| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 278, Issue 33, 30975-30984, August 15, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
¶ ||
From the
Departments of Medicine and
¶Pharmacology, Weill Medical College of Cornell
University, New York, New York 10021 and the
Cardiovascular Research Institute, University of
California, San Francisco, California 94143
Received for publication, March 31, 2003 , and in revised form, May 27, 2003.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONEXPERIMENTAL PROCEDURESRESULTS AND DISCUSSIONCONCLUSIONSREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTS AND DISCUSSIONCONCLUSIONSREFERENCES |
|---|
Lsc/p115-RhoGEF (Arhgef1) is a Rho-specific GEF that is expressed in
lymphoid and myeloid tissue and, to a lesser degree, in other organs
(8–10).
Lsc/p115-RhoGEF contains conserved DH and PH domains, an N-terminal RGS
(regulator of G-protein signaling)-like
domain, and a C-terminal predicted coiled-coil domain (see
Fig. 1). Lsc/p115-RhoGEF is
both an effector and a regulator of the heterotrimeric GTPase subunit
G
13. G13 activates Lsc/p115-RhoGEF
exchange activity (11) and can
be inhibited by the RGS-like domain of Lsc/p115-RhoGEF
(12). This is of particular
interest because it enables Lsc/p115-RhoGEF to couple ligand activation of
G13-coupled receptors to Rho signaling pathways.
|
Recently, targeted disruption of Lsc demonstrated that it is required for normal B and T lymphocyte function. Lsc–/– mice have reduced populations of splenic marginal zone B cells, enhanced marginal zone B cell chemotaxis, impaired proliferation of stimulated splenic B cells, and a reduced population of splenic T cells (13). Lsc–/– mice have impaired thymus-dependent and type 2 thymus-independent immune responses (13).
Despite its essential role, Lsc/p115-RhoGEF signaling in lymphocytes in vivo is not well understood. Several ligands for G13-coupled receptors activate Rho and are known to affect lymphocyte function, including sphingosine 1-phosphate (14, 15) and lysophosphatidic acid (16, 17). However, it is not known which ligands activate Lsc/p115-RhoGEF or which effector pathways are activated by Lsc/p115-RhoGEF signaling in vivo. To define Lsc signaling pathways in vivo, we set out to identify proteins that interact with regulatory regions of Lsc. Previous work demonstrated that deletion of the C-terminal 110 or 152 amino acids (aa) C-terminal to the PH domain of p115-RhoGEF confers a gain of function in vivo (10, 18). We hypothesized that the corresponding region might negatively regulate the murine ortholog Lsc. Deletion of the C-terminal 146 aa of Lsc conferred a 2–3-fold gain of function, suggesting that this region, containing a predicted coiled-coil domain, negatively regulates Lsc in vivo. We isolated a larger C-terminal fragment of Lsc itself in a screen for proteins that interact with this regulatory C terminus. We subsequently demonstrated that Lsc homo-oligomerizes and is negatively regulated through domains in its C terminus and that Lsc activity can be regulated by generating functionally distinct isoforms lacking these domains.
|
EXPERIMENTAL PROCEDURES |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTS AND DISCUSSIONCONCLUSIONSREFERENCES |
|---|
-D-galactopyranoside was
obtained from ICN Biomedicals (Aurora, OH). Anti-FLAG monoclonal antibody M2,
3-amino-1,2,4-triazole, aprotinin, and phenylmethylsulfonyl fluoride were
obtained from Sigma. Anti-hemagglutinin peptide (HA) monoclonal antibody 12CA5
was obtained from Roche Applied Science. Horseradish peroxidase-conjugated
goat anti-mouse antibody was obtained from Bio-Rad. Protein A-Sepharose beads
were obtained from Amersham Biosciences. All yeast media were obtained from
Qbiogene (Carlsbad, CA). Grade 410 filter paper for yeast filter lifts was
obtained from VWR (West Chester, PA). All other chemical reagents were
obtained from Fisher unless noted otherwise. Cell Culture—COS-7 and NIH 3T3 cells were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% bovine calf serum (BCS), 4.5 g/liter glucose, 100 IU/ml penicillin, and 100 µg/ml streptomycin. Transfections were performed with LipofectAMINE and Plus reagents (Invitrogen) according to the manufacturer's instructions except where noted. Saccharomyces cerevisiae strain Y190 was obtained from Clontech (Palo Alto, CA) and maintained and manipulated according to standard protocols (19).
cDNA—NIH 3T3 cells (ATCC CRL1658) were obtained from the
American Type Culture Collection (Manassas, VA), and total RNA was extracted
with Trizol reagent (Invitrogen) according to the manufacturer's instructions.
C57BL/6J mice received 
3 x 108 sheep red blood cells by
intraperitoneal injection; and 10 days later, total RNA was extracted from
their spleens with Trizol reagent. Total RNA was used to generate first-strand
cDNA using an oligo(dT)12–18 primer with the Superscript
first-strand synthesis kit (Invitrogen) according to the manufacturer's
instructions.
Plasmids—All DNA manipulations were performed using standard
techniques (20) and verified
by DNA sequencing using dye terminator chemistry. Lsc cDNA nucleotide (nt)
residues are numbered with reference to the deoxyadenosine of the start codon
designated nt 1. The pAS2-1, pACT2, and pTD1-1 vectors were obtained from
Clontech. pRL-TK was obtained from Promega (Madison, WI). The modified serum
response element (SRE)-mediated reporter plasmid pSRE.L
(21) was a generous gift from
Dianqing Wu (University of Rochester). pBJ1 was a generous gift from Mark
Davis (Stanford University). Plasmid construction is described below. The
oligonucleotides used to construct these plasmids are listed in
Table I. For HA.Lsc-pBJ1 and
FLAG.Lsc-pBJ1, Lsc cDNA nt 1–2760 encoding aa 1–919 and a stop
codon were amplified by PCR from NIH 3T3 cDNA with DL1020 and DL1021 and
subcloned into pCR2.1 (Invitrogen). A linker (DLh1 annealed to DLh2) encoding
a consensus Kozak sequence (5'-GCCACCATGG-3' on the sense strand)
(22) and an HA epitope
(YPYDVPDYA) or a linker (DLf1 annealed to DLf2) encoding a consensus Kozak
sequence and a FLAG epitope (DYKDDDDK) was subcloned into the
XhoI-NdeI sites of this plasmid, and the
XhoI-EcoRI fragments of the resulting plasmids were
subcloned into the XhoI-EcoRI sites of pBJ1. For
HA.Lsc.
CT-pBJ1 and FLAG.Lsc.CT-pBJ1, a linker replacing Lsc nt
2320–2760 encoding aa 774–919 with a stop codon (DL1060 annealed
to DL1061) was subcloned into the BamHI-BamHI sites of
HA.Lsc-pBJ1 and FLAG.Lsc-pBJ1, respectively. For HA.Lsc.DH-pBJ1,
HA.Lsc-pBJ1 was digested with PmlI and religated to delete Lsc nt
1287–1995 encoding aa 430–665. For Lsc.CT-pAS2-1, Lsc cDNA nt
2320–2760 encoding aa 774–919 were amplified by PCR from NIH 3T3
cDNA with DL1003 and DL1004; the product was subcloned into pCR2.1 to generate
Lsc.CT-pCR2.1; and the EcoRI-EcoRI fragment from this
plasmid was subcloned into the EcoRI site of pAS2-1. For
Lsc.PH+CT-pACT2, the NcoI-XhoI fragment of
FLAG.Lsc.PH+CT-pBJ.KS was subcloned into the NcoI-XhoI sites
of pACT2. For FLAG.Lsc.PH+CT-pBJ.KS, the EcoRI-XhoI fragment
of the GIP9 library clone was subcloned into the EcoRI-XhoI
sites of pBJ.KS, and then a linker encoding a consensus Kozak sequence and a
FLAG epitope (DLA annealed to DLB) was subcloned into the
SpeI-EcoRI sites of the resulting plasmid. For
GIP9LscORF-pACT2, the GIP9 library clone was digested with
PmlI-StuI, and the blunt ends were religated to delete a
region corresponding to Lsc nt 1959–2750. For Lsc.CT-pACT2, the
NcoI-SalI fragment of Lsc.CT-pAS2-1 was subcloned into the
NcoI-XhoI sites of pACT2. For Lsc.PH-pACT2, Lsc nt
1813–2319 encoding aa 605–773 were amplified by PCR from NIH 3T3
cDNA with DL1066 and DL1068 and subcloned into pCR-Blunt II-TOPO (Invitrogen),
and the XmaI-SacI fragment of the resulting plasmid was
subcloned into the XmaI-SacI sites of pACT2. For
HA.Lsc.CT-pBJ1, the NheI-XbaI fragment of HA.Lsc.CT-pcDNA3.1
was subcloned into the XbaI site of pBJ1. For HA.Lsc.CT-pcDNA3.1, a
linker encoding a consensus Kozak sequence and an HA epitope (LDW1 annealed to
LDW2) was subcloned into the NheI-EcoRI sites of
FLAG.Lsc.CT-pcDNA3.1. For FLAG.Lsc.CT-pcDNA3.1, a linker encoding a consensus
Kozak sequence, a FLAG epitope, and an internal EcoRI site (DL1007
annealed to DL1008) was subcloned into the HindIII-XhoI
sites of pcDNA3.1(+) (Invitrogen), and the EcoRI-EcoRI
fragment of Lsc.CT-pCR2.1 was subcloned into the EcoRI site of the
resulting plasmid. For FLAG.Lsc.CT-pBJ1, Lsc nt 2320–2760 encoding aa
774–919 were amplified from NIH 3T3 cDNA by PCR with DL1071, an
N-terminal primer encoding a consensus Kozak sequence and a FLAG epitope, and
DL1063. The product was subcloned into pCR2.1, and the
XhoI-SpeI fragment of the resulting plasmid was subcloned
into the XhoI-XbaI sites of pBJ1. For
Lsc.CT-(774–836)-pAS2-1, a linker replacing Lsc nt 2512–2760
encoding aa 837–919 (DL2027 annealed to DL2028) was subcloned into the
AlwNI-SalI sites of Lsc.CT-pAS2-1. For Lsc.CT(EST)-pAS2-1,
the EcoRI-XhoI fragment of Lsc.PH+CT-pACT2 was subcloned
into the EcoRI-XhoI sites of pBluescript II SK(–)
(Stratagene, La Jolla, CA) to form Lsc.PH+CT-pBS. The
SfiI-StuI fragment of the expressed sequence tag (EST)
uu91h07.y1 (GenBankTM/EBI accession number BG148369
[GenBank]
) was subcloned into
the SfiI-StuI sites of this plasmid to form
Lsc.PH+CT(EST)-pBS, and the BlpI-StuI fragment of this
plasmid was subcloned into the BlpI-StuI sites of
Lsc.CT-pAS2-1, deleting Lsc nt 2488–2706 encoding aa 830–902. For
Lsc.CT(CC)-pAS2-1, a linker deleting Lsc nt 2584–2679 encoding aa
862–893 (DL2003 annealed to DL2004) was subcloned into the
ApaI-StuI sites of Lsc.CT-pAS2-1. For
Lsc.CT-(834–919)-pAS2-1, a linker deleting Lsc nt 2320–2499
encoding aa 774–833 (DL2044 annealed to DL2045) was subcloned into the
NcoI-AlwNI sites of Lsc.CT-pAST2–1. For
Lsc.CT-(858–919)-pAS2-1, a linker deleting Lsc nt 2320–2571
encoding aa 774–857 (DL2046 annealed to DL2047) was subcloned into the
NcoI-ApaI sites of Lsc.CT-pAST2–1. For
HA.Lsc.CC-pBJ1, the XbaI-EcoRI fragment from
HA.Lsc-pBJ1 was subcloned into the XbaI-EcoRI sites of
pBluescript II SK(–) to generate Lsc(X-E)-pBS; the
SfiI-StuI fragment of Lsc.CT(CC)-pAS2-1 was subcloned
into the SfiI-StuI sites of Lsc(X-E)-pBS; and the
XbaI-EcoRI fragment of the resulting plasmid was subcloned
into the XbaI-EcoRI sites of HA.Lsc-pBJ1. For
HA.Lsc.CC(P-P)-pBJ1, L875P and L882P missense mutations were introduced into
HA.Lsc-pBJ1 using the QuikChange site-directed mutagenesis kit (Stratagene)
with primers DL2090 and DL2091. The BamHI-BamHI fragment of
the resulting plasmid was then subcloned into the corresponding
BamHI-BamHI sites of a fresh copy of HA.Lsc-pBJ1. For
HA.Lsc.237-pBJ1, the c237 amplicon from c237-pCR2.1-TOPO was released with
EcoRI and religated in the opposite orientation, and the
BamHI-BamHI fragment from the resulting plasmid was
subcloned into the BamHI-BamHI sites of HA.Lsc-pBJ1. For
HA.Lsc.249-pBJ1, the KpnI-XhoI fragment of c249-pCR2.1-TOPO
was subcloned into the KpnI-XhoI sites of pBluescript II
SK(–), and the BamHI-BamHI fragment from the resulting
construct was subcloned into the BamHI-BamHI sites of
HA.Lsc-pBJ1. For HA.Lsc.EST-pBJ1, the SfiI-StuI fragment of
EST BG148369
[GenBank]
was subcloned into the SfiI-StuI sites of
Lsc(X-E)-pBS, and the XbaI-EcoRI fragment from the resulting
plasmid was subcloned back into the XbaI-EcoRI sites of
HA.Lsc-pBJ1. For HA.dynamin-pBJ1, human dynamin-1 was subcloned into the
multicloning site of pBJ1. For gal-pBJ.KS, the
HindIII-BamHI fragment from pSV--galactosidase
(Promega) was subcloned into the HindIII-BamHI sites of
pBJ.KS. For pBJ.KS, the pBJ1 promoter and poly(A) tail were subcloned upstream
and downstream, respectively, of the pBluescript KS(+) (Stratagene)
multicloning site.
|
Yeast Two-hybrid Screen—S. cerevisiae strain Y190 with
integrated GAL1-UAS-HIS3 and
GAL1-UAS--galactosidase reporter genes (Clontech) was
sequentially transformed with Lsc.CT-pAS2-1 and then an NIH 3T3 cDNA library
in vector pACT2. pAS2-1 and pACT2 are Gal4-binding domain (BD) and Gal4
activation domain (AD) fusion protein vectors, respectively. Cotransformants
were grown on synthetic dropout medium lacking tryptophan, leucine, and
histidine and supplemented with 25 mM 3-amino-1,2,4-triazole.
Candidate clones were identified by selecting for activation of the
HIS3 reporter gene and screening for activation of the
-galactosidase reporter gene. HIS3 reporter gene expression was
selected for by retrieving colonies 
3 mm in diameter after 8 days of
incubation at 30 °C. -Galactosidase reporter activity was screened
for by immersing a filter lift of cotransformed colonies in liquid nitrogen
for 15 s and then exposing it to
5-bromo-4-chloro-3-indolyl--D-galactopyranoside (X-gal) for 8
h at 30 °C. Blue colonies were scored positive for -galactosidase
activity. A total of 2.5 x 105 colonies were evaluated for
expression of the HIS3 reporter gene; 20 of these had robust growth
(3 mm in diameter), and three of these demonstrated -galactosidase
reporter activation. An additional four cotransformants were <3 mm in
diameter, but had particularly strong -galactosidase reporter activity.
The two groups were combined, and a total of seven cotransformants were
selected for further workup. The library plasmid from each clone was isolated
as described (23), and the
library insert was sequenced.
Colony Filter Lift -Galactosidase
Assay—Single yeast colonies were streaked in a patch (10 x 15
mm) on synthetic dropout medium lacking tryptophan and leucine and incubated
for 72 h at 30 °C. Filter lifts of the patches were processed as described
for the yeast two-hybrid screen.
Yeast Liquid Culture -Galactosidase
Assay—This assay was conducted as described
(23) with the modifications
noted below. Three independent colonies of each cotransformed strain were
grown separately to logarithmic phase in synthetic defined medium lacking
tryptophan and leucine; the absorbance at 600 nm was measured; and the yeast
cells in a 1.5-ml aliquot were pelleted by centrifugation. Each pellet was
washed and resuspended in 200 µl of buffer A (60 mM
Na2HPO4·7H2O, 40 mM
NaH2PO4·H2O, 10 mM KCl, and
1 mM MgSO4·7H2O). 100-µl aliquots
of resuspended cells were subjected to three freeze-thaw cycles in liquid
nitrogen, and then 750 µl of 0.27% -mercaptoethanol in buffer A and
150 µl of 4 mg/ml
o-nitrophenyl--D-galactopyranoside in buffer A were
added. When the supernatant turned pale yellow, 400 µl of 1 M
Na2CO3 was added; the mixture was centrifuged; and the
absorbance of the supernatant at 420 nm was recorded. -Galactosidase
units = 1000 x A420/(t x V
x A600), where t is the time in minutes
from the addition of
o-nitrophenyl--D-galactopyranoside to the addition
of Na2CO3, V is 0.1x starting cell volume
of 1.5 ml/resuspended cell volume of 0.10 ml, and A600 is
the value for each sample measured during logarithmic growth phase
(23). The -galactosidase
units were normalized to the controls indicated in the figure legends.
SRE-mediated Transcription Assay—The pSRE.L reporter plasmid
has been described (21). The
pRL-TK plasmid contains the Renilla reniformis (sea pansy) luciferase
cDNA downstream of the herpes simplex virus thymidine kinase gene promoter.
COS-7 cells were plated at a density of 5 x 104 cells/well in
Falcon Primaria 24-well plates (BD Biosciences), transfected in serum-free
medium for 3 h, and incubated in medium with 0.5% BCS for 24 h; and then the
firefly and Renilla luciferase activities of the cell lysate were
measured using the dual luciferase assay reporter system (Promega) with a
MicroLumat Plus LB96V luminometer (Berthold Technologies, Bad Wildbad,
Germany). The firefly luciferase activities of cells transfected with Lsc and
each Lsc mutant are presented as the mean ± S.D. of four independent
wells in each experiment, where the measured firefly luciferase activity of
each well was adjusted for transfection efficiency by calculating the ratio of
measured firefly luciferase activity to Renilla luciferase activity
and then normalized to the control transfected with only pRL-TK, pSRE.L, and
gal-pBJ.KS. The firefly luciferase activities of Lsc and Lsc mutants
were compared using a one-way analysis of variance; and if a difference
existed, post hoc pairwise comparisons were made using the
Student-Newman-Keuls test
(24).
Immunoprecipitation and Immunoblotting—Immunoprecipitation and immunoblotting were performed using standard methods (25) with the modifications noted below. COS-7 cells were plated at a density of 2 x 105 cells/well in Falcon Primaria 6-well plates (BD Biosciences), transiently transfected for 12–16 h, and then incubated in DMEM supplemented with 10% BCS for an additional 24 h. Cell lysates were harvested with 1 ml of cold lysis buffer (50 mM Hepes (pH 7.4), 150 mM NaCl, 2 mM EDTA, 1% Igepal, 10% glycerol, 10 mM NaF, 100 µg/ml phenylmethylsulfonyl fluoride, 1 µg/ml aprotinin, and one tablet of Complete protease inhibitor mixture (Roche Applied Bioscience)/50 ml of lysis buffer) and gentle scraping and spun at 14,000 x g for 10 min, and the protein concentration of the supernatants was measured (DC protein assay, Bio-Rad) and equalized by dilution in lysis buffer. Anti-FLAG antibody M2 was added to 400 µl of supernatant; the mixture was incubated on ice for 3 h; protein A-Sepharose beads (100 µl of a 50:50 slurry) were added; and the samples were rocked for 1 h and then washed three times with cold lysis buffer. The beads were pelleted; the supernatant was removed; and 2x Laemmli buffer with 10% dithiothreitol was added. The samples were boiled for 5 min, subjected to PAGE, transferred to a polyvinylidene difluoride membrane (Bio-Rad), and blotted sequentially with murine anti-HA monoclonal antibody 12CA5 and horseradish peroxidase-conjugated goat anti-mouse antibody. Crude lysate was removed prior to the addition of the M2 immunoprecipitating antibody, processed similarly, and blotted with either the 12CA5 or M2 antibody. The immunoblots were developed with the ECL Plus detection system (Amersham Biosciences) according to the manufacturer's instructions, and images were collected with a Storm 860 imager (Amersham Biosciences).
Amplification of Lsc Partial cDNAs from Spleen—Lsc partial cDNA clones were amplified by PCR from mouse spleen first-strand cDNA using primers DL1026 and DL2080 with an annealing temperature of 60 °C for 40 cycles on a RoboCycler Gradient 96 temperature cycler (Stratagene). The PCR reaction products were subjected to agarose gel electrophoresis; and amplicons smaller than the common isoform amplicon were isolated, subcloned into pCR2.1-TOPO (Invitrogen), and sequenced. The sequences of these clones were aligned with the cDNA sequence of the common isoform of Lsc (GenBankTM/EBI accession number U58203 [GenBank] ) to identify partial cDNAs lacking exonic sequence found in the common isoform. These clones were aligned with the Lsc genomic DNA sequence (GenBankTM/EBI accession number AC073679 [GenBank] ) to predict the 5'- and 3'-splice junction sequences corresponding to the absent exonic sequence. Because >98% of introns utilize the consensus 5'-GT/3'-AG intronic splice site dinucleotide pair (26), we considered only clones with this dinucleotide pair for further analysis.
|
RESULTS AND DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTS AND DISCUSSIONCONCLUSIONSREFERENCES |
|---|
|
Deletion of the C terminus of p115-RhoGEF did not confer a gain of function in vivo in one report that compared the activities of p115-RhoGEF and a mutant form of p115-RhoGEF lacking both N- and C-terminal residues (29). Deletion of the C terminus can confer a gain of function in the absence of these N-terminal residues (10), so it is unlikely that this explains the absence of an effect.
The Regulatory C Terminus of Lsc Homo-oligomerizes—To
identify proteins that interact with the regulatory C terminus of Lsc, we
conducted a yeast two-hybrid screen of an NIH 3T3 cDNA library using a peptide
fragment corresponding to the C-terminal 146 aa of Lsc as bait. We screened a
library derived from NIH 3T3 cells because they express endogenous Lsc
(8) and could be expected to
express proteins that interact with Lsc. The library was cloned into the pACT2
vector expressing translated library products as fusion proteins with an
N-terminal Gal4-AD. A total of seven candidate clones were isolated from 2
x 105 screened cotransformants. One of these clones, GIP9
(GEF-interacting protein-9),
contained a partial cDNA encoding the 315-aa C terminus of Lsc itself (nt
1813–2760), including the PH domain and regulatory C terminus.
Cotransformation with bait and GIP9 plasmids was necessary and sufficient to
specifically activate the -galactosidase reporter (Supplemental Fig. 1),
but sequencing revealed that the Lsc partial cDNA in GIP9 was not in the same
translation frame as the upstream Gal4-AD cDNA. Yeast two-hybrid screens
utilizing the pACT2 library vector have isolated clones in which the presumed
reading frame of the library inserts did not match the frame of the upstream
Gal4-AD cDNA
(30–32),
and functional complementation
(30) and Western blotting
(31) were used to demonstrate
that alternate frame translation products of the insert were expressed from
the pACT2 vector. Cotransformation of yeast with the bait plasmid and a
version of GIP9 with the Lsc partial cDNA converted to the same
translation frame as the Gal4-AD (Lsc.PH+CT-pACT2) activated the reporter
compared with the Lsc.CT-BD/no insert-AD control
(Fig. 3A), whereas
cotransformation with the bait plasmid and a version of GIP9 lacking 792 bp of
the Lsc partial cDNA down-stream of the first stop codon predicted in
the Gal4-AD reading frame (GIP9LscORF-pACT2) did not (Supplemental Fig.
1). Deletion of these 792 nucleotides did not affect the cDNA encoding the
predicted 22-aa GIP9 translation product in the Gal4-AD reading frame, but did
eliminate Lsc cDNA nucleotides that would be required to generate alternate
frame translation products in the Lsc reading frame. These results strongly
suggest that the GIP9 library clone expressed one or more alternate frame
translation products (corresponding to fragments of Lsc) that interact with
the bait peptide. This prompted us to validate this interaction in mammalian
cells using an independent method to assess intermolecular association. We
demonstrated that these two C-terminal fragments of Lsc also interact in
mammalian cells by co-immunoprecipitating differentially epitope-tagged forms
of the 146- and 315-aa fragments in transiently transfected COS-7 cells
(Fig. 3B). Together,
the results in yeast and mammalian cells indicate that Lsc self-associates
with its regulatory C terminus.
|
To determine whether residues within the 146-aa regulatory C terminus are
sufficient for Lsc self-association, we first compared the ability of the
146-aa regulatory C terminus to interact with peptide fragments corresponding
to the entire 315-aa C terminus, the 146-aa C terminus alone, and the PH
domain alone using the yeast two-hybrid system. Qualitative assessment of
-galactosidase reporter activation by filter lift assay indicated that
the 146-aa C terminus could homo-oligomerize, but did not interact with the PH
domain (Fig. 3A).
Although streaked patches of yeast expressing two fusion proteins containing
the 146-aa C terminus (Lsc.CT-BD and Lsc.CT-AD) had much less
-galactosidase activity than yeast expressing the 146-aa C terminus and
the 315-aa C terminus, they also grew much more slowly
(Fig. 3A). This raised
the possibility that the difference in reporter activation between the two
strains could be the result of a difference in cell number rather than
evidence that the PH domain is required for Lsc self-association. To address
this, we compared -galactosidase reporter activation using a
quantitative assay that partially accounts for different growth rates by
normalizing reporter activity to assayed cell number
(33). The quantitative
-galactosidase assay indicated that yeast expressing the two 146-aa
fragments activated the reporter at least 4-fold more than the control, but
less than half as much as yeast expressing the 146- and 315-aa fragments
(Fig. 3A). These
results demonstrate that the 146-aa regulatory C terminus can
homo-oligomerize, but we cannot rule out the possibility that the PH domain
directly or indirectly enhances this self-association. To demonstrate that the
regulatory 146-aa C terminus can homo-oligomerize in mammalian cells, we
co-immunoprecipitated differentially epitope-tagged forms of the 146-aa
C-terminal fragment in transiently transfected COS-7 cells
(Fig. 3B).
Lsc Homo-oligomerizes in Mammalian Cells through a Predicted Coiled-coil Domain in the Regulatory C Terminus—We hypothesized that homo-oligomerization of the regulatory C terminus might support full-length Lsc homo-oligomerization in vivo. We demonstrated that Lsc can homo-oligomerize in vivo by co-immunoprecipitating differentially epitope-tagged forms of Lsc from COS-7 cells: HA epitope-tagged Lsc co-immunoprecipitated with FLAG epitope-tagged Lsc (Fig. 4). In contrast, we were not able to co-immunoprecipitate an HA epitope-tagged form of the GTPase dynamin-1 containing a predicted coiled-coil domain (34, 35) with FLAG epitope-tagged Lsc, indicating that Lsc homo-oligomerization is specific (Fig. 4). Comparison of the Lsc band density on the anti-HA blots of the lysate and immunoprecipitate indicated that at least 20% of the heterologously expressed Lsc was homo-oligomerized. This is likely an underestimate of the extent of homo-oligomerization of the epitope-tagged proteins because it assumes 100% efficiency of the immunoprecipitating antibody and does not account for homo-oligomers dissociated during co-immunoprecipitation or formed with the endogenous primate ortholog of Lsc. To determine whether the regulatory C terminus of Lsc is necessary for Lsc homo-oligomerization, we attempted to co-immunoprecipitate differentially epitope-tagged Lsc and a mutant form of Lsc lacking the 146-aa regulatory C terminus from transiently transfected COS-7 cells. Strikingly, deletion of the 146-aa regulatory C terminus completely eliminated the ability of Lsc to homo-oligomerize: FLAG epitope-tagged Lsc was unable to co-immunoprecipitate HA epitope-tagged Lsc lacking the regulatory C terminus (Fig. 4). This demonstrates that residues in the regulatory C terminus are required for Lsc homo-oligomerization.
|
Several Rho GEFs are known to homo-oligomerize and/or hetero-oligomerize;
and in at least some cases, homo-oligomerization appears to confer a gain of
function. Heterologously expressed Dbl
(36) and RasGRF1
(37) homo-oligomerize, and
point mutations in their DH domains disrupt homo-oligomerization and confer a
loss of function. Endogenous RasGRF1 and the closely related RasGRF2 also
hetero-oligomerize (37).
1PIX (Arhgef7/p85Cool-1) homo-oligomerizes, and this requires
a predicted coiled-coil domain C-terminal to the conserved PH domain
(38,
39). Deletion of this
coiled-coil domain abrogates homo-oligomerization and the capacity to generate
membrane ruffles, suggesting that 1PIX signaling can be facilitated by
homo-oligomerization (38,
39). Heterologously expressed
1PIX and the closely related PIX (Arhgef6/Cool-2) also
hetero-oligomerize (39). Bcr
contains an N-terminal coiled-coil oligomerization domain required for the
transforming activity of the oncogenic Bcr-Abl fusion protein
(40,
41), but the effect of
oligomerization on native Bcr GEF activity has not been reported. To determine
whether the DH domain is necessary for Lsc homo-oligomerization, we
co-immunoprecipitated differentially epitope-tagged Lsc and a mutant form of
Lsc lacking the DH domain from COS-7 cells. In contrast to Dbl
(36) and RasGRF1
(37), disruption of the DH
domain had no effect on Lsc homo-oligomerization: HA epitope-tagged Lsc
lacking the DH domain co-immunoprecipitated with FLAG epitope-tagged Lsc
(Fig. 4). This demonstrates
that Lsc does not homo-oligomerize through its DH domain.
Lsc now joins a small group of Rho GEFs known to homooligomerize and, to our knowledge, is the first member that is a Rho-specific GEF (6, 9). The Rho GEFs studied to date appear to homo-oligomerize through one of three mechanisms involving the conserved DH domain, an N-terminal coiled-coil domain, or a C-terminal coiled-coil domain as with Lsc.
The COILS2.2 (42) and
PAIRCOILS (43) algorithms
predict that the 146-aa regulatory C terminus of Lsc contains a coiled-coil
domain (aa 862–893) (Fig. 5,
A and B). The PSIPRED algorithm
(44) predicts that the C
terminus also contains two other -helices (aa 799–813 and
822–837) (Fig.
5A). The predicted coiled-coil domain is present in the
human (p115-Rho-GEF; GenBankTM/EBI accession number AAH34013
[GenBank]
) and rat
(accession number CAA15426
[GenBank]
) orthologs of Lsc, indicating that it is a
conserved feature. Many proteins homo-oligomerize through coiled-coil domains
(45), and we speculated that
Lsc might homo-oligomerize through this conserved C-terminal coiled-coil
domain.
|
To identify C-terminal residues required for Lsc homo-oligomerization, we
first compared the effect of progressively smaller deletions in the 146-aa
regulatory C terminus on its ability to interact with the 315-aa C terminus of
Lsc in the yeast two-hybrid system. Deletion of the C-terminal 83 aa (Lsc.CT
(774–836)) almost completely eliminated activation of the reporter
compared with the control (Fig.
5A). Deletion of just the 31-aa coiled-coil domain
(Lsc.CT(CC)) also conferred a substantial reduction in reporter
activation, suggesting that the coiled-coil domain is required for Lsc
homo-oligomerization (Fig.
5A). Two C-terminal peptide fragments containing the
coiled-coil domain (Lsc.CT (834–919) and Lsc.CT (858–919))
autonomously activated the reporter and were not informative
(Fig. 5A).
To test whether the coiled-coil domain is required for homooligomerization of Lsc in mammalian cells, we attempted to co-immunoprecipitate differentially epitope-tagged Lsc and a mutant form of Lsc lacking the coiled-coil domain from transiently transfected COS-7 cells: deletion of the coiled-coil domain almost completely abrogated homo-oligomerization, indicating that the coiled-coil domain is required for homooligomerization (Fig. 5C).
Coiled coils form when amphipathic -helical coiled-coil domains
assemble into a superhelix
(45). Coiled-coil domains
consist of amino acid heptad repeats with the first and fourth positions
occupied by hydrophobic residues that align to form a hydrophobic interface in
the assembled superhelix (45).
To test whether the coiled-coil structure itself is required for
homooligomerization, we attempted to co-immunoprecipitate Lsc and a mutant
form of Lsc in which the coiled-coil domain was disrupted rather than deleted.
Replacement of leucine by proline in the fourth position of two successive
heptad repeats in the coiled-coil domain (L875P and L882P) is predicted to
disrupt the -helix required to form the hydrophobic face that permits
coiled-coil formation. The COILS2.2 algorithm
(42) estimates that the
L875P/L882P double substitution reduces the probability that a 28-aa region of
the C terminus will adopt a coiled-coil configuration from >95 to 0%
(Fig. 5B). This
L875P/L882P double substitution almost completely abrogated Lsc
homo-oligomerization as detected by co-immunoprecipitation
(Fig. 5C). This
indicates that the predicted coiled-coil structure itself is required for Lsc
homo-oligomerization. Homo-oligomerization was not completely eliminated as it
was with deletion of the entire C-terminal 146 aa. This suggests that another
region of the C terminus may be capable of participating in Lsc
homo-oligomerization, but to a much smaller degree than the coiled-coil
domain.
Both deletion and disruption of the coiled-coil domain virtually eliminated homo-oligomerization. In contrast to deleting the C terminus, disruption with the L875P/L882P double substitution leaves all but two residues intact. This enabled us to examine the relationship between Lsc homo-oligomerization and negative regulation more specifically. Importantly, although deletion of the 31-aa predicted coiled-coil domain conferred a small gain in function, disruption of the coiled-coil domain with the L875P/L882P double substitution conferred no significant gain of function (Fig. 5D). Together, these results demonstrate that disruption of the coiled coil substantially impairs homo-oligomerization (Fig. 5C) without conferring a gain of function (Fig. 5D). This indicates that homo-oligomerization and negative regulation are distinct functions of the C terminus and suggests that additional proteins interact with the C terminus to regulate Lsc. Deletion of the coiled-coil domain likely confers a gain of function by directly or indirectly affecting interaction with one of these proteins, whereas disrupting the coiled-coil domain does not.
Isoforms of Lsc Lacking the C-terminal Coiled-coil and Regulatory
Domains Are Present in the Spleen—Several Rho GEFs, including
PIX (38), obscurin
(46), and collybistin
(47), undergo alternative
splicing. PIX is of particular interest because the absence of the
C-terminal homo-oligomerization domain in the 2PIX splice variant
confers important functional differences compared with 1PIX
(38). Alignment of the Lsc
cDNA and genomic locus DNA sequences revealed that the regulatory C terminus
of Lsc is encoded by six exons (Fig.
6A). We hypothesized that Lsc splice variants lacking
portions of the 146-aa C-terminal regulatory domain might exist and have
important functional differences compared with the common isoform. Because Lsc
is required for normal B and T lymphocyte function, we attempted to identify
C-terminal splice variants from the spleens of adult mice. We isolated two
partial cDNAs, c237 and c249, lacking nucleotides encoding portions of the
regulatory C terminus of the common isoform, including the coiled-coil domain
(Fig. 6, A–C).
c237 lacks nucleotides corresponding to translated exon 26 of the common
isoform (nt 2486–2649) (Fig. 6,
A–C). The predicted 5'- and 3'-intronic
splice sites corresponding to the absent exon are the same sites used to join
coding exons 25 and 26 and coding exons 26 and 27 in the common isoform,
respectively (Fig. 6,
A–C). The absence of this exon generates a
frameshift so that aa 829–919 of the common isoform are replaced by 27
aa not present in the common isoform (Fig.
6, A–C). c249 lacks nucleotides corresponding to
exons 24–27 and part of exon 28 (nt 2331–2819) of the common
isoform (Fig. 6,
A–C). The predicted 5'-intronic splice site
corresponding to the absent nucleotides is the same site used to join exons 23
and 24 in the common isoform, and the predicted alternative 3'-intronic
splice site (CCCCCACCCCCACAGCTGCCACAG/C) corresponds to a suitable consensus
sequence with a pyrimidine-rich region followed by the sequence NCAG/C, where
G/C is the intron/exon border
(48). The absence of this
sequence also generates a frameshift so that aa 778–919 of the common
isoform, almost the entire regulatory C terminus, are replaced by 13 aa not
present in the common isoform (Fig. 6,
A–C).
|
Both c237 and c249 lack the coding region for the C-terminal coiled-coil domain. Strikingly, replacing the regulatory C terminus of the common isoform with the corresponding region of c237 and c249 completely abrogated homo-oligomerization and conferred a 2–3-fold gain of function (Fig. 6, D and E).
Identification of these novel isoforms of Lsc is important for several reasons. First, it indicates that functionally distinct forms of Lsc are present in the spleen, suggesting that this may be a mechanism to regulate the cellular activity of Lsc. Although transcripts for both isoforms were substantially less abundant than the transcript for the common isoform in whole spleen (data not shown), they may represent a larger fraction of the total Lsc transcript pool in homogeneous subpopulations of splenic cells such as subsets of B or T lymphocytes. It will be important to determine the cell of origin and the biological role of these splice variants. Second, the concomitant loss of homooligomerization and gain of function conferred by these alternate C termini reinforce the results from experiments described above demonstrating that Lsc homo-oligomerizes and is negatively regulated through domains in its C terminus. It is likely that the c237 and c249 isoforms represent splice variants of Lsc; the most compelling evidence is that the splice junction sites corresponding to the gaps in their cDNA sequences are identical to junctions used for splicing of the common isoform or conform to consensus splice junction sequences.
We identified the partial cDNA for another potential isoform of Lsc lacking a portion of the regulatory C terminus by searching the NCBI Murine EST Database. This EST (GenBankTM/EBI accession number BG148369 [GenBank] ) was of interest because it was isolated from resting germinal B lymphocytes and lacks portions of exons 26 and 27 (nt 2488–2706) encoding aa 830–902 of the common isoform, including the coiled-coil domain (Fig. 6, A–C). As expected from the results of experiments above, replacement of the regulatory C terminus of the common isoform with the corresponding region from EST BG148369 [GenBank] substantially reduced Lsc self-association in the yeast two-hybrid system (Fig. 5A), abrogated Lsc homo-oligomerization (Fig. 6D), and conferred a gain of function in mammalian cells (Fig. 6E). Alignment of the EST and Lsc genomic DNA sequences reveals an acceptable predicted alternative consensus 5'-splice site, but no compelling consensus 3'-splice site corresponding to the absent exonic sequence (data not shown). This EST could therefore represent an incorrect or incomplete splicing event, a correctly spliced product with an atypical 3'-splice site, or an artifact of library preparation. It is also possible that a consensus 3'-splice sequence cannot be located because the genomic sequence acquired from the NCBI Database contains a sequencing error.
|
CONCLUSIONS |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTS AND DISCUSSIONCONCLUSIONSREFERENCES |
|---|
13. G13 activates Lsc/p115-RhoGEF
exchange activity (10,
49) by an incompletely
understood mechanism. It physically associates with the N terminus of
Lsc/p115-RhoGEF and a second site between p115-RhoGEF aa 288 and 760,
including the DH domain (49).
Deletion of the C terminus enhances the affinity of Lsc/p115-Rho- GEF for
G13 in vitro
(49), consistent with a model
in which the C terminus inhibits G13 interaction with the DH
domain of Lsc/p115-RhoGEF.
|
We used the COILS2.2 algorithm
(42) to analyze 61 human Rho
GEF amino acid sequences and identified six Rho GEFs, in addition to Lsc and
1PIX, that have predicted coiled-coil domains C-terminal to their
conserved PH domain: Lbc, GEF-H1 (Arhgef2), p190-RhoGEF, PIX (Arhgef6),
p114-RhoGEF, and KIAA720. This raises the possibility that one or more of
these Rho GEFs homo-oligomerize in a manner similar to Lsc and potentially
hetero-oligomerize with one another. Previous work has identified molecules
that bind the coiled-coil domain-containing C termini of several of these Rho
GEFs. The catenin-like protein -catulin binds a portion of the C
terminus of Lbc and augments GEF activity
(50). A portion of the GEF-H1
C terminus is necessary for microtubule association
(51,
52). Portions of the C
terminus of p190-RhoGEF are required for association with microtubules
(53), 14-3-3
(54), and a destabilizing
element of the 3'-untranslated region of the light neurofilament subunit
mRNA (55). Despite the lack of
direct proof that the coiled-coil domains in the C termini of these Rho GEFs
are required for these interactions, these interactions with the C termini
suggest that it is possible that these or other molecules could bind the C
terminus of Lsc to regulate Lsc function.
The role of homo-oligomerization in Lsc function is not clear. Other Rho
GEFs, including 1PIX
(38,
39), Dbl
(36), RasGRF1 and RasGRF2
(37), and Bcr
(40,
41), can homo-oligomerize, and
homo-oligomerization appears to facilitate signaling in vivo. The
mechanism of Lsc homo-oligomerization most closely resembles that of
1PIX, which also homo-oligomerizes through a coiled-coil domain
C-terminal to the PH domain
(38,
39). In contrast to
1PIX, the C terminus of Lsc is neither
sufficient2 nor
necessary (18) for
localization to the plasma membrane. This suggests that, although 1PIX
and Lsc may share a similar mechanism of homo-oligomerization, it serves
different functions for each.
Homo-oligomerization offers theoretical advantages, including signal amplification and scaffold formation (56). Hetero-oligomerization offers additional advantages, including facilitating cross-talk between the signaling pathways associated with the participating Rho GEFs. Interestingly, the COILS2.2 algorithm does not predict that the other Rho GEFs containing RGS-like domains (LARG, PDZ-Rho GEF, and GTRAP48) are likely to form coiled coils through the region C-terminal to their PH domains. This suggests that homo-oligomerization may serve a role in Lsc independent of the RGS-like domain.
|
FOOTNOTES |
|---|
* This work was supported by NHLBI Clinical Investigator Development Award
HL04080 from the National Institutes of Health (to D. J. L.) and by a research
award from the Cardiofellows Foundation (to D. J. L.). The costs of
publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section 1734
solely to indicate this fact. 
The on-line version of this article (available at
http://www.jbc.org)
contains Supplemental Fig. 1.
|| To whom correspondence should be addressed: Weill Medical College of Cornell University, Rm. A356, 510 E. 70th Street, New York, NY 10021. Tel.: 212-746-6282; Fax: 212-746-8184; E-mail: dal2009{at}med.cornell.edu.
1 The abbreviations used are: GEFs, guanine nucleotide exchange factors; DH,
Dbl homology; PH, pleckstrin homology; aa, amino acid(s); HA, hemagglutinin
peptide; DMEM, Dulbecco's modified Eagle's medium; BCS, bovine calf serum; nt,
nucleotide(s); SRE, serum response element; EST, expressed sequence tag; BD,
Gal4-binding domain; AD, Gal4 activation domain.
2 D. J. Lerner, unpublished data.
|
ACKNOWLEDGMENTS |
|---|
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTS AND DISCUSSIONCONCLUSIONSREFERENCES |
|---|
