Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M301523200 on June 12, 2003

J. Biol. Chem., Vol. 278, Issue 35, 32544-32551, August 29, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/35/32544    most recent
M301523200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kambhampati, S.
Right arrow Articles by Platanias, L. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kambhampati, S.
Right arrow Articles by Platanias, L. C.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Activation of Protein Kinase C{delta} by All-trans-retinoic Acid*

Suman Kambhampati {ddagger}, Yongzhong Li {ddagger}, Amit Verma {ddagger}, Antonella Sassano {ddagger}, Beata Majchrzak §, Dilip K. Deb ¶, Simrit Parmar {ddagger}, Nick Giafis {ddagger}, Dhananjaya V. Kalvakolanu ||, Arshad Rahman **, Shahab Uddin {ddagger}{ddagger}, Saverio Minucci §§, Martin S. Tallman {ddagger}, Eleanor N. Fish § and Leonidas C. Platanias {ddagger} ¶¶

From the {ddagger}Robert H. Lurie Comprehensive Cancer Center and the Division of Hematology-Oncology, Northwestern University Feinberg School of Medicine and Lakeside Veterans Affairs Medical Center, Chicago, Illinois 60611, the §Division of Cell and Molecular Biology, Toronto Research Institute, University Health Network, and the Department of Immunology, University of Toronto, Toronto, Ontario M5G 2M1, Canada, the **Department of Pediatrics, University of Rochester School of Medicine, Rochester, New York 14642, the Ben May Cancer Institute and the {ddagger}{ddagger}Section of Hematology-Oncology, University of Chicago, Chicago, Illinois 60637, the ||Department of Microbiology and Immunology, University of Maryland School of Medicine, Baltimore, Maryland 21201, and the §§Department of Experimental Oncology, European Institute of Oncology, Milan 20141, Italy

Received for publication, February 12, 2003 , and in revised form, May 12, 2003.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
All-trans-retinoic acid (RA) is a potent inhibitor of leukemia cell proliferation and induces differentiation of acute promyelocytic leukemia cells in vitro and in vivo. For RA to induce its biological effects in target cells, binding to specific retinoic acid nuclear receptors is required. The resulting complexes bind to RA-responsive elements (RAREs) in the promoters of RA-inducible genes to initiate gene transcription and to generate protein products that mediate the biological effects of RA. In this report, we provide evidence that a member of the protein kinase C (PKC) family of proteins, PKC{delta}, is activated during RA treatment of the NB-4 and HL-60 acute myeloid leukemia cell lines as well as the MCF-7 breast cancer cell line. Such RA-dependent phosphorylation was also observed in primary acute promyelocytic leukemia cells and resulted in activation of the kinase domain of PKC{delta}. In studies aimed at understanding the functional relevance of PKC{delta} in the induction of RA responses, we found that pharmacological inhibition of PKC{delta} (but not of other PKC isoforms) diminished RA-dependent gene transcription via RAREs. On the other hand, overexpression of a constitutively active form of the kinase strongly enhanced RA-dependent gene transcription via RAREs. Gel shift assays and chromatin immunoprecipitation studies demonstrated that PKC{delta} associated with retinoic acid receptor-{alpha} and was present in an RA-inducible protein complex that bound to RAREs. Pharmacological inhibition of PKC{delta} activity abrogated the induction of cell differentiation and growth inhibition of NB-4 blast cells, demonstrating that its function is required for such effects. Altogether, our data provide strong evidence that PKC{delta} is activated in an RA-dependent manner and plays a critical role in the generation of the biological effects of RA in malignant cells.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
All-trans-retinoic acid (RA)1 is a potent inducer of cell differentiation and growth arrest of malignant cells in vitro and in vivo (1–6). This agent has potent effects against acute promyelocytic leukemia blast cells, and its introduction in the clinical management of the disease has dramatically changed the outcome of this historically fatal subtype of acute leukemia (5). RA and other retinoids have been shown to inhibit cell growth or to promote programmed cell death of neoplastic cells of diverse origin (7–14). The molecular mechanisms that regulate the induction of the biological effects of retinoids include a series of signaling events that are initiated by the binding of retinoids to specific receptors in the nucleus of target cells. Two families of retinoid receptors have been identified so far: retinoic acid receptors (RARs) (types {alpha}, {beta}, and {gamma}), which are activated by both RA and 9-cis-retinoic acid, and retinoid X receptors (RXRs) (types {alpha}, {beta}, and {gamma}), which are activated only by 9-cis-retinoic acid (15–17). RA binds to the nuclear RARs and induces the formation of RAR·RXR heterodimers, which associate with specific DNA-binding sequences present in the promoters of RA-responsive genes called retinoic acid-responsive elements (RAREs). Such binding of RAR nuclear complexes to promoter RAREs results in initiation of transcription of genes whose protein products mediate RA biological responses (15–17).

In addition to the induction of formation of RAR·RXR complexes, RA induces a variety of other cellular effects that appear to play a role in the generation of its effects on target cells. Such mechanisms via which retinoids induce their biological effects on malignant cells include inhibition of activation of the AP-1 protein via a CBP (cAMP-responsive element-binding protein)-regulated mechanism (18, 19), modulation of histone acetylation (20), and up-regulation of transforming growth factor-{beta}2 and insulin-like growth factor-binding protein-3 expression (21).

Retinoids also regulate the activation of members of different groups of MAPKs. It has been previously shown that they inhibit activation of the c-Jun N-terminal kinase (22), and such inhibition appears to be required for the induction of retinoid responses (22). On the other hand, RA induces activation of the MAPK ERK2 (23) as well as activation of the p38 MAPK (24). The activation of ERK2 mediates positive regulatory effects in the induction of retinoid responses, and its function appears to be essential for RA-dependent differentiation of HL-60 cells (23). On the other hand, activation of the p38 MAPK exhibits negative regulatory effects on the induction of differentiation of NB-4 cells by RA (24), and pharmacological inhibitors of this kinase promote the anti-leukemic effects of RA in vitro (24).

The protein kinase C (PKC) family of proteins is a multigene family of at least 12 serine/threonine kinases that participate in signal transduction events and are classified into three groups based on the differences in their structure and regulatory domains as well as differences in their activation requirements (25). The protein members of this family of kinases exhibit serine kinase activities and, upon their activation, regulate phosphorylation/activation of other serine kinases, resulting in signals that ultimately mediate multiple biological responses. The tissue distribution of PKC isoforms varies considerably, with PKC{alpha}, PKC{delta}, and PKC{zeta} being widely expressed, whereas most of the other isoforms are selectively expressed in different types of cells and tissues (25). PKC{delta} belongs to the group of novel PKC isoforms, which are Ca2+-independent and are activated by phorbol esters, diacylglycerol, and phosphatidylserine (26). Previous studies have shown that this kinase plays important roles in the induction of antiproliferative and pro-apoptotic responses in response to DNA-damaging agents and ionizing radiation (27, 28). Consistent with this, it has been demonstrated that overexpression of its catalytically active fragment is capable of inducing apoptosis of target cells (29).

In this study, we provide evidence that PKC{delta} is activated during treatment of acute promyelocytic leukemia and breast cancer cell lines with RA. Our data demonstrate that this PKC isoform forms complexes with RAR{alpha} and binds to RAREs. Such a function of PKC{delta} plays a critical role in RA-dependent transcriptional regulation, as evidenced by the fact that inhibition of PKC{delta} kinase activity blocks RA-dependent gene transcription via RAREs. Consistent with this, pharmacological inhibition of PKC{delta} diminishes induction of cell differentiation of acute promyelocytic leukemia blast cells by RA and blocks RA-dependent suppression of cell growth, underscoring the critical role that this PKC isoform plays in the induction of RA responses.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Cells and Reagents—The RA-sensitive human acute promyelocytic leukemia cell line NB-4 and the acute myeloid leukemia cell line HL-60 were grown in RPMI 1640 medium supplemented with 10% fetal bovine serum and antibiotics. MCF-7 cells were grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum and antibiotics. Polyclonal antibodies against PKC{delta} and Stat1 were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). An antibody against PKC{delta} phosphorylated/activated at Thr505 was obtained from New England Biolabs Inc. (Beverly, MA). An antibody against Stat1 phosphorylated at Ser727 was obtained from Upstate Biotechnology, Inc. The PKC{delta} inhibitor rottlerin and the PKC{alpha} inhibitor Go 6976 were obtained from Calbiochem. Peripheral blood mononuclear cells were isolated from the peripheral blood of a patient with acute promyelocytic leukemia, after obtaining informed consent approved by the Institutional Review Board of Northwestern University.

Cell Lysis, Immunoprecipitations, and Immunoblotting—Cells were treated with RA (final concentration of 1 µM) for the indicated times and lysed in phosphorylation lysis buffer as described previously (30–32). Immunoprecipitations and immunoblotting using an ECL method were performed as described previously (30–32).

PKC{delta} Kinase Assays—Immune complex kinase assays to detect PKC{delta} activation were performed as described previously (33, 34). Briefly, cells were treated for the indicated times with retinoic acid and were then lysed in phosphorylation lysis buffer. Cell lysates were immunoprecipitated with anti-PKC{delta} antibody, and immunoprecipitates were washed three times with phosphorylation lysis buffer and two times with kinase buffer (25 mM Tris-HCl (pH 7.4), 5 mM MgCl2, 0.5 mM EDTA, 1 mM dithiothreitol, 20 µg of phosphatidylserine, and 20 µM ATP) and resuspended in 30 µl of kinase buffer containing 5 µg of histone H1 as an exogenous substrate, to which 20–30 µCi of [{gamma}-32P]ATP was added. The reaction was incubated for 15–30 min at room temperature and terminated by the addition of SDS sample buffer. Proteins were analyzed by SDS-PAGE, and phosphorylated histone H1 was detected by autoradiography.

Mobility Shift Assays—Gel shift and supershift assays were performed as described previously (35–37). Briefly, nuclear extracts from untreated or RA-treated cells were incubated with or without double-stranded oligodeoxynucleotide corresponding to a DR5 RARE sequence (AGGGTAGGGTTCACCGAAAGTTCACTC) in the presence or absence of unlabeled oligonucleotide. Supershift assays using antibodies against PKC{delta} or RAR{alpha} were performed as described previously (35–37).

Luciferase Reporter Assays—MCF-7 cells were transfected with a {beta}-galactosidase expression vector and an RARE-luciferase plasmid (38) using the Superfect transfection reagent (QIAGEN Inc.) following the manufacturer's recommended procedure. Forty-eight hours after transfection, triplicate cultures were either left untreated or treated with RA for 16 h in the presence or absence of pharmacological inhibitors of the different PKC isoforms. The cells were preincubated with Go 6976 (2.5 nM), LY 379196 (50 nM), rottlerin (5 µM), and PKC{zeta} pseudosubstrate (50 µM), which are specific inhibitors for PKC{alpha} (39), PKC{beta}I/II (40), PKC{delta} (33, 34), and PKC{zeta} (41), respectively, prior to the addition of RA to the cultures. The cells were then washed twice with cold phosphate-buffered saline; and after cell lysis, luciferase activities were measured following the protocol of Promega. The measured luciferase activities were normalized for {beta}-galactosidase activity for each sample. In other experiments, MCF-7 cells were transfected with a 8XGAS-luciferase construct; and 48 h after transfection, triplicate cultures were either left untreated or treated with interferon (IFN)-{alpha} (5000 units/ml), RA, rottlerin, or combinations of the these agents. In the experiments in which the effects of overexpression of wild-type or constitutively active PKC{delta} on RARE-dependent gene transcription were evaluated, the cells were transfected with the pcDNA3-PKC-WT construct (42) or the pcDNA3-PKC-CAT construct, which encodes a truncated protein in which the catalytic domain (CAT) of PKC is preserved and the regulatory N-terminal domain is deleted, thereby generating a constitutively active catalytic domain (provided by Dr. J.-W. Soh, Columbia University College of Physicians and Surgeons, New York, NY) (42).

Cell Proliferation Assays—Cell proliferation assays using a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay system were performed as described in a previous study (43).

Chromatin Immunoprecipitation (ChIP) Assays—ChIP assays were performed essentially as described previously (44, 45). ChIP DNA was used as a template for PCR using DR5 RARE forward (5'-CAC TGC AGA AAC AGC CAG-3') and reverse (5'-CAT GGG CAG GCT GAT AAG-3') primers.

Flow Cytometric Analysis—Flow cytometric studies were performed as in our previous study (24). Briefly, NB-4 cells were treated with Me2SO or RA in the presence or absence of 1 µM rottlerin for 5 days, and cell differentiation was determined by staining with anti-CD11b monoclonal antibody. The anti-CD11b monoclonal antibody and a matched isotype control were purchased from Coulter Immunotech.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
We first determined whether treatment of cells with RA induces activation of PKC{delta} in the NB-4 acute promyelocytic leukemia cell line, which expresses the t(15;17) translocation. NB-4 cells were incubated in the presence or absence of RA for different times and subsequently lysed in phosphorylation lysis buffer. After cell lysis, total lysates were resolved by SDS-PAGE and immunoblotted with an antibody against PKC{delta} phosphorylated at Thr505. As shown in Fig. 1, RA treatment of NB-4 cells induced strong phosphorylation of PKC{delta}, which was time-dependent, with the intensity of the signal being strong at 12 h of RA treatment and gradually declining to base-line levels at 48–72 h (Fig. 1A). Stripping and reprobing the same blot demonstrated that equal amounts of PKC{delta} protein were detectable prior to and after RA treatment, indicating that RA treatment does not affect the levels of PKC{delta} protein expression (Fig. 1B). Similarly, phosphorylation of the PKC{delta} protein was inducible by in vitro treatment of primary leukemia cells, isolated from the peripheral blood of a patient with acute promyelocytic leukemia with the t(15;17) translocation (Fig. 1C). To directly determine whether the phosphorylation of PKC{delta} results in induction of its kinase activity, NB-4 cells were treated with RA; cell lysates were immunoprecipitated with anti-PKC{delta} antibody; and in vitro kinase assays were carried out on the immunoprecipitates using histone H1 as an exogenous substrate. PKC{delta} immunoprecipitated from lysates of cells treated with RA induced strong phosphorylation of histone H1 in the in vitro kinase assay (Fig. 1D), indicating that the catalytic activity of PKC{delta} is induced in an RA-dependent manner during its phosphorylation at Thr505.



View larger version (40K):
[in this window]
[in a new window]
  		FIG. 1.
RA induces phosphorylation and activation of PKC{delta} in acute promyelocytic leukemia cells. A, NB-4 cells were treated with RA (ATRA) for the indicated times. Equal amounts of total cell lysates were analyzed by SDS-PAGE and immunoblotted with an antibody against PKC{delta} phosphorylated at Thr505. B, the blot shown in A was stripped and reprobed with an antibody against PKC{delta}. C, isolated peripheral blood mononuclear cells, from a patient with acute promyelocytic leukemia, were incubated in the presence or absence of RA for the indicated times. The cells were lysed, and equal amounts of total cell lysates (100 µg/lane) were analyzed by SDS-PAGE and immunoblotted with an antibody against PKC{delta} phosphorylated at Thr505. D, NB-4 cells were incubated for 24 h in the presence or absence of 1 µM RA as indicated. Cell lysates were immunoprecipitated (IP) with anti-PKC{delta} antibody, and immunoprecipitates were subjected to an in vitro kinase assay using histone H1 as an exogenous substrate. Phosphorylated proteins were detected by autoradiography.

 

In subsequent studies, we sought to determine whether phosphorylation/activation of PKC{delta} occurs in other RA-sensitive cell lines. We performed experiments using the HL-60 acute myeloid leukemia and MCF-7 breast carcinoma cell lines, both of which are sensitive to the growth inhibitory effects of RA (23, 46–48). Treatment of HL-60 (Fig. 2, A and B) or MCF-7 (Fig. 2, C and D) cells with RA resulted in strong phosphorylation/activation of PKC{delta}, indicating that the RA-inducible activation of this serine kinase is not restricted to acute promyelocytic leukemia cells expressing the t(15;17) translocation, but also occurs in other RA-sensitive neoplastic cells.



View larger version (33K):
[in this window]
[in a new window]
  		FIG. 2.
RA-dependent phosphorylation of PKC{delta} in HL-60 and MCF-7 cells. A, HL-60 cells were incubated with RA (ATRA) for 48 h as indicated. Cell lysates were analyzed by SDS-PAGE and immunoblotted with an antibody against phosphorylated PKC{delta}. B, the blot shown in A was subsequently stripped and reprobed with anti-PKC{delta} antibody to control for loading. C, MCF-7 cells were incubated with RA for the indicated times. Cell lysates were analyzed by SDS-PAGE, and total lysates were immunoblotted with an antibody against phosphorylated PKC{delta}. D, the blot shown in C was stripped and reprobed with anti-PKC{delta} antibody to control for loading.

 

It is well established that retinoids induce their biological effects by regulating gene transcription for proteins that mediate cell differentiation, cell cycle arrest, and/or apoptosis of target neoplastic cells (15–17). Such RA-dependent gene transcription is regulated by binding of retinoid·retinoid receptor complexes to RAREs present in the promoters of sensitive genes (15–17). As our data demonstrated that PKC{delta} was activated during treatment of cells with RA, we sought to determine whether it plays a role in RA-dependent transcriptional regulation. We first examined whether H-7, a nonspecific pan-PKC inhibitor, inhibits RA-dependent gene transcription. We performed experiments in which MCF-7 cells were transfected with a plasmid containing an RARE-luciferase construct and treated with RA in the presence or absence of H-7. As shown in Fig. 3A, H-7 significantly abrogated RA-dependent RARE-mediated luciferase activity, suggesting that PKC activity is required for RA-dependent gene transcription. We subsequently determined whether rottlerin, a specific inhibitor of PKC{delta} (25, 33, 34, 49–51), exhibits negative regulatory effects on RA-inducible transcriptional activation. MCF-7 cells were transfected with the RARE-luciferase construct and treated with RA in the presence or absence of rottlerin or inhibitors that exhibit specificity toward other PKC isoforms, but do not inhibit PKC{delta}. The RA-dependent increase in RARE-dependent gene transcription was blocked when cells were pretreated with rottlerin (Fig. 3B). On the other hand, the Go 6976 inhibitor, which selectively inhibits PKC{alpha} (39), and the LY 379196 inhibitor, which selectively inhibits PKC{beta} (40), had no effects on RARE-dependent luciferase activity (Fig. 3B). Similarly, a PKC{zeta} pseudosubstrate (41) had no significant effects on transcriptional regulation via RAREs (Fig. 3B), further establishing the specificity of the process.



View larger version (12K):
[in this window]
[in a new window]
  		FIG. 3.
PKC{delta} is required for RA-dependent gene transcription via RAREs. A, MCF-7 cells were transfected with an RARE-luciferase construct. Forty-eight hours after transfection, the cells were preincubated for 60 min in the presence or absence of the pan-PKC inhibitor H-7 (50 µM). Subsequently, the cells were incubated overnight in the presence or absence of RA (1 µM), and luciferase activity was measured. Data are expressed as fold increase in response to RA treatment over control untreated samples for each condition. The means ± S.E. of three independent experiments for each panel are shown. B, MCF-7 cells were transfected with an RARE-luciferase construct. Forty-eight hours after transfection, the cells were preincubated for 60 min in the presence or absence of rottlerin, Go 6976, LY 379196, or a PKC{zeta} pseudosubstrate (PKCZ PS). Subsequently, the cells were incubated overnight in the presence or absence of RA (1 µM), and luciferase activity was measured. Data are expressed as fold increase in response to RA treatment over control untreated samples for each condition. The means ± S.E. of three independent experiments for each panel are shown.

 

Previous studies have established that Stat1 is up-regulated in an RA-dependent manner and that such up-regulation of Stat1 appears to be responsible for the induction of the synergistic effects that RA and interferons exhibit in malignant cells (52–55). As pharmacological inhibition of PKC{delta} blocked RARE-dependent gene transcription, we sought to determine whether such inhibition also blocks up-regulation of Stat1 protein expression by RA. NB-4 cells were incubated with RA for 24 or 48 h; the cells were lysed; and total cell lysates were analyzed by SDS-PAGE and immunoblotted with an antibody against Stat1 phosphorylated at Ser727 (Fig. 4A) or against Stat1 (Fig. 4B). Consistent with previous reports (50–53), significantly higher levels of Stat1 were detectable in RA-treated samples (Fig. 4B). Also, there was an increase in the level of Stat1 phosphorylated at Ser727 (Fig. 4A) (24), likely reflecting the increase in the levels of Stat1 protein induced by RA. Treatment of cells with rottlerin decreased the levels of RA-dependent, serine-phosphorylated Stat1 (Fig. 4A) as well as of total Stat1 protein (Fig. 4B). Thus, based on these findings, it is likely that PKC{delta} is required for the induction of RA-dependent expression of Stat1, suggesting that it plays a role in the induction of the synergistic effects of RA and interferons.



View larger version (23K):
[in this window]
[in a new window]
  		FIG. 4.
PKC{delta} is required for RA-dependent induction of Stat1 protein expression. A, NB-4 cells were incubated with RA (ATRA; 1 µM) in the presence or absence of the PKC{delta} inhibitor rottlerin for the indicated times. Equal amounts of total cell lysates (100 µg/lane) were analyzed by SDS-PAGE and immunoblotted with an antibody against Stat1 phosphorylated at Ser727 (anti-phospho-ser727-Stat1). B, NB-4 cells were treated with RA in the presence or absence of the PKC{delta} inhibitor rottlerin for the indicated times. Equal amounts of total cell lysates (100 µg/lane) were analyzed by SDS-PAGE and immunoblotted with an antibody against Stat1.

 

To definitively establish the role of PKC{delta} in RARE-dependent gene transcription, we determined whether overexpression of wild-type or constitutively active PKC{delta} enhances RA-dependent transcriptional regulation. MCF-7 cells were transfected with constructs for either wild-type PKC{delta} (pcDNA3-PKC{delta}-WT) (Fig. 5A) or constitutively active PKC{delta} (pcDNA3-PKC{delta}-CAT) (Fig. 5B) and the DR5 RARE-luciferase plasmid. The cells were subsequently incubated in the presence or absence of RA, and luciferase assays were performed. Overexpression of wild-type PKC{delta} resulted in substantial enhancement of RA-dependent gene transcription (Fig. 5A). Such an enhancement was abrogated when cells were treated with rottlerin, demonstrating the specificity of the process (Fig. 5A). On the other hand, overexpression of constitutively active PKC{delta} increased luciferase activity at the base line (prior to RA treatment) (Fig. 5B) and resulted in further enhancement of RA-dependent RARE-mediated gene transcription (Fig. 5B).



View larger version (17K):
[in this window]
[in a new window]
  		FIG. 5.
Enhancement of RA-dependent gene transcription via RAREs by overexpression of wild-type or constitutively active PKC{delta}. A, MCF-7 cells were transfected with an RARE-luciferase construct and either the empty pcDNA3 vector or the pcDNA3-PKC{delta}-WT construct (PKC-delta WT). Forty-eight hours after transfection, cells were treated for 60 min in the presence or absence of rottlerin. The cells were then incubated overnight with or without RA (1 µM) in the continuous presence or absence of rottlerin, and luciferase activity was measured. Data are expressed as relative luciferase units, normalized for {beta}-galactosidase activity. The means ± S.E. of two independent experiments in each panel are shown. B, MCF-7 cells were transfected with an RARE-luciferase construct and either the empty pcDNA3 vector or the pcDNA3-PKC{delta}-CAT construct. Forty-eight hours after transfection, the cells were treated with RA as indicated, and luciferase activity was measured. Data are expressed as relative luciferase units, normalized for {beta}-galactosidase activity. The means ± S.E. of two independent experiments for each panel are shown. DMSO, Me2SO.

 

As our data indicated a role for PKC{delta} in RA-mediated gene transcription and modulation of Stat1 protein expression, we sought to determine whether its function is essential for the induction of the synergistic effects of RA and IFN-{alpha}. We have previously shown that PKC{delta} is activated by the type I IFN receptor and that such activation is required for type I IFN-dependent gene transcription via INF-stimulated response or GAS elements (33). As RA up-regulates Stat1 expression in a PKC{delta}-dependent manner, we examined whether pretreatment of cells with RA enhances IFN-{alpha}-inducible gene transcription via GAS elements and, if so, whether PKC{delta} activity is required for such effects. MCF-7 cells were transiently transfected with the 8XGAS-luciferase construct and subsequently treated with IFN-{alpha} or a combination of IFN-{alpha} and RA. As expected, treatment of cells with IFN-{alpha} resulted in induction of GAS-driven luciferase activity (Fig. 6). Combined treatment of the cells with RA and IFN-{alpha} resulted in substantially higher levels of luciferase activity, whereas concomitant treatment of cells with rottlerin abrogated the IFN-{alpha} and RA synergistic effects (Fig. 6), strongly suggesting that PKC{delta} activity is required for the generation of such responses.



View larger version (10K):
[in this window]
[in a new window]
  		FIG. 6.
Pharmacological inhibition of PKC{delta} abrogates the synergistic effects of RA and IFN-{alpha} on gene transcription via GAS elements. MCF-7 cells were transfected with the 8XGAS-luciferase construct. Forty-eight hours after transfection, the cells were preincubated for 60 min in the presence or absence of rottlerin as indicated. Subsequently, the cells were incubated for 12 h in the presence or absence of RA with or without an additional treatment with IFN-{alpha} (IFNa; 5000 units/ml) for 6 h as indicated. The cells were subsequently lysed, and luciferase activity was measured. Data are expressed as relative luciferase units, normalized for {beta}-galactosidase activity. The means ± S.E. of two independent experiments are shown.

 

To further understand the mechanisms by which PKC{delta} regulates RA-dependent gene transcription, we examined whether, during RA stimulation, PKC{delta} associates with and forms complexes with other proteins that bind to RAREs. We performed gel shift assays using a double-stranded DR5 RARE oligonucleotide. As expected, treatment of NB-4 cells with RA resulted in the induction of several complexes that bound RAREs (Fig. 7A). Such complexes were competed by unlabeled oligonucleotide (Fig. 7A), demonstrating the specificity of the binding. Some of the bands detected in the gel shift assay were supershifted by anti-PKC{delta} antibody, but not by control nonimmune rabbit IgG, indicating that the PKC{delta} protein participates in the formation of RARE-binding regulatory complexes (Fig. 7A). As expected, the RA-dependent DNA-binding complexes were also supershifted by anti-RAR{alpha} antibody (Fig. 7B). Consistent with these findings, in studies using nuclear extracts from RA-treated NB-4 cells, we found that the PML-RAR{alpha} fusion protein was co-immunoprecipitated by anti-PKC{delta} antibody in an RA-dependent manner (Fig. 8, A and B). Most importantly, when ChIP assays were performed, we found that PKC{delta} was present in a complex that bound to RAREs in an RA-dependent manner in NB-4 cells (Fig. 9). These findings provide very strong evidence that PKC{delta} associates with RARs and likely modulates RA-dependent gene transcription via direct interaction with the RA·RAR{alpha} complex.



View larger version (41K):
[in this window]
[in a new window]
  		FIG. 7.
RA induces formation of PKC{delta}-containing DNA-binding complexes. A, nuclear extracts from untreated or RA (ATRA)-treated NB-4 cells were incubated with 32P-radiolabeled RARE synthetic oligonucleotide in the presence or absence of different amounts of unlabeled oligonucleotide (Cold-oligo) as indicated. Protein·DNA complexes were resolved by native gel electrophoresis and visualized by autoradiography. For supershift experiments, protein extracts were incubated with 2 µg of anti-PKC{delta} antibody or control nonimmune rabbit IgG (RIgG) as indicated. B, NB-4 cells were incubated in the presence or absence of RA for the indicated times. Nuclear cell extracts were incubated with 32P-radiolabeled RARE synthetic oligonucleotide. Protein·DNA complexes were resolved by native gel electrophoresis and visualized by autoradiography. For supershift experiments, 10 µg of anti-RAR{alpha} polyclonal antibody or control nonimmune rabbit IgG was incubated with nuclear extracts.

 


View larger version (16K):
[in this window]
[in a new window]
  		FIG. 8.
PKC{delta} associates with PML-RAR{alpha} in an RA-dependent manner. NB-4 cells were incubated in the presence or absence of RA (ATRA) for the indicated times. Nuclear extracts were subsequently obtained and immunoprecipitated (IP) with an antibody against PKC{delta} or control nonimmune rabbit IgG (RIgG) as indicated. The immunoprecipitated proteins were analyzed by SDS-PAGE and immunoblotted with an antibody against RAR{alpha} (A). The blot shown in A was stripped and reprobed with an antibody against PKC{delta} to control for loading (B).

 


View larger version (39K):
[in this window]
[in a new window]
  		FIG. 9.
ChIP analysis of PKC{delta} and RAR{alpha} in NB-4 cells. NB-4 cells were incubated in the presence or absence of RA for 4 h as indicated. Chromatin immunoprecipitations (IP) were performed with either anti-PKC{delta} or anti-RAR{alpha} antibody or control nonimmune rabbit IgG (RIgG) as indicated. The precipitated chromatin was analyzed using primers specific for the DR5 RARE sequence.

 

In further studies, we sought to examine the biological relevance of RA-dependent activation of PKC{delta} in cells of acute promyelocytic leukemia origin. We determined the effects of inhibition of the PKC{delta} pathway on the induction of RA-dependent cell differentiation of NB-4 cells using an approach that we employed in previous studies (24). Cells were treated with RA in the presence or absence of rottlerin, and the induction of differentiation was determined by staining the cells with anti-CD11b antibody, the expression of which is a marker for RA-induced myeloid differentiation to the granulocytic stage (24). As expected, RA treatment induced up-regulation of CD11b expression. Concomitant treatment with rottlerin partially reversed the RA-dependent CD11b expression (Fig. 10), indicating that PKC{delta} activity is essential for the induction of differentiation of NB-4 blast cells to granulocytes.



View larger version (28K):
[in this window]
[in a new window]
  		FIG. 10.
Inhibition of PKC{delta} activation reverses RA-dependent differentiation of NB-4 cells. NB-4 cells were incubated with RA for 5 days in the presence or absence of rottlerin as indicated. The cells were subsequently stained with fluorescein isothiocyanate-conjugated anti-CD11b antibody and analyzed by flow cytometry. Shaded areas indicate cells labeled with an isotype control. Open areas indicate cells labeled with anti-CD11b antibody. The percentage of cells positive for CD11b is indicated for each condition. DMSO, Me2SO.

 

In parallel studies, we examined whether pharmacological inhibition of PKC{delta} reverses the induction of the suppressive effects of RA on cell proliferation. NB-4 cells were incubated with RA in the presence or absence of rottlerin or pharmacological PKC inhibitors that selectively block activation of other isoforms. Consistent with previous reports (24), RA inhibited the growth of NB-4 cells in a dose-dependent manner. Such an inhibition was reversed by concomitant treatment of cells with rottlerin (Fig. 11). On the other hand, Go 6976 and LY 37916 had no significant effects, indicating that PKC{alpha} and PKC{beta} do not play a role in the generation of the growth inhibitory effects of RA in NB-4 cells (Fig. 11).



View larger version (19K):
[in this window]
[in a new window]
  		FIG. 11.
Pharmacological inhibition of PKC{delta} (but not of other PKC isoforms) reverses the growth inhibitory effects of RA on NB-4 cells. Cells were incubated with or without RA (ATRA) for 5 days in the presence or absence of the PKC{delta} inhibitor rottlerin (1 µM), the PKC{alpha} inhibitor Go 6976 (2.5 nM), or the PKC{beta} inhibitor LY 379196 (50 nM). Cell proliferation was assessed using a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay.

 


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
The PKC family of serine/threonine kinases includes several members that play important roles in signaling for various cytokine receptors in mammalian cells (25, 51, 55–58). The classification of distinct members of the PKC family in different isoform groups relies on the requirements that the different isoforms exhibit for activation of their kinase domains. One group includes PKC isoforms that require increases in intracellular calcium for their activation. The members of this group, which are also activated by the traditional PKC activators, the phorbol esters, are defined as the conventional PKC isoforms. The three known conventional PKC isoforms are PKC{alpha}, PKC{beta}, and PKC{gamma} (25, 51, 55–58). The second group of PKC isozymes is the group of novel PKC isoforms, which do not require Ca2+ for their activation, but are activated by phorbol esters (25, 51, 55–58). PKC{delta}, PKC{epsilon}, PKC{theta}, PKC{eta}, and PKCµ are included in this group. Finally, a third group of atypical PKC isoforms exists, whose members are Ca2+-independent and are insensitive to phorbol esters. PKC{zeta} and PKC{lambda} are the two known atypical PKC isoforms (25, 51, 55–58).

The different isoforms of the PKC family participate in signaling cascades for various cytokine and growth factor receptors. Extensive studies have shown that these kinases play critical roles in the regulation of several important cellular responses such as differentiation, cell growth, and apoptosis (25, 51, 55–58). It is of interest that different PKC isoforms mediate different responses and, in some cases, appear to exhibit opposing effects on cell proliferation and apoptosis. For instance, PKC{epsilon} exhibits oncogenic properties and promotes cell proliferation (59), whereas PKC{delta} mediates antiproliferative and pro-apoptotic signals (28, 59–65). Similarly, PKC{alpha} and PKC{delta} exhibit antagonistic effects on the transformation of cells by the epidermal growth factor receptor, with PKC{alpha} promoting epidermal growth factor-transforming activity and PKC{delta} inhibiting such a transformation and functioning as a tumor suppressor gene (64).

Our finding that PKC{delta} participates in the generation of RA responses and regulates induction of cell differentiation and antiproliferative effects is consistent with the previously described capacity of this PKC isoform to mediate growth-suppressive signals. It is of particular interest that this kinase is also activated by interferons and regulates IFN-dependent gene transcription via modulation of serine phosphorylation of Stat1 (33). Interferons are growth inhibitory cytokines that exhibit synergistic effects with retinoids in the generation of cell differentiation and growth suppression (66–70). It is noteworthy that RA not only augments the transcription of interferon-responsive genes, but also causes increased synthesis and secretion of IFN-{alpha} itself (54), raising the possibility of an autocrine loop mediating Stat1 activation. Our data indicate that, in addition to its involvement in the induction of RA-dependent responses, PKC{delta} is required for the generation of the synergistic effects of IFN-{alpha} and RA on gene transcription. Such regulatory effects on transcription via GAS elements are likely mediated by the RA-inducible, PKC{delta}-dependent up-regulation of Stat1 protein expression. Such effects, beyond mediating IFN-{alpha} and RA synergy, may be important for retinoic acid sensitivity, as a recent study demonstrated that, in certain cases, retinoic acid resistance is associated with lack of IFN-{alpha} synthesis and Stat1 induction (69).

Our data also establish that PKC{delta} is present in RA·RAR nuclear complexes that bind to RAREs. This is demonstrated by gel shift and supershift assays, co-immunoprecipitation experiments, and ChIP assays. Previous studies had implicated a PKC isoform in retinoic acid-dependent gene transcription, as evidenced by the fact that depletion of cellular PKC by prolonged treatment with 12-O-tetradecanoylphorbol-13-acetate leads to loss of ligand-dependent transcription (72). Such an effect could be directly linked to loss of DNA-binding activity of complexes containing RAR{alpha}, but the identity of the PKC isoform involved was unknown at the time (72). Other studies have demonstrated that PKC{alpha}- or PKC{gamma}-dependent phosphorylation of RAR{alpha} at Ser157 correlates with decreased ability of human RAR{alpha} to heterodimerize with human RXR{alpha}, resulting in decreased transcriptional activity (73). As other studies have established that different PKC isoforms have opposing effects in the induction of certain responses, it is possible that PKC{delta} acts as a positive modulator of RARE-dependent gene transcription and opposes the effects of PKC{alpha} and/or PKC{gamma}. A similar phenomenon appears to occur in the regulation of the RXRs in T-lymphocytes, in which case PKC{theta} synergizes with calcineurin to induce RXR-dependent activation, whereas such activation is antagonized by the PKC{alpha} isoform (74). Independent of the precise mechanisms involved, our findings provide strong evidence for a novel function of PKC{delta} in the induction of RA responses. Future studies should examine whether induction of PKC{delta} activity also occurs in response to other retinoids and whether other PKC isoforms antagonize the effects of PKC{delta} on RA-dependent transcriptional regulation.

At this time, the precise upstream regulatory events that ultimately result in PKC{delta} activation are not known. The phosphorylation/activation of PKC{delta} by RA may reflect engagement of an inside-out signaling loop following the formation of RA·RAR complexes or could be regulated by other early biochemical cellular events induced by RA. There is accumulating evidence that serine/threonine kinases regulate activation of RARs via modulation of their phosphorylation status; and recently, the phosphatidylinositol 3'-kinase pathway was shown to exhibit effects on the phosphorylation, degradation, and transcriptional activity of RAR{gamma}2 (75). Interestingly, retinoic acid-dependent neuronal tissue differentiation (76), as well as induction of expression and activation of tissue transglutaminase, is phosphatidylinositol 3'-kinase-dependent (77). Studies in other systems have also shown that PKC{delta} is activated down-stream of phosphatidylinositol 3'-kinase via the kinase PDK1 (71, 78). It is therefore possible that the RA-dependent pathway, which ultimately facilitates RARE-dependent transcription, involves sequential activation of a phosphatidylinositol 3'-kinase/PDK1/PKC{delta} cascade, but this hypothesis remains to be determined in future studies.


   FOOTNOTES
 
* This work was supported by a merit review grant from the Department of Veterans Affairs and National Institutes of Health Grants CA77816 and CA94079 (to L. C. P.) and by Canadian Institutes of Health Research Grant MOP15094 (to E. N. F.). S. K. is a recipient of a fellowship award from the Lauri Straus Leukemia Foundation. A. V. is a recipient of an ASCO Young Investigator Award. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

¶¶ To whom correspondence should be addressed: Robert H. Lurie Comprehensive Cancer Center, Northwestern University Medical School, 710 North Fairbanks Ave., Olson Pavilion 8250, Chicago, IL 60611. Tel.: 312-503-4267; Fax: 312-908-1372; E-mail: l-platanias{at}northwestern.edu.

1 The abbreviations used are: RA, all-trans-retinoic acid; RAR, retinoic acid receptor; RXR, retinoid X receptor; RARE, retinoic acid-responsive element; MAPK, mitogen-activated protein kinase; ERK, extracellular signal-regulated kinase; PKC, protein kinase C; Stat, signal transducer and activator of transcription; GAS, interferon-{gamma}-activated site; IFN, interferon; ChIP, chromatin immunoprecipitation; PDK1, phosphoinositide-dependent protein kinase 1. Back



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Castaigne, S., Chomienne, C., Daniel, M. T., Ballerini, P., Berger, R., Fenaux, P., and Degos, L. (1990) Blood 76, 1704–1709[Abstract/Free Full Text]
  2. Huang, M., Ye, Y., Chen, S., Chai, J., Lu, J., Zhoa, L., Gu, L., and Wang, Z. (1988) Blood 72, 567–572[Abstract/Free Full Text]
  3. Grignani, F., Fagioli, M., Alcalay, M., Longo, L., Pandolfi, P. P., Donti, E., Biondi, A., Lo Coco, F., Grignani, F., and Pelicci, P. G. (1994) Blood 83, 10–25[Free Full Text]
  4. Gaboli, M., Gandini, D., Delva, L., Wang, Z.-W., and Pandolfi, P. P. (1998) Leuk. Lymphoma 30, 11–22[Medline] [Order article via Infotrieve]
  5. Tallman, M. S., Nabhan, C., Feusner, J. H., and Rowe, J. M. (2002) Blood 99, 759–767[Abstract/Free Full Text]
  6. Lutz, P. G., Moog-Lutz, C., and Cayre, Y. E. (2002) Leukemia (Baltimore) 16, 1933–1999[CrossRef][Medline] [Order article via Infotrieve]
  7. Agadir, A., Chen, G., Bost, F., Li, Y., Mercola, D., and Zhang, X. (1999) J. Biol. Chem. 274, 29779–29785[Abstract/Free Full Text]
  8. Nicke, B., Kaiser, A., Wiedenmann, B., Riecken, E. O., and Rosewicz, S. (1999) Biochem. Biophys. Res. Commun. 261, 572–577[CrossRef][Medline] [Order article via Infotrieve]
  9. Brodowicz, T., Wiltschke, C., Kandioler-Eckersberger, D., Grunt, T. W., Rudas, M., Schneider, S. M., Hejna, M., Budinsky, A., and Zielinski, C. C. (1999) Br. J. Cancer 80, 1350–1358[CrossRef][Medline] [Order article via Infotrieve]
  10. Chen, Y. H., Lavelle, D., DeSimone, J., Uddin, S., Platanias, L. C., and Hankewych, M. (1999) Blood 94, 251–259[Abstract/Free Full Text]
  11. Xu, X. C., Liu, X., Tahara, E., Lippman, S. M., and Lotan, R. (1999) Cancer Res. 59, 2477–2483[Abstract/Free Full Text]
  12. Nagy, L., Thomazy, V. A., Heyman, R. A., and Davies, P. J. (1998) Cell Death Differ. 5, 11–19[Medline] [Order article via Infotrieve]
  13. Szondy, Z., Reichert, U., and Fesus, L. (1998) Cell Death Differ. 5, 4–10[Medline] [Order article via Infotrieve]
  14. Hsu, S. L., Chen, M. C., Chou, Y. H., Hwang, G. Y., and Yin, S. C. (1999) Exp. Cell Res. 248, 87–96[CrossRef][Medline] [Order article via Infotrieve]
  15. Chambon, P. (1994) Semin. Cell Biol. 5, 115–125[CrossRef][Medline] [Order article via Infotrieve]
  16. Kastner, P., Mark, M., and Chambon, P. (1995) Cell 83, 859–869[CrossRef][Medline] [Order article via Infotrieve]
  17. Kambhampati, S., and Platanias, L. C. (2003) Haema 6, 149–156
  18. Kamei, Y., Xu, L., Heinzel, T., Torchia, J., Kurokawa, R., Gloss, B., Lin, S.-C., Heyman, R. A., Rose, D. W., Glass, C. K., and Rosenfeld, M. G. (1996) Cell 85, 403–414[CrossRef][Medline] [Order article via Infotrieve]
  19. Chen, J. Y., Penco, S., Ostrowski, J., Balaguer, P., Pons, M., Starrett, J. E., Reczek, P., Chambon, P., and Gronemeyer, H. (1995) EMBO J. 14, 1187–1197[Medline] [Order article via Infotrieve]
  20. Nagy, L., Kao, H.-Y., Chakravarti, D., Lin, R. J., Hassig, C. A., Ayer, D. E., Schreiber, S. L., and Evans, R. M. (1997) Cell 89, 373–380[CrossRef][Medline] [Order article via Infotrieve]
  21. Han, G. R., Dohi, D. F., Lee, H.-Y., Rajah, R., Walsh, G. L., Hong, W. K., Cohen, P., and Kurie, J. M. (1997) J. Biol. Chem. 272, 13711–13716[Abstract/Free Full Text]
  22. Lee, H.-Y., Walsh, G. L., Dawson, M. I., Hong, W. K., and Kurie, J. M. (1998) J. Biol. Chem. 273, 7066–7071[Abstract/Free Full Text]
  23. Yen, A., Roberson, M. S., Varvayanis, S., and Lee, A. T. (1998) Cancer Res. 58, 3163–3172[Abstract/Free Full Text]
  24. Alsayed, Y., Uddin, S., Mahmud, N., Lekmine, F., Kalvakolanu, D., Minucci, S., Bokoch, G., and Platanias, L. C. (2001) J. Biol. Chem. 276, 4012–4019[Abstract/Free Full Text]
  25. Newton, A. C. (1997) Curr. Opin. Cell Biol. 9, 161–167[CrossRef][Medline] [Order article via Infotrieve]
  26. Kikkawa, U., Matsuzaki, H., and Yamamoto, T. (2002) J. Biochem. (Tokyo) 132, 831–839[Abstract/Free Full Text]
  27. Emoto, Y., Manome, Y., Meinhardt, G., Kisaki, H., Kharbanda, S., Robertson, M., Ghayur, T., Wong, W. W., Kamen, R., Weichselbaum, R., and Kufe, D. (1995) EMBO J. 14, 6148–6156[Medline] [Order article via Infotrieve]
  28. Denning, M. F., Wang, Y., Nickoloff, B. J., and Wrone-Smith, T. (1998) J. Biol. Chem. 273, 29995–30002[Abstract/Free Full Text]
  29. Ghayur, T., Hugunin, M., Talanian, R. V., Ratnofsky, S., Quinlan, C., Emoto, Y., Pandey, P., Datta, R., Kharbanda, S., Allen, J., Kamen, R., Wong, W., and Kufe, D. (1996) J. Exp. Med. 184, 2399–2404[Abstract/Free Full Text]
  30. Platanias, L. C., and Sweet, M. E. (1994) J. Biol. Chem. 269, 3143–3146[Abstract/Free Full Text]
  31. Yetter, A., Uddin, S., Krolewski, J. J., Jiao, H., Yi, T., and Platanias, L. C. (1995) J. Biol. Chem. 270, 18179–18182[Abstract/Free Full Text]
  32. Uddin, S., Chamdin, A., and Platanias, L. C. (1995) J. Biol. Chem. 270, 24627–24630[Abstract/Free Full Text]
  33. Uddin, S., Sassano, A., Deb, D. K., Verma, A., Majchrzak, B., Rahman, A., Malik, A. B., Fish, E. N., and Platanias, L. C. (2002) J. Biol. Chem. 277, 14408–14416[Abstract/Free Full Text]
  34. Rahman, A., Anwar, K. N., Uddin, S., Xu, N., Ye, R., Platanias, L. C., and Malik, A. B. (2001) Mol. Cell. Biol. 21, 5554–5565[Abstract/Free Full Text]
  35. Fish, E. N., Uddin, S., Korkmaz, M., Majchrzak, B., Druker, B. J., and Platanias, L. C. (1999) J. Biol. Chem. 274, 571–573[Abstract/Free Full Text]
  36. Uddin, S., Majchrzak, B., Woodson, J. Arunkumar, P., Alsayed, Y., Pine, R., Young, P. R., Fish, E. N., and Platanias, L. C. (1999) J. Biol. Chem. 274, 30127–30131[Abstract/Free Full Text]
  37. Uddin, S., Lekmine, F., Sharma, N., Majchrzak, B., Mayer, I., Young, P. R., Bokoch, G. M., Fish, E. N., and Platanias, L. C. (2000) J. Biol. Chem. 275, 27634–27640[Abstract/Free Full Text]
  38. Minnucci, S., Zand, D. J., Dey, A., Marks, M. S., Nagata, T., Grippo, J. F., and Ozato, K. (1994) Mol. Cell. Biol. 14, 360–372[Abstract/Free Full Text]
  39. Martiny-Baron, G., Kazanietz, M. G., Mischak, H., Blumberg, P. M., Kochs, G., Hug, H., Marme, D., and Schachtele, C. (1993) J. Biol. Chem. 268, 9194–9197[Abstract/Free Full Text]
  40. Slosberg, E. D., Yao, Y., Xing, F., Ikui, A., Jirousek, M. R., and Weinstein, I. B. (2000) Mol. Carcinog. 27, 166–176[CrossRef][Medline] [Order article via Infotrieve]
  41. Standaert, M. L., Galloway, L., Karnam, P., Bandyopadhyay, G., Moscat, J., and Farese, R. V. (1997) J. Biol. Chem. 272, 30075–30082[Abstract/Free Full Text]
  42. Soh, J.-W., Lee, E. H., Prywes, R., and Weinstein, I. B. (1999) Mol. Cell. Biol. 19, 1313–1324[Abstract/Free Full Text]
  43. Mayer, I. A., Verma, A., Grumbach, I. M., Uddin, S., Lekmine, F., Ravandi, F., Majchrzak, B., Fujita, S., Fish, E. N., and Platanias, L. C. (2001) J. Biol. Chem. 276, 28570–28577[Abstract/Free Full Text]
  44. Chen, H., Lin, R. J., Xie, W., Wilpitz, D., and Evans, R. M. (1999) Cell 98, 675–686[CrossRef][Medline] [Order article via Infotrieve]
  45. Khanna-Gupta, A., Zibello, T., Sun, H., Gaines, P., and Berliner, N. (2003) Blood 101, 3460–3468
  46. Van der Leede, B. M., Van den Brink, C. E., Pijnappel, W. W., Sonneveld, E., Van der Saag, P. T., and Van der Burg, B. (1997) J. Biol. Chem. 272, 17921–17928[Abstract/Free Full Text]
  47. Mangiarotti, R., Danova, M., Alberici, R., and Pellicciari, C. (1998) Br. J. Cancer 77, 186–191[Medline] [Order article via Infotrieve]
  48. Van Heusden, J., Wouters, W., Ramaeckers, F. C., Krekels, M. D., Dillen, L., Borgers, M., and Smets, G. (1998) Br. J. Cancer 77, 1229–1235[Medline] [Order article via Infotrieve]
  49. Jain, N., Zhang, T., Kee, W. H., Li, W., and Cao, X. (1999) J. Biol. Chem. 274, 24392–24400[Abstract/Free Full Text]
  50. Gschwendt, M., Muller, H. J., Kielbassa, K., Zang, R., Kittstein, W., Rincke, G., and Marks, F. (1994) Biochem. Biophys. Res. Commun. 199, 93–98[CrossRef][Medline] [Order article via Infotrieve]
  51. Mellor, H., and Parker, P. J. (1998) Biochem. J. 332, 281–292[Medline] [Order article via Infotrieve]
  52. Kolla, V., Lindner, D. J., Weihua, X., Borden, E. C., and Kalvakolanu, D. V. (1996) J. Biol. Chem. 271, 10508–10514[Abstract/Free Full Text]
  53. Weihua, X., Kolla, V., and Kalvakolanu, D. V. (1997) J. Biol. Chem. 272, 9742–9748[Abstract/Free Full Text]
  54. Gianni, M., Terao, M., Fortino, I., LiCalzi, M., Viggiano, V., Barbui, T., Rambaldi, A., and Garattini, E. (1997) Blood 89, 1001–1012[Abstract/Free Full Text]
  55. Matikainen, S., Ronni, T., Lehtonen, A., Sareneva, T., Melen, K., Nordling, S., Levy, D. E., and Julkunen, I. (1997) Cell Growth Differ. 8, 687–698[Abstract]
  56. Schnaper, H. W. (2000) Pediatr. Nephrol. 14, 254–258[CrossRef][Medline] [Order article via Infotrieve]
  57. Malhotra, A., Kang, B. P., Opawumi, D., Belizaire, W., and Meggs, L. G. (2001) Mol. Cell. Biochem. 225, 97–107[CrossRef][Medline] [Order article via Infotrieve]
  58. Ventura, C., and Maioli, M. (2001) Crit. Rev. Eukaryotic Gene Expression 11, 243–247[Medline] [Order article via Infotrieve]
  59. Mischak, H., Goodnight, J., Kolch, W., Martiny-Baron, G., Schaechtle, C., Kazanietz, M. G., Blumberg, P. M., Pierce, J. H., and Mushinski, J. F. (1993) J. Biol. Chem. 268, 6090–6096[Abstract/Free Full Text]
  60. Lu, Z., Hornia, A., Jiang, Y.-W., Zang, Q., Ohno, S., and Foster, D. A. (1997) Mol. Cell. Biol. 17, 3418–3428[Abstract]
  61. Reddig, P. J., Dreckschmidt, N. E., Ahrens, H., Simsiman, R., Tseng, C. P., Zou, J., Oberley, T. D., and Verma, A. K. (1999) Cancer Res. 59, 5710–5718[Abstract/Free Full Text]
  62. Konishi, H., Matsuraki, H., Takaishi, H., Yamamoto, T., Tukunaga, M., Ono, Y., and Kikkawa, U. (1999) Biochem. Biophys. Res. Commun. 264, 840–846[CrossRef][Medline] [Order article via Infotrieve]
  63. Fuji, T., Garcia-Bermejo, M. L., Bernabo, J. L., Caamano, J., Ohba, M., Kuroki, T., Li, L., Yuspa, S. H., and Kazanietz, M. G. (2000) J. Biol. Chem. 275, 7574–7582[Abstract/Free Full Text]
  64. Hornia, A., Lu, Z., Sukezane, T., Zhong, M., Joseph, T., Frankel, P., and Foster, D. A. (1999) Mol. Cell. Biol. 19, 7672–7680[Abstract/Free Full Text]
  65. Perletti, G. P., Marras, E., Concari, P., Piccinni, F., and Tashjian, A. H., Jr. (1999) Oncogene 18, 1251–1256[CrossRef][Medline] [Order article via Infotrieve]
  66. Guzhova, I., Hultquist, A., Cetinkaya, C., Nilsson, K., Pahlman, S., and Larsson, L. G. (2001) Int. J. Cancer 94, 97–108[CrossRef][Medline] [Order article via Infotrieve]
  67. Yokoyama, M., Nakao, Y., Iwasaka, T., Pater, A., and Sugimori, H. (2001) Obstet. Gynecol. 98, 332–340[CrossRef][Medline] [Order article via Infotrieve]
  68. Chelbi-Alix, M. K., and Pelicano, L. (1999) Leukemia (Baltimore) 13, 1167–1174[CrossRef][Medline] [Order article via Infotrieve]
  69. Pelicano, L., Brumpt, C., Pitha, P. M., and Chelbi-Alix, M. K. (1999) Oncogene 18, 3944–3953[CrossRef][Medline] [Order article via Infotrieve]
  70. Moore, D. M., Kalvakolanu, D. V., Lippman, S. M., Kavanagh, J. J., Hong, W. K., Borden, E. C., Paredes-Espinoza, M., and Krakoff, I. H. (1994) Semin. Hematol. 31, 31–37[Medline] [Order article via Infotrieve]
  71. Balendran, A., Hare, G. R., Kieloch, A., Williams, M. R., and Alessi, D. R. (2000) FEBS Lett. 484, 217–223[CrossRef][Medline] [Order article via Infotrieve]
  72. Tahayato, A., Lefebvre, P., Formstecher, P., and Dautrevaux, M. (1993) Mol. Endocrinol. 7, 1642–1653[Abstract/Free Full Text]
  73. Delmotte, M.-H., Tahayato, A., Formstecher, P., and Lefebvre, P. (1999) J. Biol. Chem. 274, 38225–38231[Abstract/Free Full Text]
  74. Ishaq, M., Fan, M., Wingmore, K., Gaddam, A., and Natarajan, V. (2002) J. Immunol. 169, 732–738[Abstract/Free Full Text]
  75. Gianni, M., Kopf, E., Bastien, J., Oulad-Abdelghani, M., Garattini, E., Chambon, P., and Rochette-Egly, C. (2002) J. Biol. Chem. 277, 24859–24862[Abstract/Free Full Text]
  76. Lopez-Carballo, G., Moreno, L., Masia, S., Perez, P., and Barettino, D. (2002) J. Biol. Chem. 277, 25297–25304[Abstract/Free Full Text]
  77. Antonyak, M. A., Boehm, J. E., and Cerione, R. A. (2002) J. Biol. Chem. 277, 14712–14716[Abstract/Free Full Text]
  78. LeGood, J. A., Ziegler, W. H., Parekh, D. B., Alessi, D. R., Cohen, P., and Parker, P. J. (1998) Science 281, 2042–2045[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Clin. Endocrinol. Metab.Home page
T. Kogai, E. Ohashi, M. S. Jacobs, S. Sajid-Crockett, M. L. Fisher, Y. Kanamoto, and G. A. Brent
Retinoic Acid Stimulation of the Sodium/Iodide Symporter in MCF-7 Breast Cancer Cells Is Meditated by the Insulin Growth Factor-I/Phosphatidylinositol 3-Kinase and p38 Mitogen-Activated Protein Kinase Signaling Pathways
J. Clin. Endocrinol. Metab., May 1, 2008; 93(5): 1884 - 1892.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
R. Alzamora, L. R. Brown, and B. J. Harvey
Direct Binding and Activation of Protein Kinase C Isoforms by Aldosterone and 17{beta}-Estradiol
Mol. Endocrinol., November 1, 2007; 21(11): 2637 - 2650.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Endocrinol.Home page
S. Masia, S. Alvarez, A. R. de Lera, and D. Barettino
Rapid, Nongenomic Actions of Retinoic Acid on Phosphatidylinositol-3-Kinase Signaling Pathway Mediated by the Retinoic Acid Receptor
Mol. Endocrinol., October 1, 2007; 21(10): 2391 - 2402.
[Abstract] [Full Text] [PDF]

Home page
 J. Leukoc. Biol.Home page
M. Rizzi, M. P. Tschan, C. Britschgi, A. Britschgi, B. Hugli, T. J. Grob, N. Leupin, B. U. Mueller, H.-U. Simon, A. Ziemiecki, et al.
The death-associated protein kinase 2 is up-regulated during normal myeloid differentiation and enhances neutrophil maturation in myeloid leukemic cells
J. Leukoc. Biol., June 1, 2007; 81(6): 1599 - 1608.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
A. Sassano, E. Katsoulidis, G. Antico, J. K. Altman, A. J. Redig, S. Minucci, M. S. Tallman, and L. C. Platanias
Suppressive Effects of Statins on Acute Promyelocytic Leukemia Cells
Cancer Res., May 1, 2007; 67(9): 4524 - 4532.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
Y. Chen, M. Dokmanovic, W. D. Stein, R. J. Ardecky, and I. B. Roninson
Agonist and Antagonist of Retinoic Acid Receptors Cause Similar Changes in Gene Expression and Induce Senescence-like Growth Arrest in MCF-7 Breast Carcinoma Cells.
Cancer Res., September 1, 2006; 66(17): 8749 - 8761.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Biol. CellHome page
S. Aggarwal, S.-W. Kim, K. Cheon, F. H. Tabassam, J.-H. Yoon, and J. S. Koo
Nonclassical Action of Retinoic Acid on the Activation of the cAMP Response Element-binding Protein in Normal Human Bronchial Epithelial Cells
Mol. Biol. Cell, February 1, 2006; 17(2): 566 - 575.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
K.-W. Zhao, D. Li, Q. Zhao, Y. Huang, R. H. Silverman, P. J. Sims, and G.-Q. Chen
Interferon-{alpha}-induced Expression of Phospholipid Scramblase 1 through STAT1 Requires the Sequential Activation of Protein Kinase C{delta} and JNK
J. Biol. Chem., December 30, 2005; 280(52): 42707 - 42714.
[Abstract] [Full Text] [PDF]

Home page
 Circ. Res.Home page
P. Chaudhuri, S. M. Colles, P. L. Fox, and L. M. Graham
Protein Kinase C{delta}-Dependent Phosphorylation of Syndecan-4 Regulates Cell Migration
Circ. Res., September 30, 2005; 97(7): 674 - 681.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
P. Hampson, H. Chahal, F. Khanim, R. Hayden, A. Mulder, L. K. Assi, C. M. Bunce, and J. M. Lord
PEP005, a selective small-molecule activator of protein kinase C, has potent antileukemic activity mediated via the delta isoform of PKC
Blood, August 15, 2005; 106(4): 1362 - 1368.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
J. B. Barry and V. Giguere
Epidermal Growth Factor-Induced Signaling in Breast Cancer Cells Results in Selective Target Gene Activation by Orphan Nuclear Receptor Estrogen-Related Receptor {alpha}
Cancer Res., July 15, 2005; 65(14): 6120 - 6129.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
S. Murugappan, H. Shankar, S. Bhamidipati, R. T. Dorsam, J. Jin, and S. P. Kunapuli
Molecular mechanism and functional implications of thrombin-mediated tyrosine phosphorylation of PKC{delta} in platelets
Blood, July 15, 2005; 106(2): 550 - 557.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
P. Tanmahasamut and N. Sidell
Up-Regulation of Gap Junctional Intercellular Communication and Connexin43 Expression by Retinoic Acid in Human Endometrial Stromal Cells
J. Clin. Endocrinol. Metab., July 1, 2005; 90(7): 4151 - 4156.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
Y. Li, S. Batra, A. Sassano, B. Majchrzak, D. E. Levy, M. Gaestel, E. N. Fish, R. J. Davis, and L. C. Platanias
Activation of Mitogen-activated Protein Kinase Kinase (MKK) 3 and MKK6 by Type I Interferons
J. Biol. Chem., March 18, 2005; 280(11): 10001 - 10010.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
L. Lal, Y. Li, J. Smith, A. Sassano, S. Uddin, S. Parmar, M. S. Tallman, S. Minucci, N. Hay, and L. C. Platanias
Activation of the p70 S6 kinase by all-trans-retinoic acid in acute promyelocytic leukemia cells
Blood, February 15, 2005; 105(4): 1669 - 1677.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
K.-W. Zhao, X. Li, Q. Zhao, Y. Huang, D. Li, Z.-G. Peng, W.-Z. Shen, J. Zhao, Q. Zhou, Z. Chen, et al.
Protein kinase C{delta} mediates retinoic acid and phorbol myristate acetate-induced phospholipid scramblase 1 gene expression: its role in leukemic cell differentiation
Blood, December 1, 2004; 104(12): 3731 - 3738.
[Abstract] [Full Text] [PDF]

Home page
 FASEB J.Home page
D. N. JACKSON and D. A. FOSTER
The enigmatic protein kinase C{delta}: complex roles in cell proliferation and survival
FASEB J, April 1, 2004; 18(6): 627 - 636.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
S. Murugappan, F. Tuluc, R. T. Dorsam, H. Shankar, and S. P. Kunapuli
Differential Role of Protein Kinase C{delta} Isoform in Agonist-induced Dense Granule Secretion in Human Platelets
J. Biol. Chem., January 23, 2004; 279(4): 2360 - 2367.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
Y. Li, A. Sassano, B. Majchrzak, D. K. Deb, D. E. Levy, M. Gaestel, A. R. Nebreda, E. N. Fish, and L. C. Platanias
Role of p38{alpha} Map Kinase in Type I Interferon Signaling
J. Biol. Chem., January 9, 2004; 279(2): 970 - 979.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/35/32544    most recent
M301523200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kambhampati, S.
Right arrow Articles by Platanias, L. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kambhampati, S.
Right arrow Articles by Platanias, L. C.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement