Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M305480200 on June 12, 2003

J. Biol. Chem., Vol. 278, Issue 34, 31853-31860, August 22, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/34/31853    most recent
M305480200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Reed, R. C.
Right arrow Articles by Nicchitta, C. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Reed, R. C.
Right arrow Articles by Nicchitta, C. V.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

GRP94/gp96 Elicits ERK Activation in Murine Macrophages

A ROLE FOR ENDOTOXIN CONTAMINATION IN NF-{kappa}B ACTIVATION AND NITRIC OXIDE PRODUCTION*

Robyn C. Reed, Brent Berwin, Jeffrey P. Baker and Christopher V. Nicchitta {ddagger}

From the Department of Cell Biology, Duke University Medical Center, Durham, North Carolina 27710

Received for publication, May 25, 2003


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Vaccination of mice with GRP94/gp96, the endoplasmic reticulum Hsp90, elicits a variety of immune responses sufficient for tumor rejection and the suppression of metastatic tumor progression. Macrophages are a prominent GRP94/gp96 target, with GRP94/gp96 reported to activate macrophage NF-{kappa}B signaling and nitric oxide production, as well as the MAP kinase p38, JNK, and ERK signaling cascades. However, recent studies report that heat shock protein elicited macrophage activation is due, in large part, to contaminating endotoxin. To examine the generality of this finding, we have investigated the role of endotoxin in GRP94/gp96-elicited macrophage activation. We report that GRP94/gp96 binds endotoxin in a high-affinity, saturable, and specific manner. Low endotoxin calreticulin and GRP94/gp96 were purified, the latter using a novel method of depyrogenation; this resulted in GRP94/gp96 and calreticulin preparations with endotoxin levels substantially lower than those of previously reported preparations. Low endotoxin GRP94/gp96 retained its native conformation, ligand binding activity, and in vitro chaperone function, yet did not activate macrophage NF-{kappa}B signaling, nitric oxide production or inducible nitric-oxide synthase production. Low endotoxin GRP94/gp96 and calreticulin did, however, elicit a marked increase in ERK phosphorylation at protein concentrations as low as 2 µg/ml. These results are discussed with respect to current understanding of the contributions of endotoxin and heat shock/chaperone proteins to the stimulation of innate immune responses.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
A number of molecular chaperones, including GRP94/gp96, calreticulin (CRT),1 and Hsp70, are capable of eliciting antitumor immune responses against their tumor of origin (1–4). The efficacy of GRP94/gp96 in animal model studies of tumor rejection has spurred investigation into tumor-derived chaperones, principally GRP94/gp96, as immunotherapeutics for human cancers (5–7). The tumor-rejection properties of these proteins have been proposed to reflect a peptide-binding function (8–11). In this view, GRP94/gp96-peptide complexes are escorted to the MHC class I antigen presentation pathways of antigen-presenting cells (APC) to yield re-presentation of the GRP94/gp96-bound peptides on APC MHC class I molecules and activation of tumor directed CD8(+) T lymphocytes (8–11). However, recent data demonstrate that chaperone-elicited tumor rejection stems, at least in part, from the direct interactions of these proteins with antigen-presenting cells, to yield dendritic cell (DC) maturation (12–16) and migration (17), and the release of cytokines known to exert anti-tumor effects, including TNF-{alpha}, IL-12, IL-1{beta}, and GM-CSF (10, 12, 13, 18, 19). Additionally, several chaperones, including GRP94/gp96, have been implicated in stimulating nitric oxide (NO) production by macrophages and DC (18, 20). Importantly, these peptide-independent activities are, under some circumstances, apparently sufficient to account for GRP94/gp96-elicited tumor rejection. For example, prophylactic vaccination of mice with irradiated fibroblasts, engineered to secrete GRP94/gp96 or the GRP94/gp96 N-terminal domain, yielded a marked suppression of 4T1 mammary carcinoma growth and metastasis following tumor cell challenge (15). It thus appears that GRP94/gp96-elicited, peptide-independent APC stimulation can play a prominent, if not primary, role in the phenomenon of chaperone-elicited tumor rejection.

Several recent studies have investigated the peptide-independent mechanism(s) by which chaperones stimulate APC, implicating Toll-like receptors (TLR) and CD14 as well as a variety of downstream signaling cascades. TLR generally recognize pathogen-associated molecular patterns (PAMPs) such as lipopolysaccharide (LPS), CpG oligonucleotides, and bacterial surface proteins such as flagellin (21). Hsp60, for example, elicits TNF-{alpha} and NO release from murine macrophages in a TLR4-dependent manner, suggesting that TLR4 serves as a signaling receptor for Hsp60 (22). TLR2 and 4 have also been identified as Hsp70 signaling receptors, as determined through ectopic receptor expression studies (23, 24), and as GRP94/gp96 signaling receptors, based on similar experiments, as well as studies performed on cells derived from TLR4–/– mice (25). CD14 is a GPI-anchored co-receptor for LPS that may interact with signaling receptors (26); work with Hsp70 indicates a CD14 requirement for cytokine release (19). Evidence thus suggests that chaperone proteins are recognized by receptors of the innate immune system, principally those involved in the recognition of LPS and other PAMPs, to yield peptide-independent activation of APC function.

At least four signaling pathways have been described in the literature for GRP94/gp96-elicited APC activation. First, GRP94/gp96 signaling by activation of NF-{kappa}B has been identified by electrophoretic mobility shift assay (12) and by the loss of I{kappa}B{alpha} by immunoblot (25). Additionally, MAP kinase phosphorylation has also been observed in response to GRP94/gp96; immunoblotting for phospho-p38, JNK, and ERK demonstrated increases in the phosphorylated (active) form of each, in response to GRP94/gp96 addition (25).

It has been observed that the patterns of APC stimulation by GRP94, Hsp70, and Hsp60 bears many similarities to stimulation by LPS, in their kinetics, signaling pathways, and resulting cellular changes (12, 22, 24), though significant differences between LPS and GPR94/gp96, with respect to specific cellular effects and kinetics of activation, have been reported (12). LPS, which is found on the surface of Gram-negative bacteria, is a problematic contaminant: it is very chemically stable and a potent activator of APC activation (26), and is generally present in protein preparations unless specifically excluded. In fact, LPS levels as low as 15 pg/ml can stimulate some markers of activation in APC, including p38 phosphorylation and IL-6 release (27).

Several recent reports have revived longstanding concerns about LPS contamination in purified chaperone preparations. The ability of recombinant human Hsp70 to induce TNF-{alpha} release from macrophages has recently been attributed to LPS contamination (28). Similarly, Bausinger et al. (27) report that recombinant human Hsp70 does not cause DC maturation or cytokine release when endotoxin levels are extremely low (less than 10 EU/mg protein). On a related note, an established GRP94/gp96 purification protocol was recently found to result in substoichiometric contamination of GRP94 by concanavalin A (29), raising the possibility that other, heretofore undetected, contaminants may be present in biochemically enriched chaperone preparations.

Peptide-independent stimulation of APC appears to be a central event in chaperone-mediated immune tumor rejection. Moreover, despite reports that LPS contamination accounts for some of the APC stimulation attributed to chaperones, it is evident that GRP94/gp96, at least, elicits tumor suppression in the absence of LPS. In systems in which GPR94 is secreted from cultured cells in vivo, suppression of tumor growth and metastasis is significant, peptide independent, and characterized by activation of innate immune mechanisms including DC maturation and NK cell activation (15, 30). It becomes paramount, then, to understand the mechanism whereby GRP94/gp96 elicits APC activation. For these reasons, we investigated whether LPS was responsible for any of the immunostimulatory activities reported for GRP94/gp96. We also tested CRT, a luminal chaperone with tumor-rejection activity similar to that of GRP94/gp96 (3, 4), whose ability to stimulate an innate immune response has not been characterized. Here, we report that GRP94/gp96 specifically binds LPS, and that low endotoxin preparations of GRP94/gp96 and CRT do not stimulate NF-{kappa}B activation or NO release in macrophages; both responses are, however, robustly stimulated by LPS. Low endotoxin GRP94/gp96 and CRT do induce ERK phosphorylation in macrophages, implicating the MAP kinase cascade in the phenomenon of peptide-independent GRP94/gp96- and CRT-elicted APC activation.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Materials—LPS levels were determined using the QCL-1000 Limulus amoebocyte lysate kit (Cambrex, Walkersville, MD). Escherichia coli LCD25–09 LPS was labeled and purified by the method of Munford et al. (32) and was generously provided by Dr. Robert Munford (University of Texas Southwestern Medical Center, Dallas, TX). Unlabeled LPS is from E. coli strain 026:B6 and was purchased from Sigma. N-[3H]ethylcarboxamidoadenosine (NECA) was obtained from Amersham Biosciences (Piscataway, NJ). Chlorophenol red-{beta}-D-galactopyranoside (CPRG) was obtained from Roche Applied Science (Basel, Switzerland). Phosphorothioate CpG oligonucleotide (5' TCCATCACGTTCCTGACGTT 3') was the generous gift of Dr. David Pisetsky (Durham VA Medical Center, Durham, NC). PD98059 was purchased from Calbiochem (La Jolla, CA). Anti-phospho-p38, JNK, and ERK antibodies were from Cell Signaling Technology (Beverly, MA). DU-120 is a rabbit polyclonal antibody directed against a domain in the GRP94 N terminus and was prepared by contract service with Cocalico Biologicals (Reamstown, PA). A rabbit antiserum against BiP was prepared by contract service with Cocalico Biologicals, using a synthetic peptide representing the 15 N-terminal amino acids of the human protein. All other reagents were purchased from Sigma.

Purification of GRP94/gp96 and Calreticulin—Low endotoxin GRP94/gp96 was purified from porcine pancreas rough microsomes by a modification of the method of Wearsch and Nicchitta (33). In this modification, chromatography buffers were supplemented with detergents, as described below, to yield the efficient removal of LPS. All materials were decontaminated prior to use, either by soaking in 70% EtOH, 0.5 M acetic acid (34), or by baking for 4 h at 200 °C. All buffers were made in pyrogen-free water. Following microsome permeabilization, luminal proteins were loaded on a Mono Q column (Amersham Biosciences) equilibrated in TTTE buffer (25 mM Tris-Cl, pH 7.8, 150 mM NaCl, 0.2% (v/v) Tween 20, 0.2% (v/v) Triton X-100, and 10 mM EDTA). The column was washed sequentially with 400 ml of TTTE, 400 ml of 25 mM Tris-Cl, pH 7.8, 150 mM NaCl, and 1% (v/v) Triton X-114, and 250 ml of 25 mM Tris-Cl, pH 7.8, 50 mM NaCl. A 50–750 mM NaCl gradient was run to elute the column, and gel filtration was performed as usual, except that the column was equilibrated and run in sterile PBS. CRT was purified from porcine pancreas rough microsomes by the method of Wearsch and Nicchitta (33), and subsequently decontaminated of LPS using polymyxin B-agarose beads, by the method of Wright et al. (35). Briefly, purified CRT was incubated overnight with polymyxin B-agarose beads in a buffer containing 25 mM K-HEPES (pH 7.4), 20 mM NaCl, 110 mM KOAc, 2 mM Mg(OAc)2, 0.1 mM CaCl2, 2 mM EDTA, and 50 mM N-octyl {beta}-D-glucopyranoside, at 4 °C with mixing. The supernatant was dialyzed at 4 °C against several changes of PBS, to exchange buffer and remove traces of N-octyl {beta}-D-glucopyranoside.

[3H]LPS and [3H]NECA Binding Assays—[3H]LPS binding was determined by incubating 2 µg of GRP94/gp96 with various concentrations of [3H]LPS for 1 h on ice in a final volume of 250 µl of 50 mM Tris, pH 7.5. Bound versus free [3H]LPS was assayed by vacuum filtration of the binding reactions on Protran nitrocellulose membranes (Schleicher and Schuell, Keene, NH). Vacuum filtration was performed with a vacuum filtration manifold (Amersham Biosciences). Filters were rapidly washed with 3 x 4 ml of ice-cold 50 mM Tris, pH 7.5, placed in 5 ml of scintillation fluid (SafetySolve, RPI, Mt. Prospect, IL), vortexed, and counted by liquid scintillation spectrometry. All binding reactions were performed in triplicate and corrected by subtraction of background values, determined in binding reactions lacking GRP94. [3H]NECA binding assays were performed as in Rosser and Nicchitta (36).

GRP94/gp96 Fluorescent Labeling and Cell Binding—Low endotoxin GRP94/gp96 was labeled with fluorescein isothiocyanate (FITC) (Molecular Probes, Eugene, OR) to a ratio of ~1 mol of FITC:mol GRP94/gp96 dimer. Labeling was performed according to the manufacturer's instructions. FITC-GRP94 binding to cells was performed as described in Wassenberg et al. (37) and evaluated by flow cytometry.

Citrate Synthase Aggregation Assay—The effects of low endotoxin GRP94/gp96 on the thermal aggregation of citrate synthase were assayed essentially as described in Buchner et al. (38). Binding buffer (40 mM HEPES, pH 7.5) was preheated to 43 °C. Samples containing no protein, or GRP94 (0.6 µM final), were then added to 400 µl of preheated binding buffer in a quartz microcuvette. The cuvette was placed in a spectrofluorometer (Spex Industries, Inc., Edison, NJ) thermostatted at 43 °C. Citrate synthase was then added to 0.15 µM final concentration, with stirring. Thermal aggregation of citrate synthase was recorded as light scattering, with excitation and emission wavelengths of 500 nm and a 1-nm slit width. The time course of citrate synthase aggregation was followed for 1200 s. Readings were taken every 15 s with a 5-s integration.

NF-{kappa}B Activation Assay—Activation of the NF-{kappa}B signaling pathway was determined using the PathDetect NF-{kappa}B cis-reporting system (Stratagene, La Jolla, CA). RAW264.7 cells were plated to 80% confluence in 24-well plates and transfected with 0.5 µg each of pLuc-NF{kappa}B and pCMV-{beta}Gal (as a transfection efficiency control) for 5 h in the presence of LipofectAMINE (Invitrogen Life Technologies, Carlsbad, CA), as per manufacturer's protocols, then cultured in DMEM with 10% fetal bovine serum for an additional 21 h. Transfected cells were stimulated with GRP94/gp96, CRT, ConA and/or LPS for 4 h and lysed in Reporter Lysis Buffer (Promega, Madison, WI) with a freeze-thaw cycle. Luciferase levels were measured using the Promega luciferase assay system. {beta}-Galactosidase levels were determined by CPRG assay, as in Reed et al. (39). Luciferase levels were normalized to {beta}-galactosidase levels for analysis. All reactions were performed in triplicate and corrected by subtraction of the luciferase level of transfected, untreated cells.

Nitrite Release Assay—Production of nitrite, a measure of nitric oxide release, was determined with the method of Misko et al. (40), using 2,3-diaminonaphthalene (Molecular Probes). Fluorometer (Spex Industries, Inc.) slit widths were set to 1 nm for both excitation and emission. Samples were excited at a wavelength of 365 nm and the emission at 450 nm was recorded. All reactions were performed in duplicate and corrected by subtraction of background fluorescence.

Determination of MAP Kinase Activation—Peritoneal mouse macrophages were isolated from BALB/c mice by peritoneal lavage with DMEM, 10% FCS, 5–7 days after intraperitoneal injection of 1 ml 4.2% (w/v) brewer's thioglycollate broth. Macrophages were plated in 24-well plates (Corning Glass Works, Corning, NY) and selected by adherence for 1 h at 37 °C. The cells were then incubated for 7 h at 37 °C in serum-free DMEM. Cells were supplemented with the indicated concentrations of low endotoxin GRP94/gp96, low endotoxin calreticulin or CpG oligonucleotide in serum-free DMEM for the times indicated. At the end of the incubation, cells were washed in PBS, and lysed on ice in phosphoprotein lysis buffer (150 mM NaCl, 50 mM sodium phosphate (pH 7.4), 0.05% (w/v) SDS, 1% (w/v) Nonidet P-40, 2 mM EDTA, 50 mM NaF, 100 µM NaVO4, 1 mM phenylmethylsulfonyl fluoride, and 0.1 mg/ml soybean trypsin inhibitor). Cells were removed from the wells with a cell scraper, centrifuged at 15,000 rpm at 4 °C for 10 min, and the supernatants trichloroacetic acid-precipitated. After washing in acetone, protein pellets were resuspended in sample buffer, resolved by SDS-PAGE on a 10% acrylamide gels, transferred to nitrocellulose membranes and probed with anti-phosphoprotein antibodies according to the manufacturer's instructions. As an internal loading control, endogenous GRP94/gp96 levels were determined by Western blot using DU120. Quantification was performed with NIH Image 1.63 (National Institutes of Health, Bethesda, MD).


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
GRP94/gp96 Is an LPS-binding Protein—Current evidence indicates that peptide-independent activation of APC by chaperone proteins plays a fundamental role in the phenomenon of chaperone-elicited antitumor immunity. However, LPS is a common contaminant in purified chaperone preparations, and in the case of Hsp70, recent studies have indicated that contaminating LPS is responsible for all aspects of APC activation tested (27, 28). We therefore sought to determine, in the case of GRP94/gp96 and CRT, which aspects of APC activation were chaperone versus LPS-mediated.

To distinguish the effects of LPS from those of GRP94/gp96 and CRT on macrophage stimulation, we set out to purify very low endotoxin GRP94/gp96 and CRT. CRT can be decontaminated by incubation with polymyxin B-agarose beads (41). However, we observed that GRP94/gp96 binds polymyxin B beads, making this purification method unsuitable (Fig. 1A). Interestingly, during the gel filtration step of our GRP94 purification (33), LPS present in the Mono Q pool eluted in the same fractions as GRP94/gp96 (Fig. 1B). Subsequent attempts to separate GRP94/gp96 from LPS by repeating this gel filtration step demonstrated that LPS continued to coelute with purified GRP94/gp96 (data not shown).



View larger version (22K):
[in this window]
[in a new window]
  		FIG. 1.
GRP94/gp96 is an LPS-binding protein. A,2 µg of purified CRT or GRP94/gp96 were incubated with polymyxin B beads for 6 h at 4 °C. The beads were removed by centrifugation, washed, and any bound protein eluted in sample buffer. For each chaperone, the starting protein, supernatant, and polymyxin B-bound fractions were analyzed by SDS-PAGE and Coomassie Blue staining. B, rough microsomes were permeabilized and the luminal extract fractionated over Mono Q anion exchange by the method of Wearsch and Nicchitta (33). Fractions containing GRP94/gp96 and CRT were pooled and fractionated over a Superdex 26/60 200 gel filtration column, and the fractions tested for LPS by the LAL assay (dashed line). GRP94 and CRT peaks (solid line) were identified by SDS-PAGE analysis. C, in triplicate, 2 µg of low endotoxin GRP94/gp96 was incubated with 10 nM [3H]LPS for1hon ice, and the bound [3H]LPS separated from free ligand by vacuum filtration. The average counts per minute minus background (no protein added) are depicted; error bars represent S.D. +HS, GRP94/gp96 was first heat-shocked at 50 °C for 15 min; +pep, 500 nM SIINFEKL was added to the incubation; +RD, 1 µM radicicol was added; +cold LPS, 2 µg/ml LPS was added; ova, 2 µg of ovalbumin was used in place of GRP94/gp96. D, in triplicate, 2 µg of low endotoxin GRP94/gp96 was incubated with the indicated amounts of [3H]LPS for 1 h on ice, and the bound [3H]LPS was separated from free ligand by vacuum filtration. The average counts per minute from three assays minus background (matched samples of [3H]LPS with no GRP94/gp96 added) are depicted; error bars represent S.D.

 

These findings, which suggested a GRP94/gp96-LPS association, raised the question of whether GRP94/gp96 specifically binds LPS. LPS-GRP94/gp96 interactions were examined in a radioligand binding assay. In this assay, [3H]LPS and GRP94/gp96 were mixed in solution and the free versus GRP94/gp96-bound [3H]LPS resolved by vacuum filtration. [3H]LPS binding to a control protein, ovalbumin, was negligible; by contrast, we observed significant [3H]LPS binding to GRP94/gp96 (Fig. 1C). The binding was competed by an 50-fold excess of cold LPS, but was unaffected by heat treatment of GRP94/gp96, which is known to elicit a tertiary conformational change associated with peptide binding (42); radicicol, which binds to the N-terminal regulatory domain of GRP94 and Hsp90 and serves as a pan-Hsp90 inhibitor; or a 50-fold molar excess of SIINFEKL peptide, which was previously demonstrated to bind to GRP94/gp96 (43) (Fig. 1C). In addition, LPS binding was saturable (Fig. 1D); with a K1/2 of ~17 nM, and an occupancy rate of ~0.15 mol LPS:mol GRP94/gp96 dimer. From these data, we conclude that GRP94/gp96 can act as an LPS-binding protein. The relatively low stoichiometry of binding suggests either that LPS binds a unique confomer, present at low abundance in the population, or that the LPS binding site is occluded by other, as yet unidentified ligands.

Chromatographic Purification of Functional, Low Endotoxin GRP94/gp96 —Because LPS could not be removed from GRP94/gp96 by conventional techniques such as polymyxin B incubation, low endotoxin GRP94/gp96 was purified by a detergent extraction protocol, as described under "Experimental Procedures." Elution from the Mono Q and gel filtration chromatography were performed as described previously (33). In conjunction with chemical decontamination of all reagents and chromatography equipment, this method yielded GRP94/gp96 with a very low LPS content: by LAL assay, endotoxin levels were <0.27 EU/mg protein, or <0.027 pg/µg GRP94/gp96. Calreticulin, which was decontaminated by 1–2 rounds of polymyxin B treatment, contained <0.01 EU/µg protein. Low endotoxin GRP94/gp96 retained its native properties following purification; specifically, the protein ran as a single, 96-kDa band on SDS-PAGE (Fig. 2A) and bound N-[3H]ethylcarboxamidoadenosine ([3H]NECA), an adenosine-bearing nucleoside that functions as a high affinity ligand for the GRP94/gp96 N-terminal regulatory domain. NECA binding by GRP94/gp96 is a functional assay highly sensitive to conformational change (36) (Fig. 2B). In addition, FITC-conjugated low endotoxin GRP94/gp96 was recognized by cell surface receptors of elicited murine peritoneal macrophages, but not HepG2 or CHO cells (44) (Fig. 2C). Finally, the ability of low endotoxin GRP94/gp96 to chaperone other proteins was examined in a thermal aggregation assay (45). As with GRP94/gp96 purified by conventional means, low endotoxin GRP94/gp96 efficiently prevented the thermal aggregation of citrate synthase, demonstrating that it retains its chaperone activity (Fig. 2D).



View larger version (14K):
[in this window]
[in a new window]
  		FIG. 2.
Low endotoxin GRP94/gp96 is in its native conformation. A, low endotoxin GRP94/gp96 was purified as described under "Experimental Procedures"; 2 µg of purified GRP94/gp96 was analyzed by SDS-PAGE and Coomassie Blue staining. B, in triplicate, 6 µgoflow endotoxin GRP94/gp96 or ovalbumin was incubated with 20 nM [3H]NECAfor1hon ice, and the bound [3H]NECA separated from free ligand by vacuum filtration. The average counts per minute minus background (no protein added) are depicted; error bars represent S.D. C, low endotoxin GRP94/gp96 was labeled with fluorescein and incubated with the cell types indicated at 50 µg/ml for 1 h on ice. The cells were washed six times in cold PBS, fixed in 4% paraformaldehyde, and analyzed by flow cytometry. D, citrate synthase was diluted to 0.15 µM in buffer containing no GRP94/gp96 or 0.6 µM low endotoxin GRP94/gp96, and citrate synthase aggregation at 43 °C was monitored by light scattering at 500 nm in a thermostatted spectrofluorometer. The figure depicts an average of three independent experiments. Bovine serum albumin did not affect aggregation (data not shown).

 

Low Endotoxin GRP94/gp96 and CRT Do Not Activate NF-{kappa}B Signaling—The high affinity of GRP94/gp96 for LPS suggested that endotoxin contamination of this protein might occur frequently during purification, and that otherwise highly purified GRP94/gp96 may contain biologically significant levels of LPS. This is of concern because the reported effects of GRP94/gp96 on antigen-presenting cells are similar to those of LPS on these cells. GRP94/gp96 has been reported to activate NF-{kappa}B (12) via the TLR 2/4 signaling pathway (25) and iNOS induction and nitric oxide release (20), a cascade also typical of LPS signaling (46). Although its cell signaling properties have not been examined, calreticulin possesses immunostimulatory properties similar to GRP94/gp96 (4). We therefore examined the ability of low endotoxin GRP94/gp96 and low endotoxin CRT to activate NF-{kappa}B in RAW264.7 macrophages, using a luciferase reporter assay. The reporter construct contains tandem repeats of NF-{kappa}B binding elements upstream of the luciferase coding region. When NF-{kappa}B is released from I{kappa}B-mediated inhibition, it binds these elements, yielding transcription of luciferase, which can then be detected by luciferin assay. GRP94/gp96 and CRT did not activate NF-{kappa}B above baseline levels at concentrations of 30 and 20 µg/ml, respectively (Fig. 3A). By contrast, LPS induced a robust luciferase signal, detectable at concentrations as low as 100 pg/ml (Fig. 3, A–C). 25 µg/ml GRP94/gp96 and 40 µg/ml CRT did not potentiate the ability of LPS to elicit NF-{kappa}B activation (Fig. 3, B and C).



View larger version (12K):
[in this window]
[in a new window]
  		FIG. 3.
Low endotoxin GRP94/gp96 and CRT do not activate NF-{kappa}B signaling. A, in triplicate, RAW264.7 cells were cotransfected with pLuc-NF{kappa}B and pCMV-{beta}Gal for 24 h, then stimulated with LPS, GRP94/gp96 or CRT, as indicated, for 4 h. Luciferase and {beta}-galactosidase activities were assayed and the {beta}-galactosidase-corrected luciferase level calculated. The average luciferase activity is depicted; error bars represent S.D. B, transfected RAW264.7 cells were stimulated with LPS alone or LPS with 25 µg/ml low endotoxin GRP94/gp96 and assayed as above. C, transfected RAW 264.7 cells were stimulated with LPS alone or LPS with 40 µg/ml low endotoxin CRT and assayed as above. D, transfected RAW264.7 cells were stimulated with 100 ng/ml LPS, ConA, or ConA with 25 µg/ml low endotoxin GRP94/gp96 and assayed as above.

 

A recent report states that GRP94/gp96 purified by methods involving ConA affinity chromatography contains substoichiometric quantities of ConA (29). To investigate whether ConA, alone or in conjunction with GRP94/gp96, activates NF-{kappa}B signaling, the effect of tissue culture-grade ConA on NF-{kappa}B signaling in RAW-264.7 cells was assayed using the luciferase reporter method. We found that ConA did not activate NF-{kappa}B signaling, nor did it potentiate the ability of GRP94/gp96 to activate NF-{kappa}B (Fig. 3D).

Low Endotoxin GRP94/gp96 and CRT Do Not Activate Nitric Oxide Production—Another activity attributed both to LPS (46) and to GRP94/gp96 (20) is the ability to induce the release of nitric oxide by macrophages, by upregulating synthesis of the inducible nitric-oxide synthase, iNOS. We therefore examined whether low endotoxin GRP94/gp96 and CRT induce nitric oxide in macrophages. RAW-264.7 cells were incubated for 17 h with stimulating compounds, and subsequently assayed for production of nitrates and nitrites. In the presence of GRP94/gp96 concentrations as high as 100 µg/ml, and CRT concentrations as high as 30 µg/ml, RAW264.7 macrophages did not produce NO at levels above baseline. By contrast, LPS at 100 ng/ml increased nitrate and nitrite production by 8–11-fold (Fig. 4A). ConA, at concentrations up to 10 µg/ml, did not elicit NO production (data not shown).



View larger version (15K):
[in this window]
[in a new window]
  		FIG. 4.
Low endotoxin GRP94/gp96 and CRT do not activate NO signaling. A, in duplicate, RAW-264.7 cells were incubated with no added material, 100 ng/ml LPS, 100 µg/ml low endotoxin GPR94, or 30 µg/ml low endotoxin CRT for 17 h. NO production was assayed using the fluorometric assay of Misko et al. (1993). Average fold induction of NO release is depicted; error bars represent S.D. B, RAW-264.7 cells were incubated with no added material, 100 ng/ml LPS, 100 µg/ml low endotoxin GPR94, or 30 µg/ml low endotoxin CRT for 17 h. Cells were washed in PBS and lysed, and the lysates were separated by SDS-PAGE, transferred to nitrocellulose and probed with an anti-iNOS antibody. GRP94/gp96 and BiP immunoblots are depicted as lane loading controls.

 

To further examine the effects of low endotoxin GRP94/gp96 and CRT on the nitric oxide signaling cascade, we examined whether iNOS is synthesized in the presence of these proteins. RAW-264.7 cells were incubated overnight with 100 µg/ml GRP94/gp96 or 30 µg/ml CRT and their lysates probed with anti-iNOS antibody. We observed that low endotoxin GRP94/gp96 and CRT-treated cells did not produce iNOS; however, overnight incubation with 100 ng/ml LPS yielded robust iNOS production (Fig. 4B). From these data we conclude that low endotoxin GRP94/gp96 and CRT are not inducers of nitric oxide signaling in a murine macrophage cell line.

Low Endotoxin GRP94/gp96 and CRT Activate ERK Phosphorylation in Macrophages—A recent report demonstrates that GRP94/gp96 stimulates p38, JNK, and ERK phosphorylation (25). Because, in the case of Hsp70, p38 phosphorylation occurs only in preparations containing moderate or greater levels of LPS (27), we investigated whether our low endotoxin GRP94/gp96 or CRT-stimulated phosphorylation of these MAP kinases. Thioglycollate-elicited mouse peritoneal macrophages were selected by adherence, starved of serum for 7 h and treated with low endotoxin GRP94/gp96 or CRT; we used 1 M sorbitol as a positive control for p38 stimulation (47), and CpG oligonucleotide as a positive control for ERK stimulation (25). By immunoblotting with anti-phosphoprotein antibodies, we determined that GRP94/gp96 and CRT do not cause p38 phosphorylation at concentrations up to 25 µg/ml, over a time course of 5–60 min. The level of p38 phosphorylation in GRP94/gp96 and CRT-stimulated cells was unaffected by the addition of 20 µM SB203580 (a p38 MAP kinase inhibitor), but phospho-p38 did increase in response to osmotic shock with sorbitol, indicating that the macrophages were capable of upregulating this pathway (data not shown). We also observed no change in the level of JNK phosphorylation in response to 25 µg/ml low endotoxin GRP94/gp96 or CRT at any time from 5–60 min (data not shown).

Immunoblotting with anti-phospho-ERK antibody showed a GRP94/gp96-dependent increase in ERK phosphorylation, peaking at 1.7-fold above background (Fig. 5, A and B). The kinetics of ERK stimulation varied reproducibly by which chaperone was used to stimulate: GRP94/gp96-mediated ERK phosphorylation peaked at 30 min, while CRT-mediated ERK phosphorylation peaked at 10 min and subsequently declined (Fig. 5B). ERK stimulation occurred at low concentrations of GRP94/gp96 and CRT; 2 µg/ml of each was sufficient to stimulate maximal phosphorylation. Both CpG oligonucleotide- and GRP94/gp96-mediated ERK phosphorylation were abrogated by 20 µM PD98059, an inhibitor of MEK, the ERK kinase (Fig. 5C).



View larger version (28K):
[in this window]
[in a new window]
  		FIG. 5.
Low endotoxin GRP94/gp96 and CRT activate ERK phosphorylation. A, serum-starved thioglycollate-induced mouse peritoneal macrophages were supplemented with 2 µg/ml CpG oligonucleotide or 25 µg/ml low endotoxin GRP94/gp96 or CRT for the indicated times. Cells were washed in PBS and lysed, and the lysates were separated by SDS-PAGE, transferred to nitrocellulose and probed with an anti-phospho-ERK antibody. B, band density was quantified using NIH Image 1.63 and normalized to GRP94/gp96 density, as determined by immunoblotting with anti-GRP94/gp96 antibody. Open rectangles represent GRP94/gp96 responses; closed circles represent CRT responses. C, serum-starved thioglycollate-induced mouse peritoneal macrophages were preincubated with Me2SO 0.1% or 20 µM PD98057, where indicated, for 30 min, then supplemented with 5 µg/ml CpG oligonucleotide or the indicated quantity of low endotoxin GRP94/gp96 or CRT. CpG oligonucleotide and GRP94/gp96 incubations were carried out for 30 min; CRT incubations for 10 min. Cells were washed in PBS and lysed, and the lysates were separated by SDS-PAGE, transferred to nitrocellulose and probed with an anti-phospho-ERK antibody. As a lane loading control, the blot was probed with anti-GRP94/gp96 antibody.

 


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
Chaperone proteins have been reported to act upon a number of pathways of innate immune recognition and stimulation, including DC maturation, cytokine release by DC and macrophages, and NO production by macrophages (12–14, 20). However, the pattern of activation attributed to these proteins bears a strong resemblance to that caused by LPS, a common contaminant in both recombinant and native protein preparations. Validating this concern, we show here that GRP94/gp96 binds with high affinity to LPS, although very low endotoxin preparations of both GRP94/gp96 and CRT can be prepared using either a series of detergent washes or incubation with polymyxin B beads, respectively. Low endotoxin GRP94/gp96 and calreticulin fail to activate NF-{kappa}B signaling in macrophages by luciferase reporter assay; by contrast, LPS at concentrations as low as 100 pg/ml yields activation above background. Similarly, we observe no NO production or iNOS synthesis in the presence of low endotoxin GRP94/gp96 and calreticulin, even at high protein concentrations. Here again, LPS yields robust iNOS induction and NO release. Both GRP94/gp96 and CRT do induce rapid phosphorylation of ERK, at concentrations as low as 2 µg/ml, indicating that this signaling pathway, but not NF-{kappa}B activation, is mediated by the chaperones and not by contaminating endotoxin.

We found that GRP94/gp96 specifically binds LPS with high affinity. There is evidence that Hsp90, a close relative of GRP94, binds LPS: incubation of purified Hsp90 with [3H]LPS yields radioactive complexes following native gel electrophoresis, and the association can be competed with cold LPS (48). Furthermore, Hsp70 and Hsp90 were isolated by affinity chromatography of cellular lysates on an immobilized LPS column, and these associations were confirmed by FRET (49). In the studies reported herein, we demonstrate that GRP94/gp96 displays saturable, specific, and competable binding of LPS. It is interesting to note that binding is not affected by the Hsp90 family-specific drug radicicol, by synthetic peptides, or by heat shock.

Our findings concerning signaling pathways of GRP94/gp96 and CRT versus LPS contrast, in part, with those of several previous investigations into GRP94/gp96-mediated APC activation, which found that GRP94/gp96 activates NF-{kappa}B, NO release and p38 and JNK phosphorylation (12, 25). A possible source of difference is the degree of endotoxin contamination present in our protein preparations and those used by other investigators. The GRP94 used in the experiments described in the current paper contained < 0.27 EU/mg endotoxin; other studies of GRP94/gp96 signaling have used GRP94/gp96 containing <50 EU/mg (25) or "<0.02 EU in absolute quantity" (12). In the latter citation, EU levels per weight of protein were not provided.

Two recent studies, using Hsp70, have investigated the role of LPS contamination in APC activation. In a comparison of Hsp70 purified by standard methods, and containing 577 EU/mg endotoxin, versus that purified to reduce endotoxin levels (low endotoxin Hsp70, 4.1 EU/mg), the low endotoxin protein did not elicit TNF-{alpha} from macrophages at 5 µg/ml; however, Hsp70 at 577 EU/mg and 100 pg/ml LPS were both sufficient to do so (28). Another group distinguished between "endotoxin-contaminated" (400–4500 EU/mg), "low endotoxin" (56 EU/mg) and "very low endotoxin" (<10 EU/mg) Hsp70, and observed that different events appear to require different levels of endotoxin contamination. DC maturation took place only in the presence of endotoxin-contaminated Hsp70 at 3 µg/ml, while both endotoxin-contaminated and low endotoxin Hsp70 at 3 µg/ml induced cytokine release and rapid p38 phosphorylation in DC. However, although it remained functional by several criteria, very low endotoxin Hsp70 did not induce cytokine release or p38 phosphorylation in DC, events stimulated by LPS at concentrations as low as 15 pg/ml (27). In a commercially available "low endotoxin" GRP94/gp96 preparation containing <50 EU/mg of endotoxin (Immatics Biotechnologies, Tubigen, Germany), a GRP94/gp96 concentration of 3 µg/ml, assuming 50 EU LPS/mg, provides this level of LPS. These reports reveal an exquisite sensitivity to LPS by APC, as well as differing thresholds of activation, depending on the cell type (macrophage or DC) and the phenomenon being measured (DC activation, cytokine release, p38 phosphorylation).

Moreover, several lines of evidence argue that controls routinely performed to ensure that LPS is not the agent causing stimulation (polymyxin B treatment, heat inactivation) cannot reliably be interpreted as ruling out a role for LPS. Polymyxin B, which binds LPS, is often added to assays to sequester the LPS (12, 18, 23). However, one recent study reports that polymyxin B does not fully abrogate LPS-mediated cytokine secretion (27), while another group has observed no effect by polymyxin on the ability of an LPS-contaminated Hsp70 fraction to stimulate DC (50). Additionally, we report here that polymyxin B binds GRP94/gp96 with a high affinity, making it unsuitable for inclusion as a control in experiments using GRP94/gp96. Similarly, chaperone proteins are frequently treated by heat inactivation, in theory inactivating the protein while leaving the LPS active (24). A recent report that LPS is itself heat sensitive, especially at low concentrations (20 ng/ml), but also at higher ones (20 µg/ml), challenges the validity of this assumption (28). These findings indicate that such controls may not be valid under all circumstances and make clear the need for conservative interpretations of such experiments.

Experimental systems using cell-secreted GRP94/gp96 or GRP94/gp96 domains circumvent the problem of trace LPS contamination by avoiding purification altogether. A secreted GRP94-IgG fusion, when expressed by tumor cells, elicits a vigorous CD8+ T cell response and subsequent tumor rejection (51). There is evidence the fusion protein affects the innate immune system as well as the acquired; when expressed in vivo, the secreted protein causes NK cell activation (30). In a second system, two truncated forms of GRP94/gp96, one lacking the KDEL ER retrieval sequence and the other consisting only of the geldanamycin-binding N-terminal domain, were secreted from irradiated, transfected cells. In addition to mediating tumor rejection in mice, regardless of the source of the GRP94/gp96, media conditioned by GRP94/gp96-secreting cells also elicited DC maturation, as measured by MHC class II and CD86 up-regulation (15). Because these studies were performed in tissue culture systems and thus the potential for LPS contamination was greatly reduced, they demonstrate that chaperones (at least, chaperones secreted from transfected cells) can indeed elicit innate immune responses in vitro and in vivo.

Using GRP94/gp96 and CRT containing very low endotoxin levels, we demonstrate that low concentrations (2 µg/ml) of both proteins elicit rapid ERK phosphorylation, indicating activation of the MAP kinase cascade. It is possible that p38 and JNK are also activated by GRP94/gp96 and CRT, since small changes in the phosphorylation state of kinases may be amplified downstream; however, we could not detect such activity. In this regard, it is noteworthy that LPS elicits activation of the combined ERK, JNK, and p38 pathways. We calculate that the effective LPS concentration in a 2 µg/ml solution of our GRP94 is 0.0524 pg/ml, nearly 300-fold below the lowest reported threshold for any known LPS elicited, APC stimulatory process. On the basis of these data, we conclude that GRP94/gp96 and CRT can indeed serve as an activation signal for APC.

ERK phosphorylation, an event downstream of Ras, Raf proteins, and MAP kinase kinase, is commonly observed in response to growth factors, cytokines, and viral infection, among other stimuli (52). That ERK activation occurs in response to chaperone binding is therefore plausible: even in the chaperone-secreting systems described above, chaperones possess activity reminiscent of some inflammatory cytokines and growth factors. Moreover, ERK activation appears to be sufficient to cause elaboration of cytokines, a probable downstream effect of macrophage stimulation, under at least some circumstances. For example, nerve growth factor, for which macrophages posses a receptor, induces TNF-{alpha} production in macrophages by signaling through ERK and JNK, but not p38, cascades; pharmacological ERK inhibition abrogates TNF-{alpha} production (53). Studies in human and murine DC suggest that ERK activation plays a different role in DC, that of a maturation inhibitor (54, 55). The DC maturation observed in experimental systems of secreted GRP94/gp96 (15, 30) may therefore require additional signaling mechanism(s) which, as yet, remain to be identified. We conclude that macrophage NF-{kappa}B activation and NO production are mediated by LPS signaling whereas ERK activation is mediated by GRP94/gp96 and CRT, independent of contaminating endotoxin.


   FOOTNOTES
 
* These studies were supported by Grant DK53058 (to C. V. N.) from the National Institutes of Health. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

{ddagger} To whom correspondence should be addressed. Tel.: 919-684-8948; Fax: 919-684-5481; E-mail: c.nicchitta{at}cellbio.duke.edu.

1 The abbreviations used are: CRT, calreticulin; ER, endoplasmic reticulum; APC, antigen-presenting cell; ConA, concanavalin A; ERK, extracellular signal-regulated kinase; MAP, mitogen-activated protein; PBS, phosphate-buffered saline; FITC, fluorescein isothiocyanate; DMEM, Dulbecco's modified Eagle's medium; LPS, lipopolysaccharide; IL, interleukin; DC, dendritic cell; TNF, tumor necrosis factor; JNK, Jun N-terminal kinase; NECA, N-ethylcarboxamidoadenosine. Back


   ACKNOWLEDGMENTS
 
We thank Dr. Robert Munford (UT-Southwestern) for providing [3H]LPS, and Dr. David Pisetsky (Durham VA Medical Center) for providing CpG oligonucleotides. We are grateful to Deanna Carrick and Dr. Cary Lai (Scripps Institute) for generous assistance with the low endotoxin GRP94/gp96 purification.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. DuBois, G. C., Law, L. W., and Appella, E. (1982) Proc. Natl. Acad. Sci. U. S. A. 79, 7669–7673[Abstract/Free Full Text]
  2. Srivastava, P. K., DeLeo, A. B., and Old, L. J. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 3407–3411[Abstract/Free Full Text]
  3. Nair, S., Wearsch, P. A., Mitchell, D. A., Wassenberg, J. J., Gilboa, E., and Nicchitta, C. V. (1999) J. Immunol. 162, 6426–6432[Abstract/Free Full Text]
  4. Basu, S., and Srivastava, P. K. (1999) J. Exp. Med. 189, 797–802[Abstract/Free Full Text]
  5. Janetzki, S., Palla, D., Rosenhauer, V., Lochs, H., Lewis, J. J., and Srivastava, P. K. (2000) Int. J. Cancer 88, 232–238[CrossRef][Medline] [Order article via Infotrieve]
  6. Caudill, M. M., and Li, Z. (2001) Expert Opin. Biol. Ther. 1, 539–547[CrossRef][Medline] [Order article via Infotrieve]
  7. Belli, F., Testori, A., Rivoltini, L., Maio, M., Andreola, G., Sertoli, M. R., Gallino, G., Piris, A., Cattelan, A., Lazzari, I., Carrabba, M., Scita, G., Santantonio, C., Pilla, L., Tragni, G., Lombardo, C., Arienti, F., Marchiano, A., Queirolo, P., Bertolini, F., Cova, A., Lamaj, E., Ascani, L., Camerini, R., Corsi, M., Cascinelli, N., Lewis, J. J., Srivastava, P., and Parmiani, G. (2002) J. Clin. Oncol. 20, 4169–4180[Abstract/Free Full Text]
  8. Srivastava, P. K., and Maki, R. G. (1991) Curr. Top. Microbiol. Immunol. 167, 109–123[Medline] [Order article via Infotrieve]
  9. Srivastava, P. K., Udono, H., Blachere, N. E., and Li, Z. (1994) Immunogenetics 39, 93–98[Medline] [Order article via Infotrieve]
  10. Suto, R., and Srivastava, P. K. (1995) Science 269, 1585–1588[Abstract/Free Full Text]
  11. Srivastava, P. K. (2002) Annu. Rev. Immunol. 20, 395–425[CrossRef][Medline] [Order article via Infotrieve]
  12. Basu, S., Binder, R. J., Suto, R., Anderson, K. M., and Srivastava, P. K. (2000) Int. Immunol. 12, 1539–1546[Abstract/Free Full Text]
  13. Singh-Jasuja, H., Scherer, H. U., Hilf, N., Arnold-Schild, D., Rammensee, H. G., Toes, R. E., and Schild, H. (2000) Eur. J. Immunol. 30, 2211–2215[Medline] [Order article via Infotrieve]
  14. Kuppner, M. C., Gastpar, R., Gelwer, S., Nossner, E., Ochmann, O., Scharner, A., and Issels, R. D. (2001) Eur. J. Immunol. 31, 1602–1609[CrossRef][Medline] [Order article via Infotrieve]
  15. Baker-LePain, J. C., Sarzotti, M., Fields, T. A., Li, C. Y., and Nicchitta, C. V. (2002) J. Exp. Med. 196, 1447–1459[Abstract/Free Full Text]
  16. Nicchitta, C. V. (2003) Nat. Rev. Immunol. 3, 427–432[CrossRef][Medline] [Order article via Infotrieve]
  17. Binder, R. J., Anderson, K. M., Basu, S., and Srivastava, P. K. (2000) J. Immunol. 165, 6029–6035[Abstract/Free Full Text]
  18. Chen, W., Syldath, U., Bellmann, K., Burkart, V., and Kolb, H. (1999) J. Immunol. 162, 3212–3219[Abstract/Free Full Text]
  19. Asea, A., Kraeft, S.-K., Kurt-Jones, E. A., Stevenson, M. A., Chen, L. B., Finberg, R. W., Koo, G. C., and Calderwood, S. K. (2000) Nat. Med. 6, 435–442[CrossRef][Medline] [Order article via Infotrieve]
  20. Panjwani, N. N., Popova, L., and Srivastava, P. K.(2002) J. Immunol. 168, 2997–3003[Abstract/Free Full Text]
  21. Janeway, C. A., and Medzhitov, R. (2002) Annu. Rev. Immunol. 20, 197–216[CrossRef][Medline] [Order article via Infotrieve]
  22. Ohashi, K., Burkart, V., Flohe, S., and Kolb, H. (2000) J. Immunol. 164, 558–561[Abstract/Free Full Text]
  23. Asea, A., Rehli, M., Kabingu, E., Boch, J. A., Bare, O., Auron, P. E., Stevenson, M. A., and Calderwood, S. K. (2002) J. Biol. Chem. 277, 15028–15934[Abstract/Free Full Text]
  24. Vabulas, R. M., Ahmad-Nejad, P., Ghose, S., Kirschning, C. J., Issels, R. D., and Wagner, H. (2002) J. Biol. Chem. 277, 15107–151112[Abstract/Free Full Text]
  25. Vabulas, R. M., Braedel, S., Hilf, N., Singh-Jasuja, H., Herter, S., Ahmad-Nejad, P., Kirschning, C. J., da Costa, C., Rammensee, H.-G., Wagner, H., and Schild, H. (2002) J. Biol. Chem. 277, 20847–20853[Abstract/Free Full Text]
  26. Dobrovolskaia, M. A., and Vogel, S. N. (2002) Microbes Infect. 4, 903–914[CrossRef][Medline] [Order article via Infotrieve]
  27. Bausinger, H., Lipsker, D., Ziylan, U., Manie, S., Briand, J.-P., Cazenave, J.-P., Muller, S., Haeuw, J.-F., Ravanat, C., de la Salle, H., and Hanau, D. (2002) Eur. J. Immunol. 32, 3708–3713[CrossRef][Medline] [Order article via Infotrieve]
  28. Gao, B., and Tsuan, M.-F. (2003) J. Biol. Chem. 278, 174–179[Abstract/Free Full Text]
  29. Monks, S. A., Hassan-Zahraee, M., Rottman, J. B., Weng, J., Wang, Y., Sawlivich, W., Simha, S., Principato, J., Carpenter, J., Desroches, B., Burke, J., Truneh, A., Srivastava, P., and Zabrecky, J. R. (2003) American Association for Cancer Research Annual Meeting, Vol. 44, p. 2854, Cadmus Professional Communications, Toronto, Ontario, Canada
  30. Strbo, N., Oizumi, S., Sotosek-Tokmadzic, V., and Podack, E. R. (2003) Immunity 18, 381–390[CrossRef][Medline] [Order article via Infotrieve]
  31. Anton, L. C., Snyder, H. L., Bennink, J. R., Vinitsky, A., Orlowski, M., Porgador, A., and Yewdell, J. W. (1998) J. Immunol. 160, 4859–4868[Abstract/Free Full Text]
  32. Munford, R. S., DeVaux, L. C., Cronan, J. E. J., and Rick, P. D. (1992) J. Immunol. Methods 148, 115–120[CrossRef][Medline] [Order article via Infotrieve]
  33. Wearsch, P. A., and Nicchitta, C. V. (1996) Protein Expr. Purif. 7, 114–121[CrossRef][Medline] [Order article via Infotrieve]
  34. Girot, P., Moroux, Y., Duteil, X. P., Nguyen, C., and Boschetti, E. (1990) J. Chromatogr. 510, 213–223[CrossRef][Medline] [Order article via Infotrieve]
  35. Wright, J. R., Zlogar, D. F., Taylor, J. C., Zlogar, T. M., and Restrepo, C. I. (1999) Am. J. Physiol. 276, L650–L658
  36. Rosser, M. F., and Nicchitta, C. V.(2000) J. Biol. Chem. 275, 22798–22805[Abstract/Free Full Text]
  37. Wassenberg, J. J., Dezfulian, C., and Nicchitta, C. V. (1999) J. Cell Sci. 112, 2167–2175[Abstract]
  38. Buchner, J., Grallert, H., and Jakob, U. (1998) Methods Enzymol. 290, 323–338[CrossRef][Medline] [Order article via Infotrieve]
  39. Reed, R. C., Zheng, T., and Nicchitta, C. V. (2002) J. Biol. Chem. 277, 25082–25089[Abstract/Free Full Text]
  40. Misko, T. P., Schilling, R. J., Salvemini, D., Moore, W. M., and Currie, M. G. (1993) Anal. Biochem. 214, 11–16[CrossRef][Medline] [Order article via Infotrieve]
  41. Karplus, T. E., Ulevitch, R. J., and Wilson, C. B. (1987) J. Immunol. Methods 105, 211–220[CrossRef][Medline] [Order article via Infotrieve]
  42. Wearsch, P. A., Voglino, L., and Nicchitta, C. V. (1998) Biochemistry 37, 5709–5719[CrossRef][Medline] [Order article via Infotrieve]
  43. Breloer, M., Marti, T., Fleischer, B., and von Bonin, A. (1998) Eur. J. Immunol. 28, 1016–1021[CrossRef][Medline] [Order article via Infotrieve]
  44. Singh-Jasuja, H., Toes, R. E., Spee, P., Munz, C., Hilf, N., Schoenberger, S. P., Ricciardi-Castagnoli, P., Neefjes, J., Rammensee, H. G., Arnold-Schild, D., and Schild, H. (2000) J. Exp. Med. 191, 1965–1974[Abstract/Free Full Text]
  45. Wassenberg, J. J., Reed, R. C., and Nicchitta, C. V.(2000) J. Biol. Chem. 275, 22806–22814[Abstract/Free Full Text]
  46. Xie, Q. W., Kashiwabara, Y., and Nathan, C. (1994) J. Biol. Chem. 269, 4705–4708[Abstract/Free Full Text]
  47. McLaughlin, M. M., Kumar, S., McDonnell, P. C., Van Horn, S., Lee, J. C., Livi, G. P., and Young, P. R. (1996) J. Biol. Chem. 271, 8488–8492[Abstract/Free Full Text]
  48. Byrd, C. A., Bornmann, W., Erdjument-Bromage, H., Tempst, P., Pavletich, N., Rosen, N., Nathan, C. F., and Ding, A. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 5645–5650[Abstract/Free Full Text]
  49. Triantafilou, K., Triantafilou, M., and R. L., D. (2001) Nat. Immunol. 2, 338–345[CrossRef][Medline] [Order article via Infotrieve]
  50. Wallin, R. P. A., Lundqvist, A., More, S. H., von Bonin, A., Kiessling, R., and Ljunggren, H.-G. (2002) Trends Immunol. 23, 130–135[CrossRef][Medline] [Order article via Infotrieve]
  51. Yamazaki, K., Nguyen, T., and Podack, E. R. (1999) J. Immunol. 163, 5178–5182[Abstract/Free Full Text]
  52. Johnson, G. L., and Lapadat, R. (2002) Science 298, 1911–1912[Abstract/Free Full Text]
  53. Barouch, R., Kazimirsky, G., Appel, E., and Brodie, C. (2001) J. Leukocyte Biol. 69, 1019–1026[Abstract/Free Full Text]
  54. Puig-Kroger, A., Relloso, M., Fernandez-Capetillo, O., Zubiaga, A., Silva, A., Bernabeu, C., and Corbi, A. L. (2001) Blood 98, 2175–2182[Abstract/Free Full Text]
  55. Yanagawa, Y., Iijima, N., Iwabuchi, K., and Onoe, K. (2002) J. Leukoc. Biol. 71, 125–132[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Leukoc. Biol.Home page
M.-F. Tsan and B. Gao
Heat shock proteins and immune system
J. Leukoc. Biol., June 1, 2009; 85(6): 905 - 910.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
Q.-Q. Huang, R. Sobkoviak, A. R. Jockheck-Clark, B. Shi, A. M. Mandelin II, P. P. Tak, G. K. Haines III, C. V. Nicchitta, and R. M. Pope
Heat Shock Protein 96 Is Elevated in Rheumatoid Arthritis and Activates Macrophages Primarily via TLR2 Signaling
J. Immunol., April 15, 2009; 182(8): 4965 - 4973.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
C. Figueiredo, M. Wittmann, D. Wang, R. Dressel, A. Seltsam, R. Blasczyk, and B. Eiz-Vesper
Heat shock protein 70 (HSP70) induces cytotoxicity of T-helper cells
Blood, March 26, 2009; 113(13): 3008 - 3016.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
R. T. Figueiredo, P. L. Fernandez, D. S. Mourao-Sa, B. N. Porto, F. F. Dutra, L. S. Alves, M. F. Oliveira, P. L. Oliveira, A. V. Graca-Souza, and M. T. Bozza
Characterization of Heme as Activator of Toll-like Receptor 4
J. Biol. Chem., July 13, 2007; 282(28): 20221 - 20229.
[Abstract] [Full Text] [PDF]

Home page
 Innate ImmunityHome page
M.-F. Tsan and Baochong Gao
Review: Pathogen-associated molecular pattern contamination as putative endogenous ligands of Toll-like receptors
Innate Immunity, February 1, 2007; 13(1): 6 - 14.
[Abstract] [PDF]

Home page
 J. Leukoc. Biol.Home page
E. Schmitt, M. Gehrmann, M. Brunet, G. Multhoff, and C. Garrido
Intracellular and extracellular functions of heat shock proteins: repercussions in cancer therapy
J. Leukoc. Biol., January 1, 2007; 81(1): 15 - 27.
[Abstract] [Full Text] [PDF]

Home page
 J. Leukoc. Biol.Home page
A. Rouhiainen, S. Tumova, L. Valmu, N. Kalkkinen, and H. Rauvala
Analysis of proinflammatory activity of highly purified eukaryotic recombinant HMGB1 (amphoterin)
J. Leukoc. Biol., January 1, 2007; 81(1): 49 - 58.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
B. Liu, Y. Yang, J. Dai, R. Medzhitov, M. A. Freudenberg, P. L. Zhang, and Z. Li
TLR4 Up-Regulation at Protein or Gene Level Is Pathogenic for Lupus-Like Autoimmune Disease
J. Immunol., November 15, 2006; 177(10): 6880 - 6888.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
T. Warger, N. Hilf, G. Rechtsteiner, P. Haselmayer, D. M. Carrick, H. Jonuleit, P. von Landenberg, H.-G. Rammensee, C. V. Nicchitta, M. P. Radsak, et al.
Interaction of TLR2 and TLR4 Ligands with the N-terminal Domain of Gp96 Amplifies Innate and Adaptive Immune Responses
J. Biol. Chem., August 11, 2006; 281(32): 22545 - 22553.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
X.-Y. Wang, H. Arnouk, X. Chen, L. Kazim, E. A. Repasky, and J. R. Subjeck
Extracellular Targeting of Endoplasmic Reticulum Chaperone Glucose-Regulated Protein 170 Enhances Tumor Immunity to a Poorly Immunogenic Melanoma
J. Immunol., August 1, 2006; 177(3): 1543 - 1551.
[Abstract] [Full Text] [PDF]

Home page
 Infect. Immun.Home page
B. Henderson, E. Allan, and A. R. M. Coates
Stress Wars: the Direct Role of Host and Bacterial Molecular Chaperones in Bacterial Infection
Infect. Immun., July 1, 2006; 74(7): 3693 - 3706.
[Full Text] [PDF]

Home page
 Int ImmunolHome page
C. Biswas, U. Sriram, B. Ciric, O. Ostrovsky, S. Gallucci, and Y. Argon
The N-terminal fragment of GRP94 is sufficient for peptide presentation via professional antigen-presenting cells
Int. Immunol., July 1, 2006; 18(7): 1147 - 1157.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
C. Massa, C. Melani, and M. P. Colombo
Chaperon and Adjuvant Activity of hsp70: Different Natural Killer Requirement for Cross-Priming of Chaperoned and Bystander Antigens
Cancer Res., September 1, 2005; 65(17): 7942 - 7949.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
F. J. Quintana and I. R. Cohen
Heat Shock Proteins as Endogenous Adjuvants in Sterile and Septic Inflammation
J. Immunol., September 1, 2005; 175(5): 2777 - 2782.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
C. Habich, K. Kempe, R. van der Zee, R. Rumenapf, H. Akiyama, H. Kolb, and V. Burkart
Heat Shock Protein 60: Specific Binding of Lipopolysaccharide
J. Immunol., February 1, 2005; 174(3): 1298 - 1305.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
H. Li, M. Zhou, J. Han, X. Zhu, T. Dong, G. F. Gao, and P. Tien
Generation of Murine CTL by a Hepatitis B Virus-Specific Peptide and Evaluation of the Adjuvant Effect of Heat Shock Protein Glycoprotein 96 and Its Terminal Fragments
J. Immunol., January 1, 2005; 174(1): 195 - 204.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
B. Berwin, Y. Delneste, R. V. Lovingood, S. R. Post, and S. V. Pizzo
SREC-I, a Type F Scavenger Receptor, Is an Endocytic Receptor for Calreticulin
J. Biol. Chem., December 3, 2004; 279(49): 51250 - 51257.
[Abstract] [Full Text] [PDF]

Home page
 J. Leukoc. Biol.Home page
M.-F. Tsan and B. Gao
Endogenous ligands of Toll-like receptors
J. Leukoc. Biol., September 1, 2004; 76(3): 514 - 519.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Cell Physiol.Home page
M.-F. Tsan and B. Gao
Cytokine function of heat shock proteins
Am J Physiol Cell Physiol, April 1, 2004; 286(4): C739 - C744.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
J. C. Baker-LePain, M. Sarzotti, and C. V. Nicchitta
Glucose-Regulated Protein 94/Glycoprotein 96 Elicits Bystander Activation of CD4+ T Cell Th1 Cytokine Production In Vivo
J. Immunol., April 1, 2004; 172(7): 4195 - 4203.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
A. K. Samanta, H. J. Huang, R. C. Bast Jr., and W. S.-L. Liao
Overexpression of MEKK3 Confers Resistance to Apoptosis through Activation of NF{kappa}B
J. Biol. Chem., February 27, 2004; 279(9): 7576 - 7583.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
B. Liu, J. Dai, H. Zheng, D. Stoilova, S. Sun, and Z. Li
Cell surface expression of an endoplasmic reticulum resident heat shock protein gp96 triggers MyD88-dependent systemic autoimmune diseases
PNAS, December 23, 2003; 100(26): 15824 - 15829.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/34/31853    most recent
M305480200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Reed, R. C.
Right arrow Articles by Nicchitta, C. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Reed, R. C.
Right arrow Articles by Nicchitta, C. V.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement