|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 278, Issue 34, 32457-32464, August 22, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Activation of CTP:Phosphocholine Cytidylyltransferase 
Expression during the S Phase of the Cell Cycle Is Mediated by the Transcription Factor Sp1*
¶ ||From the Department of Biochemistry and ||Canadian Institutes of Health Research Group on Molecular and Cell Biology of Lipids, University of Alberta, Edmonton, Alberta, T6G 2S2, Canada
Received for publication, May 7, 2003 , and in revised form, May 28, 2003.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONCONCLUSIONREFERENCES |
|---|
An essential step during cell division is induction of phosphatidylcholine biosynthesis. In this pathway, CTP:phosphocholine cytidylyltransferase
(CT) plays an important regulatory role. Previous studies (Golfman, L.
S., Bakovic, M., and Vance, D. E. (2001) J. Biol. Chem. 276,
43688–43692) demonstrated that CT mRNA accumulates during S phase
in preparation for cellular mitosis. We now demonstrate that increased binding
of the transcription factor Sp1 to the proximal promoter of CT is
responsible for increased transcription during the S phase. The Sp1 binding
element present in position –67/–62 is essential for activation,
and the Sp1 site in position –31/–9 is required to enhance
transcription. Inhibition of Sp1 expression by RNA interference abolished the
enhanced expression of CT. Immunoprecipitation studies demonstrated
that Sp1 interacts with cyclin E, cyclin A, and cyclin-dependent kinase 2
during the S phase. We conclude that Sp1 binding to the CT proximal
promoter is necessary to enhance transcription during the S phase. This is the
first elucidation of a mechanism by which expression of a key enzyme in
phospholipid biosynthesis is regulated during the cell cycle. |
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONCONCLUSIONREFERENCES |
|---|
Phosphatidylcholine (PC)1 biosynthesis is an important component of the cell cycle due to a doubling of PC mass prior to mitosis. PC biosynthesis occurs in all nucleated mammalian cells via the Kennedy (CDP-choline) pathway in which CTP: phosphocholine cytidylyltransferase (CT) catalyzes the regulated and rate-limiting step (1–4). Two genes encode CT activities, CT
and CT
(5–10).
CT is ubiquitously expressed in nucleated cells
(11), and its expression is
tightly regulated. At the level of gene expression, CT mRNA has been
shown to increase after growth factor stimulation
(12), during liver development
(13), in proliferating liver
tissue following partial hepatectomy
(14), and during the S phase
of the cell cycle (15).
Because the CT gene was only recently identified
(8,
9), little is known about
control of its expression.
The CT gene has been cloned and characterized
(7). The gene is transcribed
from two transcriptional start sites and lacks a TATA box, but contains a
GC-rich region that is characteristic of many TATA-less promoters
(16). The 200-bp proximal
promoter contains sites for binding of Sp1, Sp3, transcriptional enhancer
factor-4, Ets, and sterol response element-binding protein
(16–23).
There are additional candidate binding sites for other transcription factors
that include Ap1, Ap2, signal transducer and activator of transcription, and
NF
B (16). In the
proximal promoter of the CT gene three Sp1 binding elements have been
identified that are involved in basal, activator, and suppressor activities
(16). Sp1, Sp2, and Sp3 can
competitively bind to these elements, and the relative abundance of these
factors can regulate the expression of the CT gene
(17). Sp3 has recently been
identified as being of central importance for the enhanced expression of
CT in C3H10T1/2 fibroblasts that have been stably transfected with a
cDNA encoding Ras (20). Roles
for transcriptional enhancer factor-4 and Ets in regulating the expression of
CT have also been identified
(18,
19). A 2-fold stimulation of
CT expression by sterol response element-binding protein appears to
occur upon binding to the proximal promoter
(21). However, increased PC
synthesis that occurs after the induction by sterol response element-binding
protein appears to be largely a result of increased fatty acid biosynthesis
(22,
23).
Unlike sterol or fatty acid biosynthesis, large changes in the rate of PC
biosynthesis do not occur, probably because of the critical role of PC in cell
survival
(24–26).
Moreover, genes that have TATA-less promoters are often referred to as
"housekeeping" genes. However, to describe the CT gene as
"housekeeping" is inappropriate because the gene is critical for
cell survival. Because the changes in CT activity are not dramatic under
various perturbations, it is often assumed that the expression of the
CT gene is not differentially regulated. This is not the case, but
instead the tight control of the expression of CT gene presents a more
difficult challenge for elucidation of its regulation.
We have used two cell model systems to begin to unravel cellular mechanisms
that regulate the expression of the CT gene. In cells stably
transfected with Ras we have discovered that the enhanced expression of
CT is due to a higher affinity of Sp3 for the proximal promoter
(20). In another model, in
which expression of CT was investigated during the cell cycle, the
expression of the CT gene was enhanced during the S phase
(15). In the present study we
have extended the cell cycle studies and provide evidence that Sp1 is the
major transcription factor that stimulates the expression of CT during
the S phase of the cell cycle.
|
EXPERIMENTAL PROCEDURES |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONCONCLUSIONREFERENCES |
|---|
Materials—The luciferase vector, pGL3-basic, that contains the cDNA encoding Photinus pyralis luciferase, the control pRL-CMV vector that contains the cDNA encoding Renilla reniformis luciferase, pSV-
-galactosidase vector as a transfection control, and the
dualluciferase Reporter Assay System were obtained from Promega (Madison, WI).
LipofectAMINE Plus reagent, Dulbecco's modified Eagle's medium, and fetal
bovine serum were from Invitrogen. Anti-Sp1, anti-Sp3, anti-cyclin D,
anti-cyclin A, and anti-CDK2 were purchased from Santa Cruz Biotechnology.
ECL® immunoblotting reagents were purchased from Amersham Biosciences. Cell Culture—C3H10T1/2 mouse embryo fibroblasts were cultured in Dulbecco's modified Eagle's medium supplemented with penicillin G (100 units/ml), streptomycin (100 µg/ml), and 10% fetal bovine serum (FBS) in a 5% CO2 humidified incubator at 37 °C. The cell cycle was arrested in G0 by incubation of cells in culture medium containing 0.5% FBS for 24 h and released by addition of fresh medium containing 10% FBS.
[3H]Thymidine Incorporation into DNA—For the analysis of DNA synthetic rates, [3H]thymidine (0.5 µCi, 1 µM) was added to triplicate 35-mm dishes 1 h before cells were harvested. At each time point, the medium was aspirated and the cells were washed three times with ice-cold phosphate-buffered saline and treated with 10% ice-cold trichloroacetic acid for 10 min on ice to precipitate DNA. The dishes were washed twice with 10% trichloroacetic acid, and the precipitated material was scraped into 0.2% SDS in 0.1N NaOH. Radioactivity associated with the trichloroacetic acid precipitate was measured by liquid scintillation spectrometry.
Preparation of Deleted and Mutated CT
Promoter-Luciferase Reporters—CT promoter-luciferase
constructs, LUC.C7 (–1268/+38), LUC.C8 (–201/+38), LUC.D1
(–90/+38), and LUC.D2 (–130/+38), were inserted into the
promoter-less luciferase vector pGL3-basic (Promega) as described previously
(16). To prepare mutated
promoter constructs, GCCC (–139/-136) was mutated to AGCT and named LUC.
mSp1(C)/C7, CGGGCG (–67/–62) was changed to AATTCA and named
LUC.mSp1(B)/C7, and CCGGG was changed for GGTAC (–21/–17) and
named LUC.mSp1(A)/C7. Double mutants were constructed by the same procedure
but for template we used single mutants. Vectors enabling expression of
recombinant Sp1 and Sp3 proteins were obtained from Dr. R. Tjian (pPacSp1 and
pPac0) (27) and Dr. J. Noti
(pPacSp3) (28).
Nuclear Extract Preparation and Electrophoretic Mobility Shift Assays
(EMSAs)—Total nuclear extracts of C3H10T1/2 cells grown to
different stages of the cell cycle were prepared as described
(29). Promoter fragments
(–210/+38), (–130/+38), and (–90/+38) were released from
pLUC.C8, D2 or D1 by restriction digestion with KpnI and
HindIII. Promoter fragments were purified from 2% agarose gels using
the Qiaex II gel extraction kits (Qiagen Inc., Mississauga, ON, Canada)
according to the manufacturer's instructions and end-labeled using Klenow
polymerase fragments in the presence of [-32P]dCTP. An
oligonucleotide with the Sp1-consensus sequence
(5'-ATTCGATCGGGCGGGGCGAGC-3') was synthesized by the University of
Alberta Core Facility. Complementary oligonucleotides (100 µM of
each) were heated at 90 °C for 5 min, then slowly cooled to room
temperature, and 5 pmol of double-stranded oligonucleotide was 5'
end-labeled using T4 kinase (Invitrogen) and [
-32P]ATP
(PerkinElmer Life Sciences). For each binding reaction (40 µl), 1 µg of
poly(dI-dC)-poly(dI-dC), 20 µl of 2x binding buffer (100
mM Tris-HCl, pH 7.4, 10 mM MgCl2, 250
mM NaCl, 5mM EDTA, 50% glycerol, 0.5% Nonidet P-40, 5
mM dithiothreitol), 1 µg nuclear extract, and labeled probe
(20,000 cpm) were incubated for 30 min at room temperature.
For gel mobility super shift analyses, 5 µl of antibody specific for either Sp1 or Sp3 (Santa Cruz Biotechnology) was added for 15 min prior to incubation of the probe with nuclear protein. For gel shift inhibition assays, protein and antibody were incubated for 30 min before addition of the probe. Binding reactions were terminated by the addition of 4 µl of gel loading buffer (30% (v/v) glycerol, 0.1%(w/v) bromphenol blue, 0.1% (w/v) xylene cyanol). The complex was separated on a non-denaturing 6% (w/v) polyacrylamide gel and visualized by autoradiography of the dried gel.
Immunoblot Analyses—Nuclear proteins (10 µg) from C3H10T1/2 fibroblasts were heated for 3 min at 90 °C in 62.5 mM Tris-HCl, pH 8.3, 10% (v/v) glycerol, 5% (v/v) 2-mercaptoethanol, 1% SDS, and 0.004% bromphenol blue. The protein samples were electrophoresed on a 10% SDS-polyacrylamide gel in 25 mM Tris-HCl, pH 8.3, 192 mM glycine, and 0.1% SDS buffer. The proteins were transferred to nitrocellulose by electroblotting in transfer buffer (25 mM Tris-HCl, pH 8.3, 192 mM glycine, 20% (v/v) methanol). Following transfer, the membrane was incubated for 1 h at room temperature or overnight at 4 °C with 5% skim milk in 20 mM Tris-HCl, pH 7.4, 150 mM NaCl, 0.1% Tween 20) and incubated for 1 h with antibody raised against the protein as indicated. Immunoreactive proteins were detected using the enhanced chemiluminescence system (Amersham Biosciences) according to the manufacturer's instructions.
Construction of Plasmids that Contain DNA Templates for the Synthesis of siRNAs under the Control of the U6 Promoter—DNA oligonucleotide templates for the in vitro synthesis of siRNAs were chemically synthesized by University of Alberta Core Facility. The oligonuclotides were designed to contain a nucleotide sequence specific for the mRNA of Sp1 (ggctgctacccccaacttac). After annealing, the DNA was cloned into the ApaI and EcoRI sites of pSilencer (Ambion). The plasmid harboring the insert, named pCBEd1, was confirmed by sequencing and transfected into cells with LipofectAMINE using concentrations indicated in each case.
Inmunoprecipitation—Nuclear extracts were prepared as described above from cells collected after 20 h of cell cycle induction. Nuclear extract proteins (200 µg) were incubated with 5 µg of polyclonal anti-Sp1 (Santa Cruz Biotechnology) in 1 ml final volume containing immunoprecipitation buffer (1% Triton X-100 (v/v), 150 mM NaCl, 10 mM Tris-HCl, pH 7.4, 1 mM EDTA, 1 mM EGTA, 0.2 mM phenylmethylsulfonyl fluoride, and 0.5% Nonidet P-40 (v/v)). The reaction was incubated for 1 h at 4 °C then incubated for 30 min with 50 µl 10% protein A-Sepharose (Staphylococcus aureus, Cowan strain), and the complex was washed three times with immunoprecipitation buffer. The pellet was re-suspended in 30 µl of concentrated electrophoresis sample buffer, boiled, and the supernatant was electrophoresed on a polyacrylamide gel containing 0.1% SDS. Proteins were transferred to polyvinylidene difluoride membranes and probed with the indicated antibodies.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONCONCLUSIONREFERENCES |
|---|
Sp1 Interacts with the CT
Promoter during the S Phase
of the Cell Cycle—Previous studies
(15) showed that expression of
CT mRNA increased during cell cycle progression from G1 and
reached a maximum during S phase. To identify the minimal promoter fragment
that would stimulate CT transcription during S phase, we analyzed
luciferase activity in 3 different 5' deletion constructs, LUC.C7
(–1268/+38), LUC.D1 (–90/+38), and LUC.D3 (–52/+38).
Fig. 1 shows that partial
transcriptional activation during S phase was maximal with LUC.C7 and was
maintained with the LUC.D1 construct, but not with the LUC.D3 construct,
indicating that the 40 bp between –52 and –90 are essential for
activity during S phase. LUC.D3 showed basal activity as previously described
(16). To investigate the
transcription factor(s) involved in regulation of CT promoter activity
during S phase, we utilized electromobility shift assays to determine whether
protein(s) present in C3H10T1/2 fibroblasts bind to the CT proximal
promoter region (–90/+38) during S phase. One DNA-protein complex was
clearly observed at all points of the cell cycle
(Fig. 2A). However,
the abundance of the complex increased in nuclear extracts obtained 20 h after
cell cycle induction (Fig.
2A). We confirmed that 20 h following cell cycle
induction corresponds to S phase of the cell cycle by measuring the rate of
[3H]thymidine incorporation into DNA
(Fig. 2B) and by
immunoblot analysis of cyclin D1 (Fig.
2C). Cyclin D1 expression was used as an indicator of
cell cycle re-entry because cyclin D1 is not expressed in cells arrested in
G0, but its expression is induced after serum stimulation, starting
in middle G1 (30).
In cycling cells, cyclin D1 is expressed throughout the cell-cycle, although
its levels continue to peak at late G1.
|
|
We utilized super-shift EMSAs to identify which transcription factor(s) are
involved in the formation of the DNA-protein complex during the S phase of the
cell cycle. Previous studies
(16) demonstrated that Sp1 and
Sp3 bind the CT promoter region and regulate its basal expression.
Hence, for the EMSAs we used antibodies raised against Sp1 or Sp3.
Fig. 2A shows that the
addition of anti-Sp1 (2 µg) markedly reduced the DNA-protein complex
formation. The presence of anti-Sp3 antibody did not reduce formation of the
DNA-protein complex. These results strongly suggest that Sp1 binds to the
CT proximal promoter during the S phase in C3H10T1/2 fibroblasts.
To confirm these results we used EMSAs to investigate the capacity of the
same nuclear extract to bind a 20-bp DNA that contained the Sp1 binding
consensus sequence (31).
Consistent with the data shown in Fig.
2A, Fig. 3
shows the profile obtained with the Sp1 consensus element in which the
protein-DNA complex formation increased in nuclear extracts obtained during S
phase. As in the experiment depicted in
Fig. 2A, interaction
between DNA and protein decreased when we added anti-Sp1 antibody, but no
decrease in the intensity of the retarded band was observed with anti-Sp3
antibody. The reason for the slower migrating smudge in lanes 6 and
7 is not clear and was not observed in other analyses. These results
confirm that Sp1 is the major nuclear transcription factor that binds the
CT promoter during the S phase in C3H10T1/2 fibroblasts.
|
The Induction of CT Promoter Activity During S Phase Is
Abolished in a CT Promoter Construct Lacking the Sp1 Binding
Site B—In the CT promoter region there are three Sp1 binding
elements: A (–22/–15), B (–70/–58), and C
(–144/–135) (Fig.
1A) that are involved in the regulation of CT
expression (16). Sp1, Sp2, and
Sp3 can competitively bind to these regions, and the relative abundance of
these factors regulates promoter activity of the CT gene
(17). We have investigated the
role of these three binding sites in the regulation of CT expression
during different stages of the cell cycle. We analyzed luciferase activity
using the Pcyt1a reporter plasmid LUC.C7 (–1268/+38) and
different mutated constructs of one or more of the Sp1 binding sites. These
plasmids were introduced into C3H10T1/2 murine fibroblasts by transient
transfection. After synchronization and cell cycle induction, luciferase
activity was measured. As demonstrated in
Fig. 4A, the
luciferase activity of the site A mutant (LUC.mSp1(A)/C7) increased with time
with an activity profile similar to that of the wild-type reporter construct
(LUC.C7). However, the level of expression was markedly (40%) lower than for
the wild-type LUC.C7 after 18 h. The LUC.mSp1(C)/C7 mutant showed higher
luciferase activity at all time points analyzed. Most strikingly, the mutant
LUC.mSp1(B)/C7 showed low luciferase activity and no induction during S phase.
Studies with constructs in which two Sp1 binding sites were mutated showed low
activity when only site C was active (LUC.mSp1AB). In contrast, the luciferase
activity increased during S phase in the LUC.mSp1AC mutant where only site B
was active (Fig. 4B).
Together these results indicate that the Sp1 binding site B is the minimal
necessary element required for cell cycle induction of CT promoter
activity.
|
Because Ets has been previously implicated in the expression of the
CT gene (19), we
examined the expression of LUC.C7 in which the Ets element of the CT
promoter was mutated. The expression of the mutated construct was decreased by
70% compared with LUC.C7, but there was still an increase of expression during
the S phase of the cell cycle. Hence, Ets appears to be required for optimal
reporter activity but does not seem to be involved in the enhanced expression
of the CT promoter observed in the S phase.
Interference with Sp1 Expression Decreases CT Promoter
Activity during S Phase—RNA interference is the process of
sequence-specific, post-transcriptional gene silencing initiated by
double-stranded RNA (dsRNA) that is homologous in sequence to the silenced
gene. The mediators of sequence-specific messenger RNA degradation are 21 or
22 nucleotide small interfering RNAs (siRNA) generated by ribonuclease III
cleavage from longer dsRNAs
(32). We have used this
technique to suppress expression of endogenous Sp1 for studying its function
in CT regulation during the cell cycle. Murine embryo fibroblasts were
co-transfected with a pCBEd1 plasmid (0.1 µg and 1 µg), harboring the
Sp1 DNA sequence specific for the in vitro synthesis of siRNAs that
would attenuate reporter plasmid LUC.C7 (1 µg), and
pSV-–galactosidase (1 µg). Luciferase activity was analyzed at
various time points after cell cycle induction.
Fig. 5A shows that the
CT promoter activity clearly increased during cell cycle progression
reaching a maximum in S-phase (20 h) in cells transfected with LUC.C7 and the
empty plasmid pSilencer. However, in cells where Sp1 expression was attenuated
with RNAi directed against Sp1, up to 50% reduction in S phase of the
CT promoter activity was observed
(Fig. 5A). Because
transfection efficiency was only about 10%, we were not able to detect a
difference in the level of Sp1 expression or endogenous CT activity (data not
shown). To evaluate the ability of pCBEd1 to inhibit Sp1 expression, cells
were co-transfected with PacSp1 (0.05 µg) (an expression vector encoding
Sp1) and pCBEd1 (1 µg) or pSilencer (1 µg). Immunoblot analysis showed a
clear suppression of Sp1 expression in cells transfected with pCBEd1
(Fig. 5B). As
indicated, the expression of the transcription factor TFIID was unaffected by
pCBEd1 expression. These results demonstrate that inhibition of Sp1 expression
by siRNA attenuated the induction of CT promoter activity during S
phase of the cell cycle.
|
We also measured endogenous CT activity and [3H]choline
incorporation in cells that were transfected with either pPac0 or pPacSp1.
There was no difference in CT activity detected or in the incorporation of
[3H]choline into PC. As the transfection efficiency is 
10%,
this result is not unexpected.
The Presence of Sp1 Is Necessary, but Not Sufficient, to Enhance
CT Promoter Activity during the S Phase—Previous
studies (17) have established
that the CT promoter can be activated by both Sp1 and Sp3. We,
therefore, next examined the ability of Sp1 and Sp3 to individually enhance
CT promoter activity during S phase of the cell cycle. We
co-transfected Sp1 or Sp3 expression vectors (pPacSp1 or pPacSp3), or the
empty plasmid pPac0, with a Pcyt1a reporter plasmid
LUC.C7(–1268/+38) or, as a control with pRL-cytomegalovirus vector that
has the luciferase reporter under the control of the constitutive
cytomegalovirus promoter. After transfection, cells were arrested for 24 h,
after which cell cycle progression was induced by addition of 10% FBS.
Luciferase activity was measured in samples obtained at different time points.
As Fig. 6 shows, cells that
were transfected with Sp1 have 20 times higher luciferase activity than
cells harboring the empty vector at each time point analyzed. Nevertheless,
the luciferase activity was 2-fold higher at 19 h than at 0 or 15 h after cell
cycle induction. Thus, although there was a marked increase in luciferase
activity as a result of the over-expression of Sp1, luciferase expression was
still induced in S-phase, indicating that S-phase-specific modifications of
Sp1 are required to maximally activate the CT promoter or that Sp1
interacts with other cell cycle regulated proteins, or both.
|
The expression of Sp3 enhanced luciferase activity 6-fold
(Fig. 6), consistent with
previous studies that showed that Sp3 activates CT basal transcription
(17). However, data presented
in Figs. 2 and
3 demonstrate that Sp3 is not a
major protein present in DNA-protein complexes isolated during S phase. A
parallel experiment using the pRL-cytomegalovirus promoter-luciferase reporter
as a control showed no change in luciferase activity at any time point
analyzed (data not shown). Because the level of Sp1 and Sp3 expression
determined by immunoblotting did not reveal substantial differences during the
cell cycle (data not shown), we postulated that a modification of Sp1 had
enhanced CT expression.
Sp1 Interacts with a Complex Containing Cyclin A, Cyclin E, and CDK2
during S Phase—Activation of the CT promoter was maximum at
late G1/S phase of the cell cycle, when cyclin E/CDK2 and cyclin
A/CDK2 are activated. Because cyclin A/CDK2 and cyclin E/CDK2 form complexes
with transcription factors and other regulatory proteins (such as
retinoblastoma protein) and these complexes activate S-phase-specific
promoters, we examined possible physical interactions between cyclin A, cyclin
E, or CDK2 with Sp1. Cyclin E is expressed only from late G1 into
early S phase, cyclin A is expressed from early S through M, and CDK2 is
expressed throughout the cell-cycle. Both cyclins E and A activate CDK2.
C3H10T1/2 cells were growth arrested by serum withdrawal for 48 h. After
stimulation of cell division with 10% bovine serum albumin for 20 h, nuclear
extracts were immunoprecipitated with anti-Sp1 antibody. The precipitated
proteins were separated by electrophoresis and analyzed by immunostaining with
anti-cyclin A or anti-cyclin E antibodies. Cyclin A and cyclin E were clearly
co-immunoprecipitated with Sp1 from cells harvested 20 h after induction of
the cell cylce (Fig. 7). We
also performed immunoblotting with anti-CDK2 antibody and identified this
kinase as a component of the complex (Fig.
7).
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONCONCLUSIONREFERENCES |
|---|
Identification of Sp1 as the Transcription Factor that Enhances CT
Expression during the S Phase of the Cell Cycle—
During cell division each step is coordinately regulated to permit growth and
development. One essential process is PC biosynthesis, which provides the
principal phospholipid for the synthesis of new membrane and as a precursor
for signaling molecules. Thus, CT plays a critical role due to its
regulatory function in the Kennedy pathway
(1–4).
Previous studies (15) showed
that CT mRNA increases during the S phase in preparation for mitosis.
The focus of the current study was to elucidate the mechanism by which the
expression of CT mRNA increases during S phase in fibroblasts. The
results demonstrate that a complex signaling pathway involving Sp1 interaction
with cell cycle-specific cyclin A/cyclin E and CDK2 is essential for
activation through the Sp binding element in the CT proximal promoter,
thereby enhancing transcription during the S phase. Moreover, we demonstrated
that a Sp1 binding element (–67/–62) is essential for activation
of CT transcription during S phase.
Sp1 is present in nuclear extracts and binds the CT promoter during
all stages of the cell cycle, but maximally after 20 h of cell cycle induction
corresponding with S phase. Previous studies
(17) established that the
CT basal promoter is inactive when transcription is not supported by
the nuclear factors Sp1 and Sp3. We have now established that Sp1, but not
Sp3, is responsible for the protein-DNA complex formed during S phase. Sp3 can
act as a positive or negative regulator depending on the promoter and the
cellular context (33,
34). Our data show that Sp3
does not bind to the CT proximal promoter or the Sp-consensus element
in appreciable quantities during the S phase, suggesting that this
transcription factor is either not present in nuclear extracts of C3H10T1/2
fibroblasts in this phase, or is not specifically activated during the S
phase. In contrast, Sp3 appears to be the factor responsible for enhanced
CT expression in fibroblasts stably transfected with Ras
(20).
The CT proximal promoter contains three Sp1 binding elements. Using
specific mutants in each binding element we determined that the binding site B
is essential for enhancement of transcription during the S phase. However,
mutation of site A also diminished transcription, suggesting that both sites
are important for maximal transcription during S phase. Interestingly we found
that Sp1 binding C site has a negative effect on transcription indicated by
the increased level of activity exhibited by the Sp1-mC mutant construct
compared with the un-mutated promoter. The function of site C is unclear, but
one possibility is that site C might govern CT transcription during
other phases of the cell cycle, such as G0 where PC is not required
in such abundant quantities. This result is consistent with earlier findings
that the Sp1 C site attenuates CT expression
(16).
An important role for Sp1 in CT transcription was further indicated
when we used siRNA. With this technology we were able to study the functional
consequences of reducing the expression of Sp1 on CT expression. The
results demonstrated that inhibition of Sp1 by siRNAi blocked enhanced
CT-promoter expression in S phase of the cell cycle.
Cyclins E/A and CDK2 Interact with Sp1 for Activation of
CT-Luciferase Expression—The next question we
addressed was whether or not Sp1 in the nuclear extract was specifically
required during the S phase to stimulate CT transcription. If this were
the case, we hypothesized that cells that over-expressed Sp1 would show high
transcriptional activity independent of the stage of the cell cycle. When we
analyzed the luciferase activity in cells that over-expressed Sp1, we observed
a large increase in the expression of CT-luciferase relative to that in
control cells. Nevertheless, CT-luciferase activity clearly increased
(2-fold) during the time corresponding to the S phase. This result suggests
that the presence of Sp1 per se is not sufficient for the specific
induction of CT during S phase. Sp3 also stimulated
CT-luciferase expression but to a lesser extent than Sp1.
Certain post-translational modifications affect the level, capacity, and
binding ability of transcription factors, and therefore transcriptional
activity. Cell cycle-dependent phosphorylation of proteins is often catalyzed
by cyclin/kinase complexes with cyclin A/E being the regulatory, and CDK2 the
catalytic, subunit (35).
Growth-dependent phosphorylation of Sp1 has been shown to occur during
G1 (36). Several
cellular kinases such as casein kinase II
(37) and double stranded
DNA-dependent protein kinase
(37) have been reported to
phosphorylate Sp1 and regulate its activity. Moreover, several proteins
interact with Sp1 to alter its capacity as a transcriptional activator or
repressor (36). Future
experiments will be directed toward elucidating how Sp1 is modified to
increase transcriptional activation of CT during S phase of the cell
cycle.
By co-immunoprecipitation assays we demonstrated that Sp1 interacts with
cyclin E, cyclin A, and CDK2. This result is in agreement with previous
results that cyclin E, in combination with CDK2, is a positive G1
cell cycle regulator controlling progression through G1 and
initiation of DNA replication
(38–41).
Cyclin A binds both CDK2 and another kinase, CDK1, giving rise to two distinct
cyclin A kinase activities, one appearing in S phase, the other in
G2 (42). An
interaction between cyclin A and Sp1 has been described in the regulation of
thymidine kinase expression, where this interaction, and the phosphorylation
of Sp1 by an associated kinase, enhance the transcriptional activity of the
promoter (43). An interaction
between cyclin E and Sp1 has not been previously reported. Considering that
Sp1 regulates the expression of CT during the S phase and that cyclin
E/CDK2 are involved in the regulation of the transition to S phase it is not
surprising that this interaction occurs. At the beginning of the S phase both
cyclin E/CDK2 and cyclin A/CDK2 complexes co-exist
|
CONCLUSION |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONCONCLUSIONREFERENCES |
|---|
We provide the first characterization of a mechanism by which the expression of a phospholipid biosynthetic gene is regulated during the cell cycle. During each division, cells coordinately regulate gene expression to provide the required building blocks at the correct moment. Cyclin E/CDK2 complexes regulate the transition to S phase and cyclin A/CDK2 regulates events during S phase, and both of these complexes regulate the activity of Sp1 by phosphorylation. It is not surprising that genes that encode enzymes necessary for the synthesis of essential molecules like nucleic acids and phospholipids would be regulated by a common mechanism.
|
FOOTNOTES |
|---|
* This research was supported by a grant from the Canadian Institutes of Health Research. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Scholar of the Alberta Heritage Foundation for Medical Research and a
Canadian Institutes of Health Research New Investigator.
Canada Research Chair for the Molecular and Cell Biology of Lipids and
Medical Scientist of the Alberta Heritage Foundation for Medical Research.
¶ To whom correspondence should be addressed. Tel.: 780-492-8286; Fax: 780-492-3383; E-mail: dennis.vance{at}ualberta.ca.
1 The abbreviations used are: PC, phosphatidycholine; CDK2, cyclin-dependent
kinase 2; CT, CTP:phosphocholine cytidylyltransferase; EMSA, electromobility
shift assay; FBS, fetal bovine serum; LUC, luciferase; siRNA, small
interfering RNA.
|
ACKNOWLEDGMENTS |
|---|
We thank Drs. Jean Vance and Vern Dolinsky for helpful discussions and comments on the results and manuscript.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONCONCLUSIONREFERENCES |
|---|
- Vance, D. E. (1989) in Phosphatidylcholine Metabolism (Vance, D. E., ed) pp. 33–45, CRC Press, Boca Raton, FL
- Vance, D. E. (1990) Biochem. Cell Biol. 68, 1151–1165[Medline] [Order article via Infotrieve]
- Johnson, J. E., and Cornell, R. B. (1999) Mol. Membr. Biol. 16, 217–235[CrossRef][Medline] [Order article via Infotrieve]
- Lykidis, A., and Jackowski, S. (2001) Prog. Nuc. Acid Res. Mol. Biol. 65, 361–393
- Feldman, D. A., and Weinhold, P. A. (1987)
J. Biol. Chem. 262,
9075–9081
[Abstract/Free Full Text] - Kalmar, G. B., Kay, R. J., LaChance, A., Abersold, R., and Cornell,
R. B. (1990) Proc. Natl. Acad. Sci. U. S.
A. 87,
6029–6033
[Abstract/Free Full Text] - Tang, W., Keesler, G. A., and Tabas, I. (1997)
J. Biol. Chem. 272,
13146–13151
[Abstract/Free Full Text] - Lykidis, A., Baburina, I., and Jackowski, S. (1999)
J. Biol. Chem. 274,
26992–27001
[Abstract/Free Full Text] - Lykidis, A., Murti, K. G., and Jackowski, S. (1998)
J. Biol. Chem. 273,
14022–14029
[Abstract/Free Full Text] - Vance, D. E. (2002) in Biochemistry of Lipids, Lipoproteins, and Membranes (Vance, D. E., and Vance, J. E., eds), 4th Ed., pp. 205–232, Elsevier Science Publishers B. V., Amsterdam
- Wang, Y., MacDonald, J. I. S., and Kent, C. (1995)
J. Biol. Chem. 270,
354–360
[Abstract/Free Full Text] - Tessner, T. G., Rock, C. O. Kalmar, G., Cornell, R., and Jackowski,
S. (1991) J. Biol. Chem.
266,
16261–16264
[Abstract/Free Full Text] - Sesca, E. Perlitz, C., Bindoni, M., Chiarini, F., and Tessitore, L., (1996) Biochem. Biophys. Res. Commun. 229, 158–162[CrossRef][Medline] [Order article via Infotrieve]
- Houwelling, M. Z., Cui, L. Tessitore, D. E., and Vance, D. E. (1997) Biochim. Biophys. Acta 1546, 7–9
- Golfman, L. S., Bakovic, M., and Vance, D. E. (2001)
J. Biol. Chem. 276,
43688–43692
[Abstract/Free Full Text] - Bakovic, M., Waite, K., Tang, W., Tabas, I., and Vance, D. E. (1999) Biochim. Biophys. Acta, 1438, 147–165[Medline] [Order article via Infotrieve]
- Bakovic, M., Waite, K. A., and Vance, D. E. (2000)
J. Lipid Res. 41,
583–594
[Abstract/Free Full Text] - Sugimoto, H., Bakovic, M., Yamashita, S., and Vance, D.
(2001) J. Biol. Chem.
276,
12338–12344
[Abstract/Free Full Text] - Sugimoto, H., Sugimoto, S., Tatei, K., Obinata, H., Bakovic, M.,
Izumi, T., and Vance, D. E. (2003) J. Biol.
Chem. 278,
19716–19722
[Abstract/Free Full Text] - Bakovic, M., Waite, K. A., and Vance, D. E. (2003)
J. Biol. Chem. 278,
14753–14761
[Abstract/Free Full Text] - Kast, H. R., Nguyen, C. M., Anisfeld, A. M., Ericsson, J., and
Edwards, P. A. (2001) J. Lipid Res.
42,
1266–1272
[Abstract/Free Full Text] - Lagace, T. A., Storey, M. K., and Ridgway, N. D.
(2000) J. Biol. Chem.
275,
14367–14374
[Abstract/Free Full Text] - Ridgway, N. D., and Lagace, T. A. (2003) Biochem. J. 372, 811–819[CrossRef][Medline] [Order article via Infotrieve]
- Tercé, F., Brun, H., and Vance, D. E. (1994) J. Lipid Res. 35, 2130–2142[Abstract]
- Esko, J. D., Wermuth, M. M., and Raetz, C. R. H.
(1981) J. Biol. Chem.
256,
7388–7393
[Free Full Text] - Cui, Z., Houweling, M., Chen, M. H., Record, M. Chap, H., Vance, D.
E., and Terce, F. (1996) J. Biol. Chem.
271,
14668–14671
[Abstract/Free Full Text] - Courey, A. J., and Tjian, R. (1988) Cell. 55, 887–898[CrossRef][Medline] [Order article via Infotrieve]
- Noti, J. D. (1997) J. Biol.
Chem. 272,
24038–24045
[Abstract/Free Full Text] - Andrew, N. C., and Faller, D. V. (1991)
Nucleic Acids Res. 19,
2499–2509
[Free Full Text] - Northwood, I. C., Tong, A. H. Y., Crawford, B., Drobnies, A. E.,
and Cornell, R. B. (1999) J. Biol. Chem.
274,
26240–26248
[Abstract/Free Full Text] - Jackson, S. P., MacDonald, J. J., Lees-Miller, S., and Tjian, R. (1990) Cell 63, 155–165[CrossRef][Medline] [Order article via Infotrieve]
- Paddison, P. J. Caudy, A. A., Berstein, E., Hannon, G., and
Conklin, D. S. (2002) Genes Dev.
16,
948–958
[Abstract/Free Full Text] - Lania, L., Majello, B., and DeLuca, P. (1997) Int. J. Biochem. Cell Biol. 29, 1313–1323[CrossRef][Medline] [Order article via Infotrieve]
- Hagen, G., Muller, S., Beato, M., and Suske, G. (1994) EMBO J. 13, 3843–3851[Medline] [Order article via Infotrieve]
- Johnson, D. G., and Walker, C. L. (1999) Annu. Rev. Pharmacol. Toxicol. 39, 295–312[Medline] [Order article via Infotrieve]
- Black, A. R., Jensen, D., Lin, S. Z., and Azizkhan, J. C.
(1999) J. Biol. Chem.
274,
1207–1215
[Abstract/Free Full Text] - Amstrong, S. A., Barry, D. A., Leggety, R. W., and Mueller, C. R.
(1997) J. Biol. Chem.
272,
13489–13495
[Abstract/Free Full Text] - Hunt, T. (1991) Semin. Cell Biol. 2, 213–222[Medline] [Order article via Infotrieve]
- Hunter, T., and Pines, J. (1991) Cell 66, 1071–1074[CrossRef][Medline] [Order article via Infotrieve]
- Sherr, C. J. (1993) Cell 73, 1059–1065[Medline] [Order article via Infotrieve]
- Sherr, C. J. (1994) Cell 79, 551–555[CrossRef][Medline] [Order article via Infotrieve]
- Pagano, M., Pepperkok, R., Verde, F., Ansorge, W., and Draetta, G. (1992) EMBO J. 11, 961–971[Medline] [Order article via Infotrieve]
- Haidweger, E., Novy, M., and Rotheneder, H. (2001) J. Mol. Biol. 306, 201–212[CrossRef][Medline] [Order article via Infotrieve]
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  M. A. MacKinnon, A. J. Curwin, G. J. Gaspard, A. B. Suraci, J. P. Fernandez-Murray, and C. R. McMaster The Kap60-Kap95 Karyopherin Complex Directly Regulates Phosphatidylcholine Synthesis J. Biol. Chem., March 13, 2009; 284(11): 7376 - 7384. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Banchio, S. Lingrell, and D. E. Vance Sp-1 Binds Promoter Elements That Are Regulated by Retinoblastoma and Regulate CTP:Phosphocholine Cytidylyltransferase-{alpha} Transcription J. Biol. Chem., May 18, 2007; 282(20): 14827 - 14835. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Fagone, R. Sriburi, C. Ward-Chapman, M. Frank, J. Wang, C. Gunter, J. W. Brewer, and S. Jackowski Phospholipid Biosynthesis Program Underlying Membrane Expansion during B-lymphocyte Differentiation J. Biol. Chem., March 9, 2007; 282(10): 7591 - 7605. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Tian, R. Zhou, J. E. Rehg, and S. Jackowski Role of Phosphocholine Cytidylyltransferase {alpha} in Lung Development Mol. Cell. Biol., February 1, 2007; 27(3): 975 - 982. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Banchio, S. Lingrell, and D. E. Vance Role of Histone Deacetylase in the Expression of CTP:Phosphocholine Cytidylyltransferase {alpha} J. Biol. Chem., April 14, 2006; 281(15): 10010 - 10015. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Sugimoto, K. Okamura, S. Sugimoto, M. Satou, T. Hattori, D. E. Vance, and T. Izumi Sp1 Is a Co-activator with Ets-1, and Net Is an Important Repressor of the Transcription of CTP:Phosphocholine Cytidylyltransferase {alpha} J. Biol. Chem., December 9, 2005; 280(49): 40857 - 40866. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Jackowski and P. Fagone CTP:Phosphocholine Cytidylyltransferase: Paving the Way from Gene to Membrane J. Biol. Chem., January 14, 2005; 280(2): 853 - 856. [Full Text] [PDF]
|
|
|
|
|
|
R. L. Jacobs, C. Devlin, I. Tabas, and D. E. Vance Targeted Deletion of Hepatic CTP:phosphocholine Cytidylyltransferase {alpha} in Mice Decreases Plasma High Density and Very Low Density Lipoproteins J. Biol. Chem., November 5, 2004; 279(45): 47402 - 47410. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Chintalgattu and L. C. Katwa Role of Protein Kinase C{delta} in Endothelin-Induced Type I Collagen Expression in Cardiac Myofibroblasts Isolated from the Site of Myocardial Infarction J. Pharmacol. Exp. Ther., November 1, 2004; 311(2): 691 - 699. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Banchio, L. M. Schang, and D. E. Vance Phosphorylation of Sp1 by Cyclin-dependent Kinase 2 Modulates the Role of Sp1 in CTP:Phosphocholine Cytidylyltransferase {alpha} Regulation during the S Phase of the Cell Cycle J. Biol. Chem., September 17, 2004; 279(38): 40220 - 40226. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |