| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 278, Issue 34, 32471-32477, August 22, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
¶ **
From the
Department of Microbiology and Immunology
and the Walther Oncology Center, Indiana University School of Medicine,
Indianapolis, Indiana 46202, the Walther Cancer
Institute, Indianapolis, Indiana 46208, and
||Tularik, Incorporated, San Francisco, California
94080
Received for publication, March 18, 2003 , and in revised form, June 6, 2003.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
N-STAT4) lacking the N-terminal 51
amino acids. Whereas full-length STAT4 rescued IL-12 responsiveness, T
lymphocytes expressing the STAT4 N-terminal mutant failed to proliferate in
response to IL-12 and had limited Th1 cell development as evidenced by minimal
interferon-
production. Deletion of the N-terminal domain resulted in
failure of STAT4 to be phosphorylated following IL-12 stimulation despite
similar phosphorylation of JAK2 and TYK2 in full-length STAT4 and
N-STAT4 transgenic T cells. We demonstrate that the lack of
phosphorylation in cultured cells is due to reduced efficiency of
phosphorylation of N-STAT4 by Janus kinases. These data support a new
model wherein the N-terminal domain is required to mediate the phosphorylation
of STAT4 in addition to the previously documented role in gene
transactivation. |
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
produced by Th1 cells enhances the activity of cytotoxic T lymphocytes and
natural killer cells (1). In
addition, IL-12 promotes the proliferation of T cells in response to
pathogenic stimulation. Thus, IL-12 is an important regulator in innate and
adaptive immunity.
IL-12 mediates its biological function by binding to IL-12 receptors
(IL-12Rs) and transmitting signals via the JAK-STAT pathway. IL-12
1 and
IL-12R2 belong to the gp130 cytokine receptor superfamily. The IL-12Rs
do not contain intrinsic kinase activity, but instead physically associate
with members of the Janus family of protein-tyrosine kinases (JAKs);
IL-12R1 pre-associates with TYK2, and IL-12R2 with JAK2
(2). The binding of IL-12 to
its receptor activates the JAKs that phosphorylate the tyrosine residues
located in the cytoplasmic region of IL-12R2. Subsequently, the
phosphorylated receptors recruit STAT4 through interaction of the STAT4 SH2
domain with the phosphotyrosine at position 800 in the IL-12R2 chain
(3,
4). STAT4 then becomes
phosphorylated at Tyr693
(5), dimerizes, and
translocates into the nucleus to activate gene transcription.
STAT4 is a critical mediator of IL-12-stimulated gene regulation. STAT4-deficient mice have greatly decreased Th1 cell differentiation and lack many other biological functions mediated by IL-12 signaling (6, 7). STAT proteins have several functional domains, including a central DNA-binding domain, an SH2 domain, and a C-terminal transactivation domain (8). Based on the crystal structures of STAT1 and STAT3 (9, 10), STAT proteins also have a coiled-coil domain that may mediate protein-protein interaction (11).
An N-terminal domain has also been identified in STAT proteins that,
although dispensable for dimerization, is required for the tetramerization
that mediates cooperative association with tandem STAT4 DNA-binding sites
(12). The crystal structure of
the N-terminal domain of STAT4, comprising the first 124 amino acids, has
revealed that it is composed of eight 
-helices that assemble into a
hook-like structure (13).
Recent studies using retroviral expression in primary T cells and cell lines
suggest that the STAT4 N-terminal domain may also be important for STAT4
phosphorylation (14). However,
IL-12-stimulated STAT4 activation was not extensively examined.
To delineate the function of the N-terminal domain of STAT4 in
vivo and to determine which biological functions may require the
N-terminal domain, we generated transgenic mice that express full-length STAT4
or a STAT4 mutant (N-STAT4) lacking the N-terminal 51 amino acids, with
a deletion of the regions from the N terminus through the fifth -helix.
These mice were mated with STAT4-deficient mice, so transgenic STAT4 is
expressed in the absence of endogenous STAT4. Whereas transgenic expression of
full-length STAT4 rescued IL-12-stimulated proliferation, Th1 generation, and
CD25 induction on the STAT4–/–
background, transgenic expression of N-STAT4 did not rescue any of
these functions. This correlates with a lack of IL-12-induced phosphorylation
of N-STAT4, despite normal activation of JAK2 and TYK2. Further
analysis demonstrated that the STAT4 N-terminal domain is required for
efficient phosphorylation by JAK2, but is not required for interaction with
phosphorylated peptide from the IL-12R2 chain. These results demonstrate
a critical role for the N-terminal domain in proximal events leading to the
IL-12-stimulated phosphorylation of STAT4.
|
EXPERIMENTAL PROCEDURES |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
N-STAT4)
lacking the N-terminal 51 amino acids were cloned into a vector containing the
CD2 locus control region (15,
16), and transgenic mice were
generated at the Indiana University Transgenic Facility. Transgenic mice
produced on the C3H genetic background were backcrossed to C57BL/6 and two
generations to STAT4-deficient C57BL/6 mice to generate STAT4-deficient
transgenic mice. Control wild-type mice (C57BL/6) were purchased from Harlan
Bioproducts for Science, Inc. (Indianapolis, IN).
Analysis of Transgenic Mice—Transgenic mice were analyzed by
Southern, Northern, and Western blotting. The genomic DNA and total RNA were
extracted from the tails and spleens, respectively. The probes used in
Southern and Northern blotting were the cDNAs from human full-length STAT4
labeled with [-32P]dCTP using the random decamer reagent
(Ambion Inc., Austin, TX). Alternatively, transgenic mice were typed by PCR
using upstream (GAAGGTGATCCCATTCCAATG) and downstream
(GTTTCAAACGTTATGGAATGAAGT) primers. Western blotting was carried out on total
protein extracted from spleens using anti-STAT4 polyclonal antibody specific
for the C-terminal portion of STAT4 (Santa Cruz Biotechnology, Santa Cruz,
CA).
Proliferation Assay—Cells isolated from spleens and lymph nodes were activated for 72 h with plate-bound anti-CD3 antibody to activate T cells and to make them IL-12-responsive. Cells were then plated in triplicate at 5 x 104 cells/well in a round-bottomed 96-well plate in RPMI 1640 medium supplemented with 10% heat-inactivated fetal bovine serum (Hyclone Laboratories, Logan, UT) and stimulated with various doses of IL-12 (Genetics Institute, Cambridge, MA) ranging from 0 to 1 ng/ml or with IL-2 (8 ng/ml) for 72 h. Cells were pulsed for the last 16–18 h with [3H]thymidine (1 µCi/well). The incorporation of [3H]thymidine was measured with a liquid scintillation counter.
CD25 Expression by Flow Cytometry—Splenocytes isolated from mice were activated with plate-bound anti-CD3 antibody at 2 µg/ml for 3 days. Cells purified through Histopaque-1077 (Sigma) at 1 x 106 cells/ml were incubated with IL-2 (2 ng/ml) or with IL-12 (8 ng/ml) and anti-IL-2 antibody (20 µg/ml) to eliminate IL-2-induced CD25 expression or left unstimulated (anti-IL-2 antibody alone). Following overnight incubation, cells were stained with anti-CD25 antibody conjugated with fluorescein isothiocyanate (BD Biosciences). CD25 expression on the activated cell population was analyzed by flow cytometry (FACScan, BD Biosciences). The mean fluorescence intensity was evaluated by the CellQuest program (BD Biosciences).
IFN- Production by Th1 Cells—CD4+
T cells were isolated by positive selection using MiniMacs beads (Miltenyi
Biotec, Auburn, CA) and differentiated into Th1 cells as described
(17). Differentiated Th1 cells
were restimulated with plate-bound anti-CD3 antibody (2 µg/ml), with IL-12
(2 ng/ml), or with IL-12 (2 ng/ml) and IL-18 (25 ng/ml) for 24 h. The
supernatants were collected for enzyme-linked immunosorbent assay to measure
the level of IFN- production
(18).
Protein Phosphorylation Analysis by Immunoprecipitation and Immunoblotting—Cells isolated from spleens and lymph nodes were activated with plate-bound anti-CD3 antibody at 2 µg/ml for 3 days. Ten million cells purified though Histopaque-1077 were incubated with or without IL-12 at 2 ng/ml for 20 min at 37 °C in a 5% CO2 incubator. In the case of STAT4 phosphorylation, the phosphatase inhibitor sodium orthovanadate at various doses was included. The cells were washed three times with phosphate-buffered saline and lysed with protein lysis buffer (19). Total protein extracts (1 mg) were immunoprecipitated individually with anti-JAK2 polyclonal antibody (Upstate Biotechnology, Inc., Lake Placid, NY) or anti-TYK2 polyclonal antibody (Santa Cruz Biotechnology). Phosphorylated proteins were detected with anti-phosphotyrosine antibody PY99 (Santa Cruz Biotechnology) or 4G10 (Upstate Biotechnology, Inc.) and visualized with a chemiluminescence kit (ECL, Amersham Biosciences). STAT4 phosphorylation was detected using anti-phospho-STAT4 antibody (Zymed Laboratories, Inc., South San Francisco, CA), followed by stripping and reprobing the membranes with polyclonal antibody against the C terminus of STAT4 (Santa Cruz Biotechnology).
STAT4 Analysis in COS-7 Cells—COS-7 cells grown on 6-well
plates were transiently transfected using FuGENE reagents (Roche Applied
Science) with 1 µg of STAT4 or N-STAT4 plasmid in pcDNA3 with
various concentrations of JAK2 plasmid
(12) ranging from 0 to 250 ng.
After incubation for 48 h at 37 °C in a 5% CO2 incubator, cells
were lysed to extract the total protein. The protein extracts were subjected
to 8% SDS-PAGE for Western blotting with anti-phospho-STAT4 antibody. The
membranes were stripped and reprobed with polyclonal antibody against the C
terminus of STAT4. For DNA binding assays, extracts from COS-7 cells
transfected with STAT4 or N-STAT4 and JAK2-expressing plasmids were
incubated with a biotinylated STAT4-binding site in binding buffer A (25
mM HEPES, 15 mM NaCl, 0.1 mM EDTA (pH 7.5),
0.5% Igepal, 10% glycerol, and 0.5 mM dithiothreitol) overnight at
4 °C. Streptavidin-agarose (Upstate Biotechnology, Inc.) was added to
reactions for 2 h. Complexes were then precipitated and washed twice with
binding buffer A. Samples were subjected to Western analysis with
anti-phospho-STAT4 antibody. As a control, total phospho-STAT4 levels and
total STAT4 levels were determined in total cell extracts. For reporter
assays, cells were transfected as described above with 1 µg of
STAT4-expressing plasmid, 1 µg of JAK2-expressing plasmid, 0.3 µg of
-galactosidase-expressing plasmid, and 2 µg of luciferase reporter
plasmid containing two copies of the IFN regulatory factor-1 promoter
STAT/cAMP-responsive element-binding site. Total cell extracts were made 48 h
later, and luciferase levels were analyzed with a luciferase assay kit
(Promega, Madison WI). Luciferase levels were corrected for transfection
efficiency by measuring -galactosidase levels (Galacto-Light system,
Applied Biosystems, Foster City, CA) and protein concentration.
In Vitro Kinase Assay—Recombinant STAT4 or N-STAT4
protein was expressed by baculovirus in Sf9 insect cells as described
previously (12). Purified
STAT4 proteins were incubated with or without JAK2 enzyme-agarose complex
(Upstate Biotechnology, Inc.) following the manufacturer's instructions. The
phosphorylation of STAT4 was detected by Western blotting with
anti-phospho-STAT4 antibody. The blot was stripped and reprobed with
polyclonal antibody against the C terminus of STAT4.
Peptide Binding Assay—The biotinylated phosphopeptide DLPTHDGpY800LPSNIDD and the identical non-phosphorylated peptide were synthesized (Genemed Biotechnologies, Inc., San Francisco, CA) for the in vitro binding assay. Increasing amounts of total protein extracts (100, 200, and 400 µg) from pooled spleens and lymph nodes were incubated with the biotinylated phosphopeptide (100 nM) overnight at 4 °C in binding buffer B (20 mM HEPES, 15 mM NaCl, 0.5 mM dithiothreitol, and 0.5% Igepal). The complex of peptide-bound STAT4 was precipitated by immobilized streptavidin (Upstate Biotechnology, Inc.). The precipitation of STAT4 with the biotinylated peptides was evaluated by Western blotting with polyclonal antibody against the C terminus of STAT4.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
N-STAT4) lacking the first 51 amino acids
(Fig. 1A) were
generated on the C57BL/6 STAT4–/–
background as described under "Experimental Procedures." The
presence of transgenes in mice was tested by Southern analysis of tail genomic
DNA (Fig. 1B) or by
PCR. Expression of transgenic STAT4 was confirmed by Northern and Western
analyses (Fig. 1B).
Two forms of N-STAT4 were observed in some Western analyses
(Fig. 1B). This may
represent increased degradation of the N-STAT4 form and correlated with
relatively low expression despite high STAT4 mRNA levels
(Fig. 1B). Four
founder lines were initially characterized and found to have similar
phenotypes. Two CD2:N-STAT4 founder lines (1078 and 1106) were selected
and used for detailed analysis.
|
CD2:N-STAT4 Cells Do Not Respond to IL-12—As
previously demonstrated, STAT4-deficient activated T cells do not proliferate
in response to IL-12 (6,
7,
20). To determine whether the
N-terminal portion of STAT4 is required for proliferation of T cells in
response to IL-12, we activated spleen cells with plate-bound anti-CD3
antibody for 72 h. Cells were then removed from anti-CD3 antibody and
incubated in the presence or absence of increasing doses of IL-12. Activated T
cells from wild-type and CD2:STAT4 mice demonstrated a dose-dependent increase
in IL-12-stimulated proliferation (Fig.
2A). Activated T cells from CD2:N-STAT4 transgenic
mice (founder lines 1078 and 1106) failed to proliferate upon IL-12
stimulation, as shown in Fig.
2A. As a control, wild-type, STAT4-deficient, and STAT4
transgenic mice had a similar level of proliferation with IL-2
(Fig. 2B). Thus,
N-STAT4 expression is not sufficient to mediate T cell proliferation in
response to IL-12.
|
CD25 gene expression is induced by IL-12 in a STAT4-dependent manner
(21,
22). The STAT-responsive
element in the CD25 promoter has been well characterized and has demonstrated
the necessity of the N-terminal domain of STAT5 for IL-2-induced gene
expression (23). Thus, this
gene provides an ideal target gene for analysis of N-terminal domain function.
Spleen cells were activated with anti-CD3 antibody as described above, and
cells were incubated overnight with anti-IL-2 antibody (unstimulated), with
IL-12 and anti-IL-2 antibody, or with IL-2. Cells were then stained with
fluorescent antibody to CD25. Wild-type and CD2:STAT4 cells demonstrated
IL-12-induced CD25 expression, whereas there was no induction of CD25
expression in STAT4-deficient cells (Fig.
3). The diminished induction in CD2:STAT4 cells correlated with
lower levels of STAT4 expressed in these cells
(Fig. 1). Importantly, CD25
expression was not induced by IL-12 in CD2:N-STAT4 transgenic mice
(Fig. 3). Induction of CD25
expression by IL-2 was similar in all genotypes, demonstrating that the CD25
locus is still cytokine-responsive in STAT4-deficient and CD2:N-STAT4
transgenic mice.
|
STAT4 activation following IL-12 stimulation contributes to the development
of Th1 cells and is important for the production of IFN-, the hallmark
cytokine of Th1 cells (24). We
next examined whether CD4 T cells from STAT4 transgenic mice could be
polarized into Th1 cells. Purified CD4 T cells were stimulated with
plate-bound anti-CD3 antibody, anti-CD28 antibody, IL-12, and anti-IL-4
antibody for 6 days. Cells were then restimulated with anti-CD3 antibody
alone, with IL-12 alone, or with IL-12 in combination with IL-18. Wild-type
and CD2:STAT4 cells produced significant levels of IFN- following each
of these stimuli (Fig. 4)
(25), and diminished induction
in CD2:STAT4 cells correlated with lower levels of STAT4 expressed in these
cells (Fig. 1). As previously
described, STAT4-deficient cells are greatly or completely impaired in their
ability to produce IFN- following anti-CD3 antibody or IL-12
stimulation, respectively (6,
7). Th1 cultures from the two
founder lines (1078 and 1106) of CD2:N-STAT4 transgenic mice produced
low levels of IFN- following anti-CD3 antibody stimulation and
undetectable amounts of IFN- following either IL-12 or IL-12 plus IL-18
stimulation (Fig. 4), a
phenotype similar to that seen in STAT4-deficient mice. To confirm that Th1
differentiation (and not simply IFN- production) was impaired in
CD2:N-STAT4 mice, we also examined the expression of Th1-restricted
genes, including IL-12R2, lympho-toxin-, and Ccr5, by
Northern analysis. These genes were highly expressed in wild-type Th1 cells,
whereas levels were greatly decreased in STAT4-deficient and
CD2:N-STAT4 transgenic Th1 cultures (data not shown). Thus,
N-STAT4 is not sufficient to mediate Th1 differentiation.
|
The N-terminal Domain Is Required for STAT4
Phosphorylation—Since N-STAT4 was not sufficient to mediate
any IL-12-stimulated functions, we next examined the phosphorylation of STAT4
following IL-12 stimulation to confirm normal activation of N-STAT4.
IL-12 induced tyrosine phosphorylation of STAT4 in wild-type and CD2:STAT4
cells (Fig. 5). In contrast,
IL-12 did not induce tyrosine phosphorylation of STAT4 in CD2:N-STAT4
transgenic mice. To increase the sensitivity of phosphotyrosine analysis,
sodium orthovanadate, a phosphatase inhibitor, was included during IL-12
stimulation to increase phospho-STAT4 levels. As shown in
Fig. 5, the addition of
increasing levels of the phosphatase inhibitor increased the level of STAT4
tyrosine phosphorylation in wild-type and CD2:STAT4 cells. However, even with
treatment of the phosphatase inhibitor, STAT4 from CD2:N-STAT4
transgenic cells did not become detectably phosphorylated.
|
We have previously demonstrated that JAK2 and TYK2 activation is normal in
STAT4-deficient cells (19). To
determine whether the lack of STAT4 phosphorylation observed in CD2:
N-STAT4 transgenic mice resulted from deficient JAK kinase activity,
the integrity of the IL-12-activated JAKs JAK2 and TYK2 was evaluated upon
IL-12 stimulation. IL-12 induced comparable phosphorylation of JAK2
(Fig. 6A) and TYK2
(Fig. 6B) in
wild-type, CD2:STAT4, and CD2:N-STAT4 transgenic cells.
|
Binding of STAT4 to Phosphopeptide Derived from
IL-12R2—To begin to determine the nature of the
defect in N-STAT4 activation, we first examined the ability of
full-length and mutant STAT4 to interact with the IL-12R. The tyrosine at
position 800 in the IL-12R2 protein mediates the recruitment of STAT4 to
the receptor complex. Furthermore, the binding of STAT4 to this region is
specific and occurs only when this tyrosine is phosphorylated
(Fig. 7B)
(3,
4). To determine whether
N-STAT4 interacts with the IL-12R2 phosphopeptide, we performed a
phosphopeptide binding assay using total cell extracts from CD2:STAT4 and
CD2:N-STAT4 mice. Direct interaction of N-STAT4 with the
phosphopeptide derived from the IL-12R2 subunit was readily observed to
a level similar to that of full-length STAT4 with increasing amounts of cell
extract (Fig. 7C).
Thus, both forms of STAT4 are capable of interacting with the IL-12R.
|
The STAT4 N-terminal Domain Mediates Efficient
Phosphorylation—To further characterize the inability of
N-STAT4 to be phosphorylated, we transfected COS-7 cells with plasmids
expressing full-length STAT4 or N-STAT4 and cotransfected with
increasing amounts of JAK2 plasmid DNA. As shown in
Fig. 8A, no
phospho-STAT4 was detected in the absence of transfected JAK2. However, JAK2
dose-dependent phosphorylation of STAT4 and N-STAT4 was observed when
the JAK2 plasmid was cotransfected. The level of phosphorylation was
determined by the ratio of phosphorylated STAT4 to total STAT4 protein using
densitometry, and the results of this analysis are shown in
Fig. 8B. More
full-length STAT4 was phosphorylated with lower concentrations of JAK2
compared with N-STAT4, although equal phosphorylation of both forms of
STAT4 was detected upon the expression of high levels of JAK2
(Fig. 8B).
|
To confirm these results, we also performed an in vitro kinase
assay with recombinant full-length STAT4 and N-STAT4. Recombinant
proteins were incubated with a JAK2 enzyme-agarose complex, and phospho-STAT4
was detected by Western analysis. As shown in
Fig. 8C,
phosphorylation of N-STAT4 protein was detectable, but in a much lower
level compared with full-length STAT4 proteins. Thus, N-STAT4 is
phosphorylated by JAK2 less efficiently compared with full-length STAT4.
The N-terminal Domain Is Not Required for Transactivation from a
STAT4-responsive Element—Knowing that high levels of JAK2
expression can lead to equivalent activation of full-length STAT4 and
N-STAT4, we wanted to test whether both forms would still be capable of
binding DNA and activating transcription. We first tested the ability of
full-length STAT4 and N-STAT4 to bind DNA by incubating cell extracts
from COS-7 cells, which had been transfected with either full-length STAT4 or
N-STAT4 in the presence or absence of JAK2 expression, with
biotinylated oligonucleotides containing STAT4-binding sites
(Fig. 9A). Complexes
were precipitated with streptavidin-agarose and analyzed by Western blotting.
Both full-length STAT4 and N-STAT4 were capable of binding to DNA
(Fig. 9B). We then
tested whether full-length or mutant STAT4 would activate a reporter
containing two copies of the IFN regulatory factor-1 promoter
STAT/cAMP-responsive element-binding site known to mediate STAT4
transactivation (26). Plasmids
encoding full-length STAT4 or N-STAT4 and the reporter plasmid were
transfected into COS-7 cells in the absence or presence of a JAK2 plasmid.
Full-length STAT4 and N-STAT4 were capable of equally inducing
luciferase activity from the reporter plasmid
(Fig. 9C)
(12). Thus, defects in
N-STAT4 function are restricted to proximal events during STAT4
phosphorylation.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
N-STAT4, which lacks the N-terminal 51 amino acids. These
mice allowed us to characterize the role of the N-terminal domain by examining
a wide array of biological assays. Transgenic expression of full-length STAT4
(but not N-STAT4) on a
STAT4–/– background rescued
IL-12-stimulated biological functions, including proliferation and Th1
differentiation. This was due to the lack of N-STAT4 phosphorylation in
transgenic T cells following IL-12 stimulation. We have demonstrated that the
lack of phosphorylation in cultured cells was due to reduced efficiency of
phosphorylation of N-STAT4 by JAKs. These data support a model wherein
the N-terminal domain is required to mediate the biological function of
STAT4.
In our study using several different systems examining STAT4
phosphorylation in primary transgenic cells
(Fig. 5) and in transfected
COS-7 cells and in a cell-free reaction
(Fig. 8), the N-STAT4
proteins demonstrated decreased tyrosine phosphorylation. Transfection data
indicated that the mutant N-STAT4 protein was capable of serving as a
substrate, albeit less efficiently, for JAK2. Thus, this deficiency may be
overcome when JAK2 is overexpressed
(12). It is also possible that
the N-terminal domain may mediate interactions with the IL-12R2 chain.
The N-terminal region of STAT2 has been shown to mediate association with the
IFN receptor 2 (27).
However, the interaction of STAT2 with the IFN- receptor is not
required for activation (28),
and we have shown that transgenic N-STAT4 interacted normally with a
phosphopeptide from the IL-12R2 chain. Thus, the 1–51
mutation of STAT4 affects the efficiency of phosphorylation by JAKs rather
than being required for interactions of STAT4 with the receptor.
The precise role of the N-terminal domain of STAT proteins in
phosphorylation events is still unclear. We have demonstrated that the
N-STAT4 proteins from cells of the transgenic mice were not activated
upon IL-12 stimulation as evidenced by undetectable tyrosine phosphorylation
(Fig. 5). Specific mutation of
Trp37 or double mutation of Lys84 and Arg85
demonstrated a similar role for the STAT4 N-terminal domain in tyrosine
phosphorylation (14). Mutation
of Trp37, which is conserved in all STAT protein N-terminal domains
(13), results in a lack of
STAT4 phosphorylation following IFN- stimulation in U3A cells and a
lack of nuclear STAT4 in IL-12-stimulated primary T cells
(14). Similarly, deletion of
the N-terminal 59 amino acids of STAT2 completely abolishes tyrosine
phosphorylation following IFN- stimulation in U6A cells by a mechanism
that is distinct from IFN receptor interaction
(28,
29). In contrast, the
N-terminal domain of all STAT proteins does not seem to be required for
activation. Truncated STAT1 lacking the N-terminal 61 amino acids displays
constitutive tyrosine phosphorylation
(30). In addition, truncated
STAT1 lacking the N-terminal 131 amino acids undergoes successful tyrosine
phosphorylation in vitro
(31), and deletion of 136
amino acids from the N terminus of STAT5 does not affect IL-3-stimulated
tyrosine phosphorylation (32).
These results suggest that the N-terminal domain may have distinct functions
in different STAT proteins. The N-terminal domain is required for normal
activation of STAT4 and STAT2. In contrast, the N-terminal domain of STAT1
mediates targeting of a STAT1 phosphatase
(30) as well as cellular
distribution (33).
Importantly, the requirement for the N-terminal domain in STAT dimer-dimer interactions leading to stabilization of the protein-DNA complex by cooperative DNA binding has been well documented. Deletion of 88 amino acids from the N terminus of STAT4 does not affect its binding to a single binding site, but abolishes the cooperative binding of two STAT4 dimers to tandem low affinity sites (12). Similarly, truncated STAT1 lacking the N-terminal 44 residues binds to a single high affinity site, but not to a pair of low affinity sites (12). Mutation of the invariant Trp37 to alanine in STAT1 or STAT5 eliminates tetramer formation (13, 34). The precise nature of the dimerization interface of the STAT proteins is unclear since several examples of mutations that would be predicted to disrupt dimer formation have little effect. Recent analyses of potential dimer interfaces suggest that the interaction may be distinct from that originally predicted (35).
Since the STAT N-terminal domain was crystallized separately from the rest of the STAT protein, it is still unclear how it may interact with other STAT domains. Intraprotein interactions have been shown to be important for receptor interaction and the subsequent activation of STAT3 (36), and this may be important for other STAT proteins as well. Our results suggest that the N-terminal domain of STAT4 may contribute to inter- or intramolecular interactions, which affects its ability to serve as a substrate for JAKs. The potential structural requirements for the N-terminal domain in inter- or intramolecular interactions suggest that distinct mutations could result in proteins that lack activation or that have constitutive activation. Further analysis will be required to determine how this domain mediates distinct STAT protein functions.
|
FOOTNOTES |
|---|
¶ Supported by National Institutes of Health Training Grant T32DK007519.
** To whom correspondence should be addressed: Dept. of Microbiology and Immunology, Walther Oncology Center, Indiana University School of Medicine, Rm. 302, 950 West Walnut St., Indianapolis, IN 46202. Tel.: 317-278-3696; Fax: 317-274-7592; E-mail: mkaplan2{at}iupui.edu.
1 The abbreviations used are: IL, interleukin; IFN, interferon; JAK, Janus
kinase; IL-12R, interleukin-12 receptor; STAT, signal
transducer and activator of transcription;
SH2, Src homology-2.
|
ACKNOWLEDGMENTS |
|---|
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  M. J. Robertson, H.-C. Chang, D. Pelloso, and M. H. Kaplan Impaired interferon-{gamma} production as a consequence of STAT4 deficiency after autologous hematopoietic stem cell transplantation for lymphoma Blood, August 1, 2005; 106(3): 963 - 970. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. E. Persky, K. M. Murphy, and J. D. Farrar IL-12, but Not IFN-{alpha}, Promotes STAT4 Activation and Th1 Development in Murine CD4+ T Cells Expressing a Chimeric Murine/Human Stat2 Gene J. Immunol., January 1, 2005; 174(1): 294 - 301. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. O'Sullivan, H.-C. Chang, Q. Yu, and M. H. Kaplan STAT4 Is Required for Interleukin-12-induced Chromatin Remodeling of the CD25 Locus J. Biol. Chem., February 20, 2004; 279(8): 7339 - 7345. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
