁷/mouse) used, as no significant swelling of the inoculated footpads was observed (Fig. 4, E and F). In both cases virulence could be restored by the complemented null mutant cell lines. The rate of onset and progression of disease where the 1+cRIB1 cell line was used for infection was comparable to that of the WT parental strain, and lesion development was slower in mice infected with the 1+pX1 promastigotes (Fig. 4E). Although some of the mice infected with the complemented null mutant cell lines, µ1+cRIBµ1 and µ1+pXµ1, failed to develop lesions (50% in both cases), for the rest the progression of disease was still much slower than the control WT promastigotes (shown in Fig. 4F). Unsuccessful attempts to re-isolate parasites from the injected foot-pad, lymph nodes, and spleen from mice infected with the 1- or µ1- null mutant cells, indicated that there were no persistent parasites in these animals.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
The results obtained in this study show the identification and initial characterization of two adaptin homologues of the pathogenic, protozoan L. mexicana. The significant sequence identities of these two ORFs to 1- and µ1-adaptins from other organisms (Fig. 1, A and B) and phylogenetic analyses which group these proteins within these classes of adaptins suggest that these subunits are potential components of a L. mexicana AP-1 complex homologue that by analogy to other heterotetrameric AP-1 complexes would be involved in the formation of clathrin-coated vesicles at the TGN.

The high degree of -adaptin sequence conservation implicates an important functional role of this subunit within the AP complexes. Although it has been proposed that -adaptins may be involved in targeting of the complexes to appropriate membranes (11), a definitive role has yet to be determined. The ORFs of the 1-adaptins contain several conserved blocks, which are also present in the L. mexicana 1-ADAPTIN primary sequence. One of these segments conform to the consensus, which is considered a signature for the -adaptins according to the PROSITE data base (Fig. 1A).

The µ-adaptins have been implicated in cargo selection by recognition of distinct sorting signals found within the cytoplasmic tails of certain transmembrane proteins (12). Resolution of the crystal structure of the µ2-adaptin complexed to the tyrosine motif, YXX, has identified the domains involved in signal recognition that form a hydrophobic pocket into which the Y and residues fit (42). These amino acid segments are conserved in the µ2 subunits from all species. The binding domains present in the µ1-adaptins are very similar, therefore it has been postulated that one amino acid change may alter the binding affinity and specificity for the X-residue. Examination of the L. mexicana µ-ADAPTIN primary sequence shows the presence of many highly conserved sequence blocks found in µ-adaptins of other organisms, including the PROSITE signature sequence, and amino acids involved in sorting motif interaction are identical to the class of µ1-adaptins from other organisms. Based on these criteria, the L. mexicana - and µ-ADAPTINs identified in this study have been assigned Lmx1- and µ1-ADAPTIN (according to the genetic nomenclature for Leishmania stipulated by Ref. 43). The number of molecules per Leishmania promastigote for each adaptin was estimated at 1 x 10⁴, and 50% of this amount was found to be in the membrane-associated pool. Therefore this amount appeared to be too low for detection by the antisera used in localization studies.

One feature of coat proteins is their ability to cycle between cytosolic and membrane-bound pools (1). The nature of association of AP complexes with membranes has been investigated by extracting membrane fractions with varying concentrations of different salts and detergents, where the results obtained indicated that the complexes behave as peripheral membrane proteins (44). The findings reported here showed that both Lmx1- and µ1-ADAPTINs were found to be partially associated with membranes. However unlike the adaptins studied in other organisms, the L. mexicana adaptins were not susceptible to dissociation from membranes after treatment with moderate concentrations of salt or detergent (Fig. 3, C and D and data not shown). Most of the total cellular pool could be solubilized in the presence of 0.8 M Tris-HCl (pH 7.5), and this must be a specific Tris effect rather than that of an elevated ionic strength, as NaCl had no effect in releasing these L. mexicana adaptins from the membrane.

Studies performed by disrupting the S. cerevisiae AP subunits genes, of which there are 13 genes encoding homologues of the heterotetrameric complexes to assemble three AP complexes with one extra µ chain, showed that the deletion strains did not display any discernible phenotype (14). It was therefore proposed that, for these mutant unicellular eukaryotes, alternative mechanisms are used for sorting and coated vesicle formation. It appears also that this is the case for both Lmx1- and µ1-ADAPTINs, as it was possible to generate null mutants of both of these genetic loci and obtain viable promastigotes.

In contrast, studies on disrupting AP complex genes in higher eukaryotes has led to the conclusion that these heterotetramers are essential for the development of multicellular organisms (13). In particular, targeted disruption of the mouse µ1A-adaptin gene resulted in embryonic lethality (45). It was found that no free -, 1-, or 1-subunits were present in fibroblasts and -1-1 subcomplexes were unable to associate with membranes, which has been suggested to cause the rerouting of mannose 6-phosphate receptors. Interestingly, these µ1A-adaptin cells showed reduced expression levels of 1-adaptin, which indicate reduced stability of free adaptins. The results obtained in this study showed that disruption of the Lmxµ1-ADAPTIN gene resulted in the down-regulation of Lmx1-ADAPTIN protein, as only minute amounts of this adaptin were detected in the µ1 cell line. Re-introduction of the Lmxµ1-ADAPTIN gene into µ1 cells restored the expression of the Lmx1-ADAPTIN protein to WT levels (Fig. 3, A and B). This observation suggests that both of these L. mexicana adaptins are components of the same AP complex. Overexpression of both Lmx1- and µ1-ADAPTIN genes, from either an episome or under the control of the ribosomal promoter, did not result in large quantities of protein detected, but rather WT levels were present in these cell lines (Fig. 3, A and B), which suggests that the excess proteins not incorporated into an AP complex are degraded.

The Lmx1- and µ1-ADAPTINS were dispensable for growth of promastigote stage parasites; however, the function(s) of these proteins were clearly essential for transformation to amastigotes or proliferation of these mammalian stage cells, as the null mutant promastigote cell lines, 1 and µ1, were unable to establish infection when introduced into macrophages or mice (Fig. 4). That the 1 and µ1 parasites retained the ability to invade macrophages is shown by the kinetic experiments performed, however, with time the invading 1 and µ1 parasites were killed and cleared by the host cells, whereas WT and complemented null mutant (1+cRIB1 and µ1+pXµ1) cells survived and proliferated (Figs. 4, C and D and 5). The start of vacuole formation is observed in macrophages colonized by WT and complemented null mutant cells on day 3. In contrast, 1 and µ1 parasites appear unable to induce PV formation and were rapidly cleared from macrophages. In comparison to WT cells, both these null mutant cell lines also displayed the GPI-anchored molecules on their surface, which have been proposed to be required for infection, and it is unlikely that these molecules would require adaptin-mediated sorting. It must be noted that for L. mexicana, absence of LPG, GP63, PPGs, and GIPLs do not render these parasites avirulent for mice (20, 38, 40, 41).

Infection of mice with the 1 and µ1 cell lines showed that in comparison to WT and the respective complemented cells lines, the null mutants were impaired in lesion formation (Fig. 4, E and F). For the µ1+cRIBµ1- and µ1+pXµ1-complemented cell lines although the mice showed lesion formation, the onset and rate of disease progression was lower in comparison to the WT control. In vivo, expression of the µ1-ADAPTIN may be lower without selection pressure, which would result in reduced amounts of 1-ADAPTIN, as Western blot analysis showed that lower levels of 1-ADAPTIN were detected in the µ1 cell line (Fig. 3A). Therefore in the complemented µ1 cell lines, the slower progression of disease may be due to the overall effect of reduced amounts of 1- and µ1-ADAPTINs. In addition, several reports have shown that, for reasons unknown, complementation systems only give qualitative information when compared to infection with wild-type parasites (39, 46–48).

By analogy to heterotetrameric AP-1 complexes in other organisms, it is most likely that the Lmx1- and µ1-ADAPTINs would play a functional role for sorting of proteins at the TGN for delivery to the endosomal/lysosomal system. However, it is difficult to speculate which parasites proteins need to be accurately sorted that are required for transformation and proliferation of amastigotes. Initially, it was assumed that these adaptin subunits may be involved in the sorting of the LmxMBAP due to potential sorting signals contained within its cytoplasmic domain (25), but localization studies have shown that this protein is delivered to the endosomal/lysosomal network in both the 1 and µ1 cell lines, as in WT parasites. Although the LmxMBAP is expressed in both life cycles stages of L. mexicana, parasites that lack this protein still retain the ability to cause disease in mice (49). It is also unlikely that the Lmx1- and µ1-ADAPTINs would play an essential role in the sorting of cysteine proteases to megasomes, which have been characterized in L. mexicana, as parasites lacking these proteins are able to establish infection in mice (46).

The results obtained in this study lead to the conclusion that like yeast, L. mexicana promastigotes maintained under laboratory conditions do not require 1- and µ1-ADAPTIN function for viability. However, with similarity to multicellular organisms where it is essential that multiple transport and sorting events are highly accurate for development, introduction of these parasites into the mammalian host leads to a stringent requirement for the 1- and µ1-ADAPTINS during differentiation or proliferation or both, which is required for infectivity of these unicellular, pathogenic organisms. A better biochemical and functional characterization of the AP-1 complex containing the Lmx1- and µ1-ADAPTINs may require the simultaneous overexpression of all four subunits either in Leishmania or a heterologous system.

	FOOTNOTES

 
^* This research was funded by the Max-Planck-Gesellschaft. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. The nucleotide sequence(s) reported in this paper has been submitted to the GenBank^TM/EBI Data Bank with accession number(s) AF514805 [GenBank] and AF514806 [GenBank] .

To whom correspondence should be addressed: Cambridge Institute for Medical Research, Wellcome Trust/MRC Bldg., Box 139, Addenbrooke's Hospital, Hills Rd., Cambridge CB2 2XY, United Kingdom. E-mail: sg360{at}cam.ac.uk.

¹ The abbreviations used are: CCVs, clathrin-coated vesicles; TGN, trans-Golgi network; PM, plasma membrane; AP, adaptor protein; DIG, digoxygenin; ORF, open reading frame; PBS, phosphate-buffered saline; DAPI, 4',6-diamidino-2-phenylindole; WT, wild type; PV, parasitophorous vacuole.

	ACKNOWLEDGMENTS

 
The author thanks the following people: Professor Peter Overath, Drs. Thomas Ilg, Martin Wiese, and Frank Weise for helpful advice, discussions, and reagents; Dr. Attila Garami for expert help and advice with the mouse and macrophage infection experiments; Michaela Hempel and Monika Demar for technical assistance. The author is indebted to Peter Overath for his continuous support in allowing this research to be conducted in his laboratory. Sincere thanks to those at the CIMR: Drs. Matthew Seaman, Carmel Stober, and Jacqui Whyte.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 

1. Schekman, R., and Orci, L. (1996) Science 271, 1526–1533[Abstract]
2. Boehm, M., and Bonifacino, J. S. (2001) Mol. Biol. Cell. 12, 2907–2920[Abstract/Free Full Text]
3. Robinson, M. S., and Bonifacino J. S. (2001) Curr. Opin. Cell Biol. 13, 444–453[CrossRef][Medline] [Order article via Infotrieve]
4. Pearse, B. M. F. (1975) J. Mol. Biol. 97, 93–98[CrossRef][Medline] [Order article via Infotrieve]
5. Brodsky, F. M., Chen, C.-Y., Knuehl, C., Towler, M. C., and Wakeham, D. E. (2001) Annu. Rev. Cell Dev. Biol. 17, 517–568[CrossRef][Medline] [Order article via Infotrieve]
6. Kirchhausen, T. (1999) Annu. Rev. Cell Dev. Biol. 15, 705–732[CrossRef][Medline] [Order article via Infotrieve]
7. Hirst, J., and Robinson, M. S. (1998) Biochim. Biophy. Acta. 1404, 173–193[Medline] [Order article via Infotrieve]
8. Ahle, S., and Ungewickell, E. (1989) J. Biol. Chem. 264, 20089–20093[Abstract/Free Full Text]
9. Shih, W., Gallusser, A., and Kirchhausen, T. (1995) J. Biol. Chem. 270, 31083–31090[Abstract/Free Full Text]
10. Robinson, M. S. (1993) J. Cell Biol. 123, 67–77[Abstract/Free Full Text]
11. Page, L. J., and Robinson M. S. (1995) J. Cell Biol. 131, 619–630[Abstract/Free Full Text]
12. Bonifacino, J. S., and Dell'Angelica, E. C. (1999) J. Cell Biol. 145, 923–926[Free Full Text]
13. Boehm, M., and Bonifacino, J. S. (2002) Gene (Amst.) 286, 175–186[CrossRef][Medline] [Order article via Infotrieve]
14. Huang, K. M., D'Hondt, K., Riezman, H., and Lemmon, S. K. (1999) EMBO J. 18, 3897–3908[CrossRef][Medline] [Order article via Infotrieve]
15. Shim, J., Sternberg, P. W., and Lee, J. (2000) Mol. Biol. Cell. 11, 2743–2756[Abstract/Free Full Text]
16. Zizioli, D., Meyer, C., Guhde, G., Saftig, P., von Figura, K., and Schu, P. (1999) J. Biol. Chem. 274, 5385–5390[Abstract/Free Full Text]
17. Shim, J., and Lee, J. (2000) Mol. Cell. 10, 309–316
18. Alexander, J., and Russell, D. G. (1992) Adv. Parasitol. 31, 175–254[Medline] [Order article via Infotrieve]
19. Turco, S. J., Spath, G. F., and Beverley, S. M. (2001) Trends Parasitol. 17, 223–226[CrossRef][Medline] [Order article via Infotrieve]
20. Ilg, T. (2000) EMBO J. 19, 1953–1962[CrossRef][Medline] [Order article via Infotrieve]
21. Hilley, J. D., Zawadzki, J. L., McConville, M. J., Coombs, G. H., and Mottram, J. C. (2000) Mol. Biol. Cell. 11, 1183–1195[Abstract/Free Full Text]
22. Webster, P., and Russell, D. G. (1993) Parasitol. Today. 9, 201–206[CrossRef][Medline] [Order article via Infotrieve]
23. Overath, P., Stierhof, Y.-D., and Wiese, M. (1997) Trends Cell Biol. 7, 27–33[Medline] [Order article via Infotrieve]
24. Weise, F., Stierhof, Y.-D., Kuehn, C., Wiese, M., and Overath, P. (2000) J. Cell Sci. 113, 4587–4603[Abstract]
25. Wiese, M., Berger, O., Stierhof, Y. D., Wolfram, M., Fuchs, M., and Overath, P. (1996) Mol. Biochem. Parasitol. 82, 153–165[CrossRef][Medline] [Order article via Infotrieve]
26. Kelley, R. J., Alexander, D. L., Cowan, C., Balber, A. E., and Bangs, J. D. (1999) Mol. Biochem. Parasitol. 98, 17–28[CrossRef][Medline] [Order article via Infotrieve]
27. McConville, M. J., Mullin, K. A., Ilgoutz, S. C., and Teasdale, R. D. (2002) Microbiol. Mol. Biol. Rev. 66, 122–154[Abstract/Free Full Text]
28. Morgan, G. W., Hall, B. S., Denny, P. W., Field, M. C., and Carrington, M. (2002) Trends Parasitol. 18, 540–546[CrossRef][Medline] [Order article via Infotrieve]
29. LeBowitz, J. H., Coburn, C. M., McMahon-Pratt, D., and Beverley, S. M. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 9736–9740[Abstract/Free Full Text]
30. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
31. Coulson, R. M. R., and Smith, D. F. (1990) Mol. Biochem. Parasitol. 40, 63–75[CrossRef][Medline] [Order article via Infotrieve]
32. Medina-Acosta, E., and Cross, G. A. M. (1993) Mol. Biochem. Parasitol. 59, 327–330[CrossRef][Medline] [Order article via Infotrieve]
33. Cruz, A., Coburn, C. M., and Beverley, S. M. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 7170–7174[Abstract/Free Full Text]
34. Freedman, D. J., and Beverley, S. M. (1993) Mol. Biochem. Parasitol. 62, 37–44[CrossRef][Medline] [Order article via Infotrieve]
35. Militz, A., Mottram, J. C., Overath, P., and Aebischer, T. (2000) Mol. Biochem. Parasitol. 107, 251–261[CrossRef][Medline] [Order article via Infotrieve]
36. Harlow, E., and Lane, D. (1988) Antibodies- A Laboratory Manual. Cold Spring Harbor Press, Cold Spring Harbor, NY
37. Ilg, T. (2000) Parasitol. Today 16, 489–497[CrossRef][Medline] [Order article via Infotrieve]
38. Ilg, T., Demar, M., and Harbecke, D. (2001) J. Biol. Chem. 276, 4988–4997[Abstract/Free Full Text]
39. Wiese, M. (1998) EMBO J. 17, 2619–2628[CrossRef][Medline] [Order article via Infotrieve]
40. Garami, A., and Ilg, T. (2001) EMBO J. 20, 3657–3666[CrossRef][Medline] [Order article via Infotrieve]
41. Garami, A., Mehlert, A., and Ilg, T. (2001) Mol. Cell. Biol. 21, 8168–8183[Abstract/Free Full Text]
42. Owen, D. J., and Evans, P. R. (1998) Science 282, 1327–1332[Abstract/Free Full Text]
43. Clayton, C. et al. (1998) Mol. Biochem. Parasitol. 97, 221–224[CrossRef][Medline] [Order article via Infotrieve]
44. Dell'Angelica, E. C., Ohno, H., Ooi, C. E., Rabinovich, E., Roche, K. W., and Bonifacino, J. S. (1997) EMBO J. 16, 917–928[CrossRef][Medline] [Order article via Infotrieve]
45. Meyer, C., Zizioli, D., Lausmann, S., Eskelinen, E.-L., Hamann, J., Saftig, P., von Figura, K., and Schu, P. (2000) EMBO J. 19, 2193–2203[CrossRef][Medline] [Order article via Infotrieve]
46. Mottram, J. C., Souza, A. E., Hutchinson, J. E., Carter, R., Frame, M. J., and Coombs, G. H. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 6008–6013[Abstract/Free Full Text]
47. Späth, G. F., Epstein, L., Leader, B., Singer, S. M., Avila, H. A., Turco, S. J., and Beverley, S. M. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 9258–9263[Abstract/Free Full Text]
48. Joshi, P. B., Kelly, B. L., Kamhawi, S., Sacks, D. L., and McMaster, W. R. (2002) Mol. Biochem. Parasitol. 120, 33–40[CrossRef][Medline] [Order article via Infotrieve]
49. Benzel, I., Weise, F., and Wiese, M. (2000) Mol. Biochem. Parasitol. 111, 77–86[CrossRef][Medline] [Order article via Infotrieve]

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				J. E. Vince, D. L. Tull, T. Spurck, M. C. Derby, G. I. McFadden, P. A. Gleeson, S. Gokool, and M. J. McConville Leishmania Adaptor Protein-1 Subunits Are Required for Normal Lysosome Traffic, Flagellum Biogenesis, Lipid Homeostasis, and Adaptation to Temperatures Encountered in the Mammalian Host Eukaryot. Cell, August 1, 2008; 7(8): 1256 - 1267. [Abstract] [Full Text] [PDF]

				P. F. Andreotti, J. L. Monteiro da Silva, E. C. Teixeira, M. C. Bertolini, C. P. Soares, G. Benard, and M. J. S. Mendes-Giannini Identification of a gene encoding adaptin-like protein in the Paracoccidioides brasiliensis genome by random amplified polymorphic DNA analysis J. Med. Microbiol., July 1, 2007; 56(7): 884 - 887. [Abstract] [Full Text] [PDF]

				M. C. Touz, L. Kulakova, and T. E. Nash Adaptor Protein Complex 1 Mediates the Transport of Lysosomal Proteins from a Golgi-like Organelle to Peripheral Vacuoles in the Primitive Eukaryote Giardia lamblia Mol. Biol. Cell, July 1, 2004; 15(7): 3053 - 3060. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 278/32/29400    most recent M304572200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Gokool, S. Search for Related Content PubMed PubMed Citation Articles by Gokool, S. Social Bookmarking                      What's this?