| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 278, Issue 32, 30356-30364, August 8, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|| ** 
From the
Laboratorio Nazionale del Consorzio
Interuniversitario per le Biotecnologie (LNCIB), Area Science Park, Padriciano
99, 34012 Trieste, the ¶Istituto Nazionale
Tumori, Dipartimento Oncologia Sperimentale, via Venezian 1, 20133 Milan,
||Dipartimento Biochimica, Biofisica e Chimica
delle Macromolecole, Universita di Trieste, via Giorgeri 1, 34100 Trieste, and
**Dipartimento Scienze e Tecnologie Biomediche,
Universita di Udine, piazzale Kolbe, 33100 Udine, Italy
Received for publication, March 21, 2003 , and in revised form, May 12, 2003.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
The murine GTSE-11 (G2 and S phase-expressed) gene, previously named B99, was cloned in our laboratory during a screening of p53-inducible genes from a murine cell line that stably expresses a temperature-sensitive p53 allele (6). Wild-type p53 (wt-p53) induces GTSE-1 transcription by an active p53-binding site located in the promoter region; however, similar to other p53 target genes, GTSE-1 is also induced by DNA damage independent of p53 status (6). Further characterization of murine GTSE-1 protein showed that is mainly localized to the microtubules (6), although clear evidence of nuclear-cytoplasmic shuttling of the protein has been observed in our laboratory.2 GTSE-1 protein is cell cycle-regulated with increased expression during S and G2 phases. It becomes phosphorylated in mitosis and markedly reduced in G1 (7). Overexpression of GTSE-1 resulted in a delay of the G2 to M phase transition independent of p53 (6). The same cell cycle regulation, cellular localization, and the ability to delay the G2 phase have been also observed for the GTSE-1 human homologue protein, hGTSE-1 (8).
Here we report that hGTSE-1 can control DNA damage-induced apoptosis by regulating p53 stability and function. We provide evidence that hGTSE-1 protein can negatively regulate p53 levels and activity, thus affecting DNA damage-induced apoptosis in wt-p53 cells. The proposed mechanism by which hGTSE-1 regulates p53 activity involves a physical interaction between the C-terminal region of hGTSE-1 and the C-terminal regulatory domain of p53. Moreover, hGTSE-1 knock-down (KD) by small interference RNA (siRNA) resulted in S/G2-specific increase of p53 levels and cell sensitization to DNA damage-induced apoptosis during these cell cycle phases, thus implying that endogenous hGTSE-1 plays a role in p53-dependent apoptosis control during the cell cycle window where it is physiologically expressed.
|
EXPERIMENTAL PROCEDURES |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
Plasmids
For transient transfection experiments, pcDNA3-hGTSE-1 containing
full-length hGTSE-1 cDNA (8)
was used. The N-terminal hGTSE-1 construct (NT-hGTSE-1) encodes for a deletion
mutant of hGTSE-1 from amino acids 1–476 inserted into pcDNA3
(Invitrogen). The C-terminal hGTSE-1 construct (CT-hGTSE-1) encodes for a
deletion mutant of hGTSE-1 from amino acids 476–720 inserted into
pcDNA3.1 with a His6 N-terminal tag (Invitrogen).
GFP·hGTSE-1 contains the full-length hGTSE-1 fused to GFP (pEGFP
vector, Clontech). pcDNA3-p53wt contains the full-length human wt-p53 cDNA.
The p53 reporter plasmid employed for luciferase assays was the pG13-Luc,
which contains 13 repeats of a p53 consensus sequence. GFP·p53 contains
human wild-type p53 fused to the GFP protein.
Transfection and Reporter Gene Assay
DNA—Expression vectors were transfected in mid-log growth
phase U2OS cells using the calcium phosphate method. Unless stated otherwise,
cells were analyzed 24 h after transfection.
siRNA—Transfection of siRNA (Dharmacon Research) was performed as described by Elbashir et al. (9) using Oligofectamine (Invitrogen). Reporter plasmid and siRNA cotransfection was carried out using LipofectAMINE 2000 (Invitrogen) as recommended by the manufacturer for siRNA in adherent cells. In all cases, medium without antibiotics was used. The hGTSE-1 mRNA targeted sequence was AAAUUUGACUUCGAUCUUUCA (sihGTSE-1). The control siRNA used was AACCUUUUUUUUUGGGGAAAA (siCONT). siRNA for human p53 was designed as described by Brummelkamp et al. (10).
For luciferase assay, cells were transfected with the reporter plasmid (pG13-Luc) and a plasmid encoding Renilla luciferase, pRL-CMV. The assay was performed with a dual luciferase kit (Promega). Renilla luciferase activity was used to standardize p53 activation values for transfection efficiency.
Immunoprecipitation and Western Blot Analysis
Cells were harvested in ice-cold lysis buffer containing 50 mM
Tris-HCl, pH 8, 150 mM NaCl, 1% Nonidet P-40, 0.1 mM
sodium orthovanadate, 2 mM dithiothreitol, 0.1 mM
phenylmethylsulfonyl fluoride, 5 mM EDTA, and 10 µg/ml each of
chymostatin, leupeptin, antipain, and pepstatin. Lysis was performed at 4
°C for 10 min. The lysates were then clarified by centrifugation and
precleared with 20 µl of Protein A-Sepharose CL-4B (Amersham Biosciences).
Then antibody prebound to 20 µl of Protein A-Sepharose CL-4B was added and
incubated at 4 °C for 4 h. The resin was washed, and bound proteins were
eluated in SDS-PAGE sample buffer.
Western blot analysis was performed according to standard procedures using the following primary antibodies: affinity-purified LF1 anti-hGTSE-1 polyclonal antibody, DO-1 anti-p53 monoclonal antibody (Santa Cruz Biotechnology), anti-actin polyclonal antibody (Sigma), and N20 anti-Bax polyclonal antibody (Santa Cruz Biotechnology). Bound primary antibodies were visualized by enhanced chemiluminescence (ECL; Amersham Biosciences) after addition of horseradish peroxidase-conjugated secondary antibodies.
Immunofluorescence, Apoptosis, Flow Cytometry, and in Vitro Binding
Assay
Immunofluorescence—Cells were fixed in 3% paraformaldehyde,
treated with Triton X-100, and stained using specific antibodies followed by a
fluorescein isothiocyanate or RITC-conjugated secondary antibody (Sigma).
Images were analyzed with a laser scan confocal microscope (Leica).
Apoptosis—Cell death was assessed by scoring apoptotic morphology of the nucleus stained with propidium iodide (P.I.) by counting at least 200 cells on each experiment.
Flow Cytometry—After siRNA transfection and ET treatment, cells were harvested by trypsin treatment and fixed with cold 70% ethanol. After washing with phosphate-buffered saline, cells were treated with RNase A, and then DNA was stained with propidium iodide (25 µg/ml). Cytometric analysis was performed on a Bryte HS (Bio-Rad) cytofluorimeter. Cell sorting was performed by a FACSventage instrument (Becton-Dickinson) as reported by Delia et al. (11).
In Vitro Binding Assay—35S-labeled proteins were in vitro translated using reticulocyte lysates (TNT system; Amersham Biosciences) and incubated with purified GST or GST·p53 or GST·p53 deletion mutants immobilized on glutathione-Sepharose 4B beads (Amersham Biosciences). Bound proteins were eluted and resolved in SDS-PAGE.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
|
To directly assess the role of hGTSE-1 in p53-induced apoptosis, we used a well characterized model based on wt-p53 overexpression in Saos-2 cells. wt-p53-expressing vector was transfected together with GFP·hGTSE-1 or GFP alone. 48 h later, cells were fixed and stained using an anti-p53 polyclonal antibody, and the apoptotic nuclei were scored in cotransfected cells. As shown in Fig. 1D, GFP·hGTSE-1 significantly reduced p53-induced apoptosis when compared with cells transfected with GFP alone, thus confirming that hGTSE-1 overexpression could efficiently interfere with p53 proapoptotic activity.
We next investigated the role of endogenous hGTSE-1 in apoptosis induced by DNA damage. For this purpose we designed siRNA to KD hGTSE-1 protein expression in human cells. The ability of the specific siRNA for hGTSE-1 (named sihGTSE-1) to down-regulate hGTSE-1 protein levels was tested in U2OS cells. As shown in Fig. 2A, 40 h after sihGTSE-1 transfection, expression of endogenous hGTSE-1 protein was almost completely abolished. A scrambled siRNA (named siCONT) was used as control.
|
To address the physiological role of hGTSE-1 in DNA-damaged cells, U2OS cells were transfected with siCONT or sihGTSE-1. 40 h after siRNA transfection, cells were treated with 50 µM ET. Apoptosis was then determined as subG1 population by using flow cytometry analysis. As observed in Fig. 2B, hGTSE-1/knock-down (hGTSE-1/KD) cells displayed an increased subG1 population after ET when compared with control cells. Fig. 2C shows a representative field evidencing the enhancement of apoptotic nuclei induced by ET treatment in hGTSE-1/KD cells when compared with cells transfected with control siRNA. The obtained data suggest that hGTSE-1 knockdown significantly sensitizes cells to undergo apoptotic cell death upon treatment with DNA-damaging agents.
Finally, to analyze the involvement of p53 in apoptosis induced by DNA damage in hGTSE-1/KD cells, the effect of ET treatment was evaluated in hGTSE-1/p53 double knock-down cells. U2OS cells were transfected with sihGTSE-1, sip53 (siRNA specific for p53 silencing, Brummelkamp et al., Ref. 10), and their combination as indicated in Fig. 2D. sip53 efficiency to down-regulate p53 levels was about 80–90% as determined by Western blotting (data not shown). Although in the absence of damage no significant apoptosis was detected, hGTSE-1/KD cells displayed enhanced cell death compared with cells transfected with control siRNA when treated with ET. Interestingly, p53 silencing significantly rescued susceptibility of hGTSE-1/KD cells to ET-induced apoptosis. These data and those presented in Fig. 1B indicate that p53 is a key element for hGTSE-1-dependent control of apoptosis upon DNA damage.
hGTSE-1 Expression Regulates p53 Activity and Protein Levels—Because we obtained evidence pointing to a role of hGTSE-1 in p53-dependent apoptosis after DNA damage, we investigated the functional activity of p53 in cells expressing different levels of hGTSE-1. We first established a U2OS cell line with hGTSE-1 expression under the control of tetracycline. p53 protein levels were determined in cell lysates of all seven hGTSE-1-inducible clones obtained after 24 h of tetracycline removal. As shown in two representative clones (Fig. 3A), p53 levels strongly decreased after hGTSE-1 induction, suggesting that overexpressed hGTSE-1 is able to reduce endogenous levels of p53. We then determined p53 transactivation activity in U2OS cells transiently cotransfected with a synthetic promoter containing multiple p53 binding sites (pG13-Luc) together with hGTSE-1 or an empty vector. As shown in Fig. 3B, overexpression of hGTSE-1 efficiently down-regulated endogenous p53-driven transactivation activity, altogether suggesting that hGTSE-1 could exert resistance to DNA damage-induced apoptosis at least in part by regulating p53.
|
p53 levels and activity were then determined in cells expressing lower levels of hGTSE-1 protein by siRNA-hGTSE-1 silencing. In agreement with hGTSE-1 overexpression data, down-regulation of endogenous hGTSE-1 resulted in a moderate increase of p53 protein level (Fig. 3C). Consistently, enhancement of p53 transactivation was detected after quantification of the pG13-Luc reporter activity when cotransfected with sihGTSE-1 (Fig. 3D).
Although silencing of hGTSE-1 increased p53 levels and activity in unstressed cells, it failed to stimulate apoptotic cell death. This fact could indicate that the amount of accumulated p53 in hGTSE-1/KD cells is not sufficient to induce apoptosis or that accumulated p53 is not fully active or efficiently modified to trigger the apoptotic process. To investigate this hypothesis, we analyzed p53 levels and activity in hGTSE-1/KD cells exposed or not to ET treatment (25 µM for 18 h). Phosphorylation of p53 in serine 15 is a key event during its full activation (13). Using a p53-Ser-15 phospho-specific antibody, we observed that hGTSE-1 knock-down did not induce detectable p53 phosphorylation in the absence of damage, whereas it followed p53 increments in ET-treated cells. Consistently, levels of the p53-induced proapoptotic protein Bax remained unchanged in unstressed hGTSE-1/KD cells, whereas its up-regulation was clearly detected after ET treatment (Fig. 3E). Finally, when p53 transactivation function was assessed using the pG13-Luc reporter, we observed that hGTSE-1 silencing could significantly enhance p53 activity even in cells treated with ET (Fig. 3F), thus concluding that increased p53 levels due to hGTSE-1 silencing should synergize with DNA damage-dependent p53 stabilization and activation, therefore providing a more robust p53 response when compared with cells expressing normal levels of hGTSE-1 protein.
hGTSE-1 Physically Interacts with p53—Looking for possible mechanisms linking hGTSE-1 expression with p53 regulation, we investigated whether hGTSE-1 could physically interact with p53. hGTSE-1/p53 interaction was analyzed in vivo by coimmunoprecipitation assay. U2OS cells were cotransfected with vectors expressing hGTSE-1 and the GFP·p53 fusion protein. Cell lysates were immunoprecipitated with hGTSE-1 antiserum and immunoblotted using the DO-1 anti-p53 monoclonal antibody. The results demonstrate that hGTSE-1 and p53 can bind to each other because the 90-kDa GFP·p53 protein specifically immunoprecipitated with the anti-hGTSE-1 antiserum (Fig. 4A). To obtain evidence that this association could occur between the respective endogenous products, U2OS cells lysates were immunoprecipitated with DO-1 anti-p53 antibody or 9E10 anti-Myc antibody as control. Fig. 4B shows that endogenous p53 and hGTSE-1 can physically interact, because hGTSE-1 coprecipitated when DO-1 antibody was used. Similar results were also obtained in HCT116 cells (data not shown).
|
We then performed in vitro binding experiments to define the interaction region between hGTSE-1 and p53. In vitro translated (IVT) 35S-labeled hGTSE-1 protein was incubated with different GST·p53 deletions described in Fig. 4C. As shown in Fig. 4D, hGTSE-1 was bound by the C-terminal region of p53 (amino acids 355–393), which has been established as a p53 regulatory domain crucial for the control of its transactivation function.
The region of hGTSE-1 that is able to bind p53 was then determined by using IVTs of two hGTSE-1 constructs coding from amino acid 1 to 476 (NT-hGTSE-1) and from amino acid 476 to 720 (CT-hGTSE-1). These deletions were tested for in vitro binding to the full-length p53 (GST·p53) as described above. As shown in Fig. 4E, CT-hGTSE-1 was preferentially retained on the beads containing GST·p53, supporting the existence of a direct interaction between the C-terminal regions of hGTSE-1 and p53.
To confirm the data obtained in in vitro assays, the effect of NT-hGTSE-1 and CT-hGTSE-1 deletion mutants on endogenous p53 transactivation function was assessed in U2OS cells. p53 activity was analyzed in transiently transfected cells with the indicated hGTSE-1 constructs together with the pG13-Luc reporter. As shown in Fig. 4F, the construct lacking the region involved in p53 binding (NT-hGTSE-1) completely lost the ability to down-regulate p53 activity when compared with the full-length protein. Interestingly, the CT-hGTSE-1 deletion mutant maintained full ability to repress p53 transactivation activity, thus suggesting that hGTSE-1 regulation of p53 activity correlates with its ability to bind p53. Moreover, the hGTSE-1 region involved in p53 binding is necessary and sufficient to repress p53 transactivation function. hGTSE-1 Plays a Role in DNA Damage-induced Cell Death during the S and G2 Phases—hGTSE-1 protein is specifically expressed during S and G2 phases of the cell cycle (8), with an expression profile similar to that of cyclin A. This behavior could indicate that endogenous hGTSE-1 may regulate p53 in a cell cycle-specific manner. To address this topic, U2OS cells were transfected with sihGTSE-1 or siCONT, and 40 h later the DNA dye Hoechst 33342 was added to the culture medium. Using a fluorescence-activated cell sorter (FACS, Becton-Dickinson), cells in G1 phase (DNA content, 2N) and those in S/G2/M phases (DNA content, more than 2N to 4N) were separated, and p53 levels were determined in all fractions. As shown in Fig. 5A, although siRNA-dependent hGTSE-1 silencing did not affect p53 levels of G1 phase cells, it specifically increased p53 protein levels in cells passing S/G2/M phases, indicating that hGTSE-1 is a cell cycle-specific regulator of p53.
|
This result prompted us to investigate whether cells in the course of the S and G2 phases could be more sensitive to apoptosis when hGTSE-1 was silenced. To address this issue, U2OS cells were transfected with sihGTSE-1 or siCONT and treated with ET as described for Fig. 2B. 18 h after ET treatment, cells were fixed and stained with an anti-cyclin A antibody as S/G2 marker and P.I. A similar number of apoptotic cells were counted in hGTSE-1/KD and control cells and then scored for the reactivity to cyclin A, as indicated in the fields shown in Fig. 5B. Interestingly, among the hGTSE-1/KD cells, the cyclin A-positive subpopulation with apoptotic morphology displayed a considerable increase with respect to the control (Fig. 5C). Cyclin A protein levels were not changed by hGTSE-1 silencing or ET treatment (Fig. 5D), implying that the increased ratio of apoptotic hGTSE-1/KD cells positive to cyclin A was not because of increased cyclin A-positive population. All together these results suggest that by regulating p53, endogenous hGTSE-1 plays a role in apoptosis control during S and G2, the cell cycle window where it is physiologically expressed.
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
The potential mechanism by which hGTSE-1 regulates p53 activity involves a physical interaction between the C-terminal region of hGTSE-1 and the C-terminal regulatory domain of p53. Moreover, the C-terminal region of hGTSE-1 is sufficient to repress p53 transactivation function. The C-terminal regulatory domain of p53 is the target for several post-translational modifications, such as phosphorylation (14, 15) and acetylation (16, 17), regulating p53 activity and stability, thus suggesting that the interaction of hGTSE-1 within this domain could interfere with one or more modifications required for p53 function.
Recent observations obtained in this laboratory on the subcellular localization of GTSE-1 suggest that it can shuttle from cytoplasm (where it localizes to the microtubules) to the nucleus relying on conserved nuclear localization and nuclear export signals.2 In addition, DNA damage induces a p53-independent stabilization of hGTSE-1 protein as well as its accumulation in the nucleus (see Fig. 1C), thus targeting p53 nuclear activities.2
DNA damage causes G1 and G2/M cell cycle arrest.
p53-dependent arrest of cells in G1 through p21waf1
expression is an important component of cellular response to stress, although
p53-independent mechanisms involving cyclin D1 degradation have been recently
reported (18). DNA damage
causes an immediate p53-independent G1 arrest due to a rapid
proteolysis of cyclin D1, thus suggesting that DNA damage is at least a
two-step process: a fast p53-independent phase mediated by cyclin D1
degradation and a slower maintenance of arrest depending on increased p53
stability. Similarly, it has been shown that genotoxic stress activates
p53-dependent and p53-independent pathways that contribute to G2/M
cell cycle arrest (reviewed in Ref.
19). Using different
approaches it has been demonstrated that p53 is not required for the initial
arrest of human cells in G2 but plays a crucial role for the
long-term maintenance of the arrest
(20,
21). A role of p53 in
maintaining G2 arrest may be attributable to its ability to
transcriptionally repress both cdc2 and cyclin B1 genes
(22,
23) and to inhibit cdc2 via
the p53 target genes: Gadd45, 14–3-3
, and
p21waf-1
(19). The mentioned data
explain some mechanisms involved in p53-dependent G2 arrest.
However, emerging evidence could indicate a cell cycle-dependent regulation of
p53 function. It has been shown that Mdm2·p53 complex was
preferentially found in S/G2 phases of the cell cycle
(24). Moreover, as we
described for hGTSE-1, 14–3-3 overexpression induces
G2 cell cycle arrest
(25).
14–3-3 regulates the cdc2·cyclin B1 complex and,
therefore, the entry into mitosis
(26). It has been reported
that 14–3-3 is also able to delay the apoptotic program
through sequestration of Bax
(27). More recently, another
protein with S/G2-specific expression, PTTG1/securin, has been
shown to be involved in the regulation of p53
(28). Similar to hGTSE-1,
PTTG1/securin binds the C-terminal regulatory domain of p53 and represses p53
transactivation and apoptosis. The behavior of proteins such as hGTSE-1,
14–3-3, and PTTG1/securin involved in both G2 cell
cycle regulation and apoptosis delay imply that DNA damage-induced
G2 arrest may be accompanied by specific mechanisms that control
the triggering of the apoptotic program within this phase of the cell
cycle.
In conclusion, we observed that hGTSE-1 plays a specific role after DNA damage by controlling p53-dependent functions during S/G2. This is supported by the fact that hGTSE-1 silencing resulted in enhanced p53 levels and augmented susceptibility to DNA damage-induced apoptosis in S/G2 cell population. In this context, we propose that after DNA damage, hGTSE-1 could play a dual role during the G2 checkpoint, promoting the delay of G2 to M transition and protecting, at the same time, these cells from p53-dependent apoptosis.
|
FOOTNOTES |
|---|
* This work was supported by Associazione Italiana per la Ricerca sul Cancro
Grant 0661-00 and Ministero dell'Istruzione dell'Università e della
Ricerca Grant MM05187239_004 (to C. S.). The costs of publication of this
article were defrayed in part by the payment of page charges. This article
must therefore be hereby marked "advertisement" in
accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 
Supported by a Fondazione Italiana per la Ricerca sul Cancro
fellowship.
To whom correspondence should be addressed. Tel.: 39-040-398985; Fax:
39-040-398990; E-mail:
schneide{at}sci.area.trieste.it.
1 The abbreviations used are: GTSE-1, G2 and S phase-expressed-1
protein; hGTSE-1, human GTSE-1; NT-hGTSE-1; N-terminal hGTSE-1; CT hGTSE-1,
C-terminal hGTSE-1; wt, wild-type; siRNA, small interfering RNA; ET,
etoposide; GFP, green fluorescence protein; RITC, rhodamine B isothiocyanate;
P.I., propidium iodide; GST, glutathione S-transferase; IVT, in
vitro translated; KD, knock-down.
2 M. Monte, R. Benetti, L. Collavin, and C. Schneider, manuscript in
preparation.
|
ACKNOWLEDGMENTS |
|---|
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  C.-M. Hogerkorp and C. A. K. Borrebaeck The Human CD77- B Cell Population Represents a Heterogeneous Subset of Cells Comprising Centroblasts, Centrocytes, and Plasmablasts, Prompting Phenotypical Revision J. Immunol., October 1, 2006; 177(7): 4341 - 4349. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Monte, M. Simonatto, L. Y. Peche, D. R. Bublik, S. Gobessi, M. A. Pierotti, M. Rodolfo, and C. Schneider MAGE-A tumor antigens target p53 transactivation function through histone deacetylase recruitment and confer resistance to chemotherapeutic agents PNAS, July 25, 2006; 103(30): 11160 - 11165. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Hofstetter, V. Vuong, A. Broggini-Tenzer, S. Bodis, I. F. Ciernik, D. Fabbro, M. Wartmann, G. Folkers, and M. Pruschy Patupilone Acts as Radiosensitizing Agent in Multidrug-Resistant Cancer Cells In vitro and In vivo Clin. Cancer Res., February 15, 2005; 11(4): 1588 - 1596. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L.-R. Yu, T. P. Conrads, T. Uo, Y. Kinoshita, R. S. Morrison, D. A. Lucas, K. C. Chan, J. Blonder, H. J. Issaq, and T. D. Veenstra Global Analysis of the Cortical Neuron Proteome Mol. Cell. Proteomics, September 1, 2004; 3(9): 896 - 907. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Khurana and T. M. Kristie A Protein Sequestering System Reveals Control of Cellular Programs by the Transcriptional Coactivator HCF-1 J. Biol. Chem., August 6, 2004; 279(32): 33673 - 33683. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Monte, R. Benetti, L. Collavin, L. Marchionni, G. Del Sal, and C. Schneider hGTSE-1 Expression Stimulates Cytoplasmic Localization of p53 J. Biol. Chem., March 19, 2004; 279(12): 11744 - 11752. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Kanamori, P. Sandy, S. Marzinotto, R. Benetti, C. Kai, Y. Hayashizaki, C. Schneider, and H. Suzuki The PDZ Protein Tax-interacting Protein-1 Inhibits {beta}-Catenin Transcriptional Activity and Growth of Colorectal Cancer Cells J. Biol. Chem., October 3, 2003; 278(40): 38758 - 38764. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research |
indicates GFP·hGTSE-1 expressing cells and their respective
nuclei. 
indicates apoptotic cells. D, percentage of apoptotic
nuclei in Saos-2 cells coexpressing p53 and GFP or p53 and GFP·
hGTSE-1.
