Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M305456200 on June 18, 2003

J. Biol. Chem., Vol. 278, Issue 35, 32899-32904, August 29, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/35/32899    most recent
M305456200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, J.
Right arrow Articles by Steiner, D. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, J.
Right arrow Articles by Steiner, D. F.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Regulation of Proglucagon Transcription by Activated Transcription Factor (ATF) 3 and a Novel Isoform, ATF3b, through the cAMP-response Element/ATF Site of the Proglucagon Gene Promoter*

Jie Wang {ddagger}, Yun Cao § and Donald F. Steiner {ddagger} § 

From the {ddagger}Department of Biochemistry and Molecular Biology and the §Howard Hughes Medical Institute, University of Chicago, Chicago, Illinois 60637

Received for publication, May 23, 2003 , and in revised form, June 16, 2003.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Glucagon, the second major glucose-regulated hormone in the control of glucose homeostasis, functions as a counter-regulator to insulin and is specifically produced by the pancreatic {alpha} cells. Its excessive biosynthesis and secretion is associated with diabetes mellitus. The expression of the proglucagon gene has been demonstrated to be regulated by a cAMP-dependent pathway through cAMP-response element-binding protein (CREB) and possibly other transcription factors bound to its cAMP-response element (CRE)/activated transcription factor (ATF) site. Elsewhere we have shown that ATF3, a member of the ATF/CREB subfamily of the basic leucine zipper domain proteins, is expressed predominantly in the {alpha} cells of the pancreatic islets. In our attempts to further dissect the role of ATF3 proteins in {alpha} cells, we have identified and characterized a novel alternatively spliced form, ATF3b, and have compared the specific binding ability of ATF3 and ATF3b on the CRE/ATF motif of the proglucagon promoter. Our findings indicate the existence of a novel mechanism by which the transcription of the proglucagon gene is regulated in response to cAMP signals, in addition to CREB and in relation to glucose fluctuations in pancreatic {alpha} cells.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Glucagon, the second major hormone in the control of glucose homeostasis, acts as a counterregulator to insulin (1). It is synthesized mainly in the pancreatic {alpha} cells in most species. However, proglucagon mRNA is also expressed in the enteroendocrine L cells, where it gives rise to GLP1 and -2, and also in some neurones in the central nervous system (2). Its excessive production and secretion is associated with poorly controlled diabetes mellitus (3). Toward understanding the regulation of glucagon biosynthesis, it has been demonstrated that proglucagon gene expression is regulated by a cAMP-dependent pathway (4–8) through a cAMP-response element (CRE)1 site bound by one of the bZip proteins, CREB (4, 9), and possibly other factors (4). Moreover, in contrast to the up-regulation of insulin mRNA levels by glucose (10), only minor changes in proglucagon mRNA levels occur in response to glucose in cultured islets; the levels tend to increase during culture irrespective of the glucose concentration (11). In vivo it is increased during prolonged fasting (12). The increase or attenuated decrease of proglucagon mRNA at lower glucose concentrations may be a physiological feature of {alpha} cells that supports glucagon secretion at low glucose levels. However, the underlying mechanism is unclear.

ATF3 is a member of the ATF/CREB subfamily of bZip domain proteins (13). It functions by binding to ATF/CRE sites (TGACGTCA, identical to the CRE) or the related activated protein-1 site in DNA (13, 14). Murine ATF3, initially designated as LRG-21 (homologous to rat liver-regenerating factor LRF-1), is composed of 181 aa and contains a bZip domain (residues 88–142) for homo/heterodimer formation and specific DNA binding (15). The aa sequence homology of mouse ATF3 to the rat or human proteins is 99 and 98%, respectively (15). Two C-terminal truncated isoforms, ATF3{Delta}Zip and ATF3{Delta}Zip2, which lack the leucine zipper domain, have been isolated from human tissue. These fail to bind to the ATF/CRE sites (16, 17). The corresponding isoforms have not yet been described in rodents.

ATF3 expression is relatively low in most cell types under normal conditions but is strongly induced in response to many environmental changes as an immediate early response gene (18). It appears to function in the regulation of the cellular stress response and in cell proliferation by forming homo- and selective heterodimers with certain other bZip proteins (13, 18). ATF-3 has been implicated in regulating several genes (16, 19–24) including PEPCK (25), that influence glucose homeostasis in transgenic mice (26). Recently, it has been found to be expressed predominantly in {alpha} cells within islets.2 Because the CRE/ATF site of the proglucagon gene promoter has been suggested to be bound by other proteins besides CREB (4), we have further explored the possibility of proglucagon gene expression regulated by ATF3 in {alpha} cells. In the present study, we have characterized a novel alternative spliced isoform, ATF3b, compared the specific binding ability of ATF3b with that of ATF3 to the CRE/ATF site, and further have demonstrated a novel mechanism by which proglucagon gene expression in pancreatic {alpha} cells is regulated by glucose and in response to cAMP signals.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Cell Culture, Islet Isolation, RNA Preparation—{alpha}TC1.6 and NIH3T3 cells were grown in 10% fetal calf serum/Dulbecco's modified Eagle's medium (Invitrogen) as described (28, 29). Islet isolation and RNA preparation were described previously (30).

Molecular Cloning of ATF3b cDNA—cDNA synthesized by reverse transcription from {alpha}TC1.6 total RNA (1 µg) was subjected to PCR as described previously (30) using primer pairs (from 5' to 3') for cloning the coding sequence of ATF3: GGTGGAATTCGAGCGAAGACTGGAGCAAAA (sense) and AACCTCGAGGTGGGGTGGAAAAGGAGGA (antisense). The products (the expected band and a smaller one) were subcloned into the EcoRI-XhoI sites of the pcDNA3.1 (+) expression vector (Invitrogen). The sequences were determined using an ABI PRISM sequencing kit and compared with the reported ATF3 cDNA and genomic gene sequences. The nucleotide sequence of the cDNA of a novel isoform, ATF3b, has been deposited in GenBankTM accession number (pending).

RT-PCR, Northern and Western Blotting—These procedures were carried out as described previously (31). Using the same primers as described above, total RNA (1 µg) from {alpha}TC1.6 and islets was subjected to RT-PCR. 10 µg of total RNA was used for Northern blotting. For Western blotting, whole-cells proteins (50 µg/lane) were separated by Laemmli or Tricine SDS-PAGE and transferred onto an Immobilon-P or -PSQ membrane (Millipore). Antibodies against the C-terminal region of ATF3 (Santa Cruz Biotechnology, Santa Cruz, CA) and tubulin (Sigma) were purchased commercially.

In Vitro Synthesis, Immunoprecipitation, and N-terminal Sequencing of ATF3b Protein—Labeled ATF3 and ATF3b proteins were synthesized using the TnT-coupled transcription/translation system (Promega) with the plasmids constructed as described above in a mixture containing [35S]methionine or [3H]leucine (Amersham Biosciences). For immunoprecipitation with rabbit anti-ATF3 serum, the [35S]- or [3H]-labeled ATF3b protein was diluted in 0.5x TBST buffer (10 mM Tris, 70 mM NaCl, 0.05% Tween 20, pH 7.4) with protease inhibitors (Roche Applied Science). Immunoprecipitation and PAGE analysis was carried out as described previously (31). For the N-terminal sequencing of ATF3b, the [3H]-labeled ATF3b protein immunoprecipitates were separated on a 16.5% Tricine gel and transferred onto an Immobilon-PSQ membrane. The membrane-bound ATF3b protein band was excised and subjected to N-terminal Edman degradation. Tritium radioactivity of aa fractions released on each cycle was counted in a liquid scintillation counter.

EMSA (Electrophoretic Mobility Shift Assay)—ATF3 and ATF3b proteins were synthesized in vitro as described above. DNA probes (normal, 5'-AGGCTCATTTGACGTCAAAATTCAC-3'; mutant, 5'-AGGCTCATTTGTGGTCAAAATTCAC-3') were derived from the region containing the CRE/ATF site (underlined) of the mouse proglucagon promoter and labeled with [{gamma}-32P]ATP. DNA binding reactions were carried out as follow: aliquots of in vitro translation mixture were incubated in 20 µl of binding buffer (10 mM HEPES-KOH, pH 7.9, 50 mM KCl, 0.1 mM EDTA, 0.25 mM dithiothreitol, and 10% glycerol) containing 2 µg of poly(dI-dC) (Sigma) and 6–20 x 103 counts per minute of DNA probe at room temperature for 10 min. For supershift assays, 0.2 µg of IgG of rabbit anti-ATF3 or control serum was added and the samples incubated for another 10 min. The binding mixture was then applied onto a 5% polyacrylamide gel (0.5x Tris borate-EDTA buffer) for electrophoresis (25).

Transient Transfection and Luciferase Activity Assay—A cDNA containing the mouse proglucagon promoter (1453 bp) was obtained by PCR with Pfu DNA polymerase (Stratagene) using the primers of GluP5SacI (5'-GTTGAGCTCTGCCAAGAGCTGTCCTT-3') and Glup3NheI (5'-GTTGCTAGCCCTTCTGCACCAGGGTGCT-3'). The promoter harboring the mutant CRE/ATF site was obtained by two steps of PCR: (a) PCR was performed using two sets of primers, the GluP5SacI and GlumP3 (5'-GTGAATTTTGACCACAAATGAGCCTAGTCT-3'), GlumP5 (5'-GGCTCATTTGTGGTCAAAATTCACTTGAG-3') and the Glup3NheI; (b) the template obtained by combining the diluted PCR products from the first step (a) was subjected to PCR again with the GluP5SacI and Glup3NheI primers. The products were then cloned into the SacI/NheI sites of pGL3 basic plasmid (Promega), and the mutant site was confirmed by sequencing. The reporter plasmid (1.0 µg) driven by the proglucagon promoter (normal or mutant) was transfected into {alpha}TC1.6 or NIH3T3 cells (3.5-cm well) with effector DNA, 0.5 µg of pcDNA3.1-ATF3, pcDNA3.1-ATF3b, and pCMV-SPORT6 CREB-327 (IMAGE clone; Invitrogen), using LipofectAMINE (Invitrogen). At 24 h after transfection, cells were incubated with media containing 20 µM forskolin/100 µM IBMX (Sigma). Cells were harvested 48 h post-transfection, and luciferase activity was assayed using the dual-luciferase reporter assay system (Promega). For each transfection, 50 ng of Renilla luciferase reporter pRL-TK was included to normalize transfection efficiency. All transfection experiments were performed at least in duplicate.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Cloning and Characterization of a Novel Isoform of ATF3b—In the course of cloning the coding sequence of ATF3 using a pair of primers described under "Materials and Methods," we observed a band of 517 bp in addition to the expected 623-bp band representing ATF3 in both {alpha}TC1.6 cells as well as the islets of PC2 null mice (32) and littermate mice (Fig. 2A). Sequencing of the 517-bp cDNA (named ATF3b) reveals that it lacks 106 nucleotides beginning from position 25 of the ATF3 coding sequence. The deleted 106 nucleotides constitute an intron-like DNA fragment (33) that is located in the corresponding exon 2 of the ATF3 gene (Fig. 1A). This deletion generates a novel stop codon at a site corresponding to aa residue position 10 of the ATF3 protein; the novel isoform, ATF3b, then initiates from a downstream in-frame ATG (Fig. 1B). The predicted ATF3b protein (124 aa) is an N-terminal-truncated form lacking the initial 57 aa of ATF3 but preserving the intact bZip domain (Fig. 1, B and C) that is absent in the ATF3{Delta}Zip and ATF3{Delta}Zip2 isoforms.



View larger version (28K):
[in this window]
[in a new window]
  		FIG. 2.
Expression of ATF and ATF3b in {alpha}TC1.6 cells and islets. A, RT-PCR. Lane 1, {alpha}TC1.6; lane 2, control littermate islets; lane 3, PC2 null islets; lane 4, 100-bp DNA ladder (BioLabs). ATF3 and ATF3b, 623 and 517 bp (after cleavage with EcoRI/XhoI). B, Western blot with anti-ATF3 serum; 50 µg of whole protein from {alpha}TC1.6 cells cultured for 24 h at 2.5 mM (lane 1) and 25 mM glucose conditions; ATF3, upper band; ATF3b, lower band. C, using the ATF3 C-terminal-specific antiserum, ATF3b protein (lane 2) was immunoprecipitated from the in vitro translation mixture with [35S]methionine by using pcDNA3.1-ATF3b cDNA, but not from the water control (lane 1). D, tritium radioactivity of amino acid fractions collected from protein sequencer; the ATF3b protein was synthesized in vitro with [3H]leucine. Numbers indicate the cycle of Edman degradation.

 


View larger version (58K):
[in this window]
[in a new window]
  		FIG. 1.
Structure of ATF3 and alternatively spliced isoform, ATF3b. A, ATF3 mRNA missing an intron-like fragment of 106 bp (underlined) that is located in exon 2 of the ATF3 gene (GenBankTM No. NT_039189 [GenBank] .1). The initial ATG for the translation of the ATF3b protein is double-underlined. B, the predicted protein sequence of ATF3b; the basic and leucine zipper domains are underlined and double-underlined, respectively. C, schematic of domain structure of ATF3 and ATF3b proteins.

 

Using an antibody specific for the C-terminal region of ATF3, but not that of ATF3{Delta}Zip and ATF3{Delta}Zip2 (17), both ATF3 (upper band) and ATF3b (lower band) were detected in {alpha}TC1.6 cells, and both were down-regulated by glucose (Fig. 2B). These bands were also detected in whole pancreas homogenate (data not shown). Moreover, the ATF3b protein could be immunoprecipitated from products translated in vitro using an ATF3 C-terminal-specific antiserum (Fig. 2C); additionally, this protein contained the predicted leucine residue at position 5 as determined by N-terminal sequence analysis (Fig. 2D). These data thus confirm the expression of both ATF3b mRNA and protein in pancreatic {alpha} cells in concert with ATF3.

The DNA Binding Properties of ATF3 and ATF3b Homo- and Heterodimers—To test whether these ATF3 proteins are involved in the transcriptional regulation of the proglucagon gene through its CRE/ATF site, we analyzed the binding ability of ATF3 or ATF3b homodimers to the normal and mutant ATF/CRE sites derived from mouse proglucagon promoter (Fig. 3). The EMSA results showed that both ATF3 and ATF3b protein bound to the normal ATF/CRE site (Fig. 3B, lanes 2 and 12) but not to the mutant sequence (lanes 7 and 17). The specificity was verified by supershifting of the DNA-protein complex (lanes 3 and 13) with an ATF3- and ATF3b-specific antiserum but not with a nonspecific antiserum (lanes 4 and 14). Moreover, the formation of the DNA-protein complex was inhibited by addition of an 80-fold excess of unlabeled competitor (lanes 5 and 15). On the other hand, disruption of specific binding by mutation of the CRE/ATF site (lanes 6–10 and 16–20) indicated that the homodimers of ATF3 or ATF3b protein bind directly to the CRE/ATF site of the proglucagon gene promoter and not to the flanking DNA regions.



View larger version (51K):
[in this window]
[in a new window]
  		FIG. 3.
EMSA assays of ATF3 isoform binding to proglucagon gene CRE/ATF site. A, the sequence of DNA probes containing the CRE/ATF site derived from the mouse proglucagon gene promoter used for EMSA. B, EMSA results of ATF3 (1 µl) and ATF3b (2 µl) proteins synthesized in vitro. (See "Materials and Methods" for experimental details.)

 

To compare the relative binding ability of ATF3 and ATF3b homodimers, we initially quantified the amount of ATF3 and ATF3b protein required for binding. Compared with ATF3, ~10-fold less ATF3b protein was synthesized in vitro from the same amount of cDNA template based on normalized methionine radioactivity (ATF3/ATF3b = 10.3, p <0.0005, n = 3) (Fig. 4A). The low production of the ATF3b protein may reflect the presence of an atypical Kozak sequence for initiation of translation (34), because the transcriptional efficiency of the ATF3b plasmid is likely to be similar to that of the ATF3 plasmid in this system. However, comparative binding results based on 32P radioactivity of the respective bands indicated that the binding ability of the ATF3b homodimer is ~15-fold higher than that of ATF3 homodimer normalized to the same protein amount (ATF3/ATF3b = 15.3, p <0.001, n = 3) (Fig. 4B). We also tested the binding ability of ATF3 and ATF3b heterodimers. As shown in Fig. 4C, such heterodimers can be formed and show a higher binding ability with the CRE/ATF site than the homodimers based on densitometric analysis (ATF3b heterodimer versus homodimer = 2.53, p <0.003, n = 3) (Fig. 4C).



View larger version (32K):
[in this window]
[in a new window]
  		FIG. 4.
EMSA assay quantifying the relative amounts and CRE/ATF site binding activity of ATF3 and ATF3b proteins synthesized in vitro. A, comparison of amounts of ATF3 and ATF3b proteins labeled in vitro with [35S]methionine using equal amounts of cDNA templates. ATF3 and ATF3b proteins synthesized in parallel with cold methionine were used for panels B and C. B, comparison of the binding ability of ATF3 and ATF3b proteins with the CRE/ATF site derived from the mouse proglucagon gene promoter. C, heterodimer formation of ATF3 and ATF3b and its binding ability. Note elevated basal activity and reduced response to CREB in {alpha}TC1.6 cells. (See "Materials and Methods" for experimental details.)

 

ATF3 and ATF3b Stimulate Proglucagon Transcription and This Action Is Potentiated by cAMP—To assess the role of ATF3 proteins in proglucagon gene transcription, transient transfection assays were performed in both {alpha}TC1.6 and NIH3T3 cells. The results indicated that the transcription of the proglucagon gene was stimulated by transfection of ATF3 or ATF3b along with the normal proglucagon gene promoter-luciferase construct (p <0.05, n = 4) in both {alpha}TC1.6 and NIH3T3 cells (Fig. 5B). By contrast, the stimulatory activity was significantly reduced when these were transfected with a promoter construct containing a mutation in the CRE/ATF site (Fig. 5B, p <0.0005, n = 3). The results demonstrate that the stimulatory effect of the ATF3 proteins is dependent on the CRE/ATF site. Moreover, the stimulatory activity was dose-dependent on the amount of transfected DNA (data not shown), potentiated by elevated cAMP levels (Fig. 5B, p <0.05, n = 4), and paralleled the increased amounts of ATF3 and ATF3b protein (Fig. 5C). These observations suggest alterations in the levels of ATF3 proteins contribute to the regulation of proglucagon gene transcription. Note that the effects of ATF3 and ATF3b cotransfection lie between the effects of ATF3 or ATF3b transfection alone. This presumably reflects additivity in the binding ability of heterodimers with the CRE/ATF site. In these experiments, the basal activity of the proglucagon promoter was lower in NIH3T3 versus {alpha}TC1cells, which may reflect the lack of some important transcription factors for basal proglucagon gene transcription in these non-glucagon-producing NIH3T3 cells. It should be noted also that, in agreement with the transfection results described above, the increased proglucagon mRNA level in {alpha}TC1.6 cells paralleled the increased level of ATF3 proteins in {alpha} TC1.6 cells treated with forskolin/IBMX (Fig. 5D).



View larger version (20K):
[in this window]
[in a new window]
  		FIG. 5.
Assays of luciferase expression in transfected cell lines. A, sketch map of luciferase reporter gene driven by the normal or mutant promoter of the mouse proglucagon gene. B, transient transfection assay to evaluate the stimulatory effects of ATF3 and/or ATF3b on proglucagon gene transcription using {alpha}TC1.6 (upper panel) and NIH3T3 (lower panel) cells under the conditions of normal culture and forskolin/IBMX treatments. C, detection of ATF3 and ATF3b proteins by Western blot in NIH3T3 cells using the same treatments as in panel B. Lanes 1 and 5, transfected with control plasmid; lanes 2 and 6, transfected with pcDNA3-ATF3b; lanes 3 and 7, transfected with pcDNA3-ATF3; lanes 4 and 8, transfected with pcDNA3-ATF3b and pcDNA3-ATF3. Lanes 1–4, without forskolin/IBMX; lanes 5–8, with forskolin/IBMX. All samples were co-transfected with the reporter plasmid driven by the normal proglucagon promoter. D, increase of proglucagon mRNA level (Northern blot, right panel) is paralleled by alterations in the levels of ATF3 and ATF3b proteins (Western blot, left panel) in {alpha}TC1.6 cells with forskolin/IBMX treatment. (See "Materials and Methods" for experimental details.)

 

ATF3 Proteins Have Effects Similar to Those of CREB Protein on Proglucagon Gene Transcription in Pancreatic {alpha} Cells— The effects of ATF3 proteins on proglucagon gene transcription were compared with those of CREB-327, a cAMP signal effector (4, 7, 9). As shown in Fig. 6, in non-glucagon-producing NIH3T3 cells (lower panel), CREB-327 showed a greater stimulation of proglucagon gene transcription as compared with the ATF3 proteins. However, in {alpha}TC1.6 cells (upper panel), the effects of ATF3 proteins were similar under normal culture conditions (columns 2 or 3 or 4 versus 5, p >0.05, n = 3) and were potentiated more than that of CREB-327 in response to forskolin/IBMX (columns 11 or 12 versus 13, p <0.01, n = 3), although ATF3 alone exhibited the highest activity among the three proteins (column 11). Compared with that in NIH3T3 cells (lower panel, column 13 versus 5 = 4.54, p <0.01, n = 3), the attenuated effect of CREB-327 in response to the cAMP signal in {alpha}TC1.6 cells (upper panel, column 13 versus 5 = 2.69, p <0.05, n = 3) may reflect the fact that pancreatic {alpha} cells express at high levels a large number of transcription factors, including the bZip proteins,2 some of which may associate with and attenuate the activity of CREB-327 as described previously (9). Another possibility may be related to the high basal cAMP-dependent protein kinase activity and its reduced responsiveness to added exogenous cAMP in the original {alpha}TC1 cells from which the {alpha}TC1.6 cells were cloned (35). Without forskolin/IBMX, no significant synergistic effects of CREB and ATF3 proteins were observed in either cell type (Fig. 6, column 5 versus 6 or 7 or 8, p >0.05, n = 3). This result is in agreement with the absence of CREB/ATF3 heterodimer formation found by others (36) and ourselves. With forskolin/IBMX, some combination of CREB/ATF3 proteins (upper panel, column 14 versus 13, p <0.05, n = 3; lower panel, column 15 versus 13, p <0.05, n = 3) showed enhanced effects compared with that of each alone. This result may reflect partial overlapped positive effects of ATF3 and CREB proteins in response to cAMP signal. It should be noted that although the double banding pattern of ATF3b expression seen in Fig. 5C suggests phosphorylation, this could not be demonstrated (data not shown). Therefore, it is more likely that the lower band arises from initiation at an internal ATG codon (see Fig. 1).



View larger version (23K):
[in this window]
[in a new window]
  		FIG. 6.
Comparative effects of CREB and ATF3 proteins on proglucagon gene transcription in cultured {alpha}TC1.6 and NIH3T3 cells (see "Materials and Methods" for experimental details). The effects of ATF3 proteins on proglucagon gene transcription were compared with those of CREB-327, a cAMP signal effector. In non-glucagon-producing NIH3T3 cells (lower panel), CREB-327 showed a greater stimulation of proglucagon gene transcription as compared with the ATF3 proteins (column 5 versus 2, 3, and 4/140 ± 37.22 versus 42.22 ± 8.64, 75.14 ± 16.01, and 51.53 ± 13.46, n = 3; column 13 versus 10, 11, and 12/635.83 ± 27.70 versus 166.39 ± 2.55, 302.80 ± 5.00, 224.72 ± 3.73, n = 3). However, in {alpha}TC1.6 cells (upper panel), the effects of ATF3 proteins were similar under normal culture conditions (columns 2 or 3 or 4 versus 5, p >0.05, n = 3) and were potentiated more than that of CREB-327 in response to forskolin/IBMX (columns 11 or 12 versus 13, p <0.01, n = 3), although ATF3 alone exhibited the highest activity among the three proteins (column 11). Compared with that in NIH3T3 cells (lower panel, column 13 versus 5 = 4.54, p <0.01, n = 3), the effect of CREB-327 in response to the cAMP signal in {alpha}TC1.6 cells was attenuated (upper panel, column 13 versus 5 = 2.69, p <0.05, n = 3). Without forskolin/IBMX, no significant synergistic effects of CREB and ATF3 proteins were observed in either cell type (column 5 versus 6 or 7 or 8, p >0.05, n = 3). With forskolin/IBMX, some combinations of CREB/ATF3 proteins (upper panel, column 14 versus 13, p <0.05, n = 3; lower panel, column 15 versus 13, p <0.05, n = 3) showed enhanced effects compared with those of each alone.

 


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
The identification of the novel isoform ATF3b indicates that alternative splicing of the ATF3 gene generates more functionally diversified products in addition to ATF3{Delta}Zip and ATF3{Delta}Zip2. The ATF3b protein, which lacks a weak activation region (1–39 aa) and 18 aa of the repression region (40–84 aa) (37), retains the intact bZip domain for DNA binding. Compared with ATF3, its expression is lower in islets and {alpha}TC1.6 cells (Fig. 2B). The reason may likely be due to both the atypical Kozak sequence and low level of ATF3b mRNA (Fig. 2B). Intriguingly, the binding ability of the ATF3b homodimer with the CRE/ATF site of the proglucagon promoter was much higher than that of ATF3 homodimers (Fig. 4B). This property may remedy its low expression level in contributing to the regulation of proglucagon gene transcription. In addition, the ATF3b homodimer and heterodimer with ATF3 showed a much higher binding ability in vitro than the ATF3 homodimer (Fig. 4, B and C) but somewhat weaker effect on proglucagon gene expression in cellular systems compared with that by ATF3 (Fig. 5B). These observations suggest that the 1–57 aa region of ATF3 contains regions that strongly interfere with binding and only weakly activate transcription.

The results of EMSA (Figs. 3 and 4C) and transient transfection assays (Fig. 5) clearly indicate that the homo- and heterodimers of ATF3 and ATF3b directly bind to the specific CRE/ATF element and stimulate proglucagon gene expression. This role of the ATF3 proteins is indirectly supported by the observations of higher plasma glucagon concentrations in ATF3 transgenic mice (25) and the elevated levels of proglucagon mRNA in the islets of PC2 null mice (1) that is also accompanied by a significant increase of ATF3 protein (data not shown).

In the pancreatic {alpha} cell, despite the fact that the CREB and ATF3 proteins specifically act on the same CRE/ATF motif of the proglucagon promoter, their effects may be exerted in different physiological states. Thus, the CREB protein can be rapidly phosphorylated by cAMP-dependent protein kinase and may be adapted to meet the increased need for elevated glucagon production and/or secretion in stressful situations, such as hypoglycemia and sudden muscular activity, through activation of adenylate cyclase. However, the ATF3 proteins do not have consensus phosphorylation sites for PKA (15). Thus, the ATF3 proteins may provide a more prolonged glucagon response by acting through increasing amounts of active protein. Because the levels of the ATF3 proteins can be up-regulated both by decreasing glucose concentration and elevated cAMP, regulation of proglucagon gene expression by ATF3 proteins may cover a broader spectrum of physiological demands, including fasting and hypoglycemia, in addition to stress responses. The increased proglucagon mRNA level seen in islets cultured for 6 h at reduced levels of glucose from 5 to 2 mM (11) and in the pancreas of 4-day fasting rats (12) may be partially because of positive contributions of increased ATF3 proteins to the expression of the proglucagon gene. Overall, we have demonstrated the existence of a novel mechanism for regulation of the transcription of the proglucagon gene by glucose and cAMP signals in addition to the CREB protein in pancreatic {alpha} cells. Although high ATF3 levels are present in {alpha} cells, whether this mechanism is dominant compared with the role of CREB or how specific it might be for {alpha} cells as compared with two other cell types, such as the enteroendocrine L cells and some neuronal cells, will require additional studies. Because a similar CRE/ATF element is located in the human proglucagon gene promoter (38), a role for ATF3 proteins in human proglucagon gene expression seems plausible. Intriguingly, regulation of proglucagon gene expression by the Wnt signaling pathway has recently been demonstrated in enteroendocrine L cells. However, regulation of proglucagon gene expression by lithium via this pathway has not been shown in pancreatic {alpha} cells (27).

In summary, in the present study we have characterized the specific binding ability of ATF3 and ATF3b with the CRE/ATF motif of the proglucagon gene and demonstrated a novel mechanism in addition to CREB by which the transcription of this gene may be regulated in response to cAMP signals and to glucose fluctuations in pancreatic {alpha} cells. Because pancreatic {alpha} cells play an important physiological role in responding to low glucose levels, a stressful condition for many cell types, the {alpha} cells appear to be equipped with a multifaceted mechanism to support this feature. The higher levels of bZip proteins, including ATF3 and ATF3b, in {alpha} cells may be a part of this mechanism. Further dissection of the interactions of ATF3 proteins with some of the other bZip protein family members may extend our understanding of this aspect of proglucagon gene expression.


   FOOTNOTES
 
The nucleotide sequence(s) reported in this paper has been submitted to the DDBJ/GenBankTM/EBI Data Bank with accession number(s) AY329367 [GenBank] .

* This work was supported by National Institutes of Health Grants DK13914 and DK20595 and by the Howard Hughes Medical Institute. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

To whom correspondence should be addressed: The Howard Hughes Medical Institute, University of Chicago, 5841 S. Maryland Ave., MC 1028, Rm. 216, Chicago, IL 60637. Tel.: 773-702-1334; Fax: 773-702-4292; E-mail: dfsteine{at}midway.uchicago.edu.

1 The abbreviations used are: CRE, cAMP-response element; aa, amino acid; ATF/CREB, activated transcription factor/cAMP-response element binding protein; bZip, basic leucine zipper; EMSA, electrophoretic mobility shift assay; IBMX, isobutylmethylxanthine; PC, pro-protein convertase; PEPCK, phosphoenolpyruvate carboxykinase; Tricine, N-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycine. Back

2 J. Wang, G. Webb, Y. Cao, and D. F. Steiner, submitted for publication. Back


   ACKNOWLEDGMENTS
 
We thank Raymond Carroll, Paul Gardner, Jeffrey Stein, and Margaret Milewski for technical assistance and Rosie Ricks for expert assistance in preparing this manuscript. Our thanks also to Graeme Bell and Louis Philipson for encouragement.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Webb, G. C., Akbar, M. S., Zhao, C., Swift, H. H., and Steiner, D. F. (2002) Diabetes 51, 398–405[Abstract/Free Full Text]
  2. Steiner, D., Bell, G., Rubenstein, A., and Chan, S. (2000) in Endocrinology (DeGroot, L., and Jameson, J., eds), 4th Ed., pp. 667–696, W. B. Saunders, New York
  3. Unger, R., and Orci, L. (1996) in Ellenberg and Rifkin's Diabetes Mellitus (Porte, D., Jr., and Sherwin, R., eds), 5th Ed., Appleton and Lange, Stamford, CT
  4. Knepel, W., Chafitz, J., and Habener, J. F. (1990) Mol. Cell Biol. 10, 6799–6804[Abstract/Free Full Text]
  5. Drucker, D. J., and Brubaker, P. L. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 3953–3957[Abstract/Free Full Text]
  6. Gajic, D., and Drucker, D. J. (1993) Endocrinology 132, 1055–1062[Abstract/Free Full Text]
  7. Schwaninger, M., Lux, G., Blume, R., Oetjen, E., Hidaka, H., and Knepel, W. (1993) J. Biol. Chem. 268, 5168–5177[Abstract/Free Full Text]
  8. Drucker, D. J., Jin, T., Asa, S. L., Young, T. A., and Brubaker, P. L. (1994) Mol. Endocrinol. 8, 1646–1655[Abstract/Free Full Text]
  9. Miller, C. P., Lin, J. C., and Habener, J. F. (1993) Mol. Cell Biol. 13, 7080–7090[Abstract/Free Full Text]
  10. Nielsen, D. A., Welsh, M., Casadaban, M. J., and Steiner, D. F. (1985) J. Biol. Chem. 260, 13585–13589[Abstract/Free Full Text]
  11. Dumonteil, E., Magnan, C., Ritz-Laser, B., Ktorza, A., Meda, P., and Philippe, J. (2000) Endocrinology 141, 174–180[Abstract/Free Full Text]
  12. Chen, L., Komiya, I., Inman, L., O'Neil, J., Appel, M., Alam, T., and Unger, R. H. (1989) J. Clin. Invest. 84, 711–714[Medline] [Order article via Infotrieve]
  13. Hai, T., and Hartman, M. G. (2001) Gene 273, 1–11[CrossRef][Medline] [Order article via Infotrieve]
  14. Hsu, J. C., Laz, T., Mohn, K. L., and Taub, R. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 3511–3515[Abstract/Free Full Text]
  15. Drysdale, B. E., Howard, D. L., and Johnson, R. J. (1996) Mol. Immunol. 33, 989–998[CrossRef][Medline] [Order article via Infotrieve]
  16. Chen, B. P., Liang, G., Whelan, J., and Hai, T. (1994) J. Biol. Chem. 269, 15819–15826[Abstract/Free Full Text]
  17. Hashimoto, Y., Zhang, C., Kawauchi, J., Imoto, I., Adachi, M. T., Inazawa, J., Amagasa, T., Hai, T., and Kitajima, S. (2002) Nucleic Acids Res. 30, 2398–2406[Abstract/Free Full Text]
  18. Hai, T., Wolfgang, C. D., Marsee, D. K., Allen, A. E., and Sivaprasad, U. (1999) Gene Expr. 7, 321–335[Medline] [Order article via Infotrieve]
  19. Chu, H. M., Tan, Y., Kobierski, L. A., Balsam, L. B., and Comb, M. J. (1994) Mol. Endocrinol. 8, 59–68[Abstract/Free Full Text]
  20. Wolfgang, C. D., Chen, B. P., Martindale, J. L., Holbrook, N. J., and Hai, T. (1997) Mol. Cell Biol. 17, 6700–6707[Abstract]
  21. Nawa, T., Nawa, M. T., Cai, Y., Zhang, C., Uchimura, I., Narumi, S., Numano, F., and Kitajima, S. (2000) Biochem. Biophys. Res. Commun. 275, 406–411[CrossRef][Medline] [Order article via Infotrieve]
  22. Perez, S., Vial, E., van Dam, H., and Castellazzi, M. (2001) Oncogene 20, 1135–1141[CrossRef][Medline] [Order article via Infotrieve]
  23. Allan, A. L., Albanese, C., Pestell, R. G., and LaMarre, J. (2001) J. Biol. Chem. 276, 27272–27280[Abstract/Free Full Text]
  24. Yan, C., Wang, H., and Boyd, D. D. (2002) J. Biol. Chem. 277, 10804–10812[Abstract/Free Full Text]
  25. Allen-Jennings, A. E., Hartman, M. G., Kociba, G. J., and Hai, T. (2002) J. Biol. Chem. 277, 20020–20025[Abstract/Free Full Text]
  26. Allen-Jennings, A. E., Hartman, M. G., Kociba, G. J., and Hai, T. (2001) J. Biol. Chem. 276, 29507–29514[Abstract/Free Full Text]
  27. Ni, Z., Anini, Y., Fang, X., Mills, G., Brubaker, P. L., and Jin, T. (2003) J. Biol. Chem. 278, 1380–1387[Abstract/Free Full Text]
  28. Hamaguchi, K., and Leiter, E. H. (1990) Diabetes 39, 415–425[Abstract]
  29. Jainchill, J. L., Aaronson, S. A., and Todaro, G. J. (1969) J. Virol. 4, 549–553[Abstract/Free Full Text]
  30. Wang, J., Takeuchi, T., Tanaka, S., Kubo, S. K., Kayo, T., Lu, D., Takata, K., Koizumi, A., and Izumi, T. (1999) J. Clin. Invest. 103, 27–37[Medline] [Order article via Infotrieve]
  31. Wang, J., Takeuchi, T., Yokota, H., and Izumi, T. (1999) J. Biol. Chem. 274, 28542–28548[Abstract/Free Full Text]
  32. Furuta, M., Yano, H., Zhou, A., Rouille, Y., Holst, J. J., Carroll, R., Ravazzola, M., Orci, L., Furuta, H., and Steiner, D. F. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 6646–6651[Abstract/Free Full Text]
  33. Padgett, R. A., Grabowski, P. J., Konarska, M. M., Seiler, S., and Sharp, P. A. (1986) Annu. Rev. Biochem. 55, 1119–1150[CrossRef][Medline] [Order article via Infotrieve]
  34. Kozak, M. (1996) Mamm. Genome 7, 563–574[CrossRef][Medline] [Order article via Infotrieve]
  35. Arava, Y., Adamsky, K., Belleli, A., Shaltiel, S., and Walker, M. D. (1998) FEBS Lett. 425, 24–28[CrossRef][Medline] [Order article via Infotrieve]
  36. van Dam, H., and Castellazzi, M. (2001) Oncogene 20, 2453–2464[CrossRef][Medline] [Order article via Infotrieve]
  37. Hsu, J. C., Bravo, R., and Taub, R. (1992) Mol. Cell Biol. 12, 4654–4665[Abstract/Free Full Text]
  38. Nian, M., Drucker, D. J., and Irwin, D. (1999) Am. J. Physiol. 277, G829–837

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Am. J. Physiol. Endocrinol. Metab.Home page
D. Islam, N. Zhang, P. Wang, H. Li, P. L. Brubaker, H. Y. Gaisano, Q. Wang, and T. Jin
Epac is involved in cAMP-stimulated proglucagon expression and hormone production but not hormone secretion in pancreatic {alpha}- and intestinal L-cell lines
Am J Physiol Endocrinol Metab, January 1, 2009; 296(1): E174 - E181.
[Abstract] [Full Text] [PDF]

Home page
 J EndocrinolHome page
T. Jin
Mechanisms underlying proglucagon gene expression
J. Endocrinol., July 1, 2008; 198(1): 17 - 28.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
J. Xie and M. S. Roberson
3', 5'-Cyclic Adenosine 5'-Monophosphate Response Element-Dependent Transcriptional Regulation of the Secretogranin II Gene Promoter Depends on Gonadotropin-Releasing Hormone-Induced Mitogen-Activated Protein Kinase Activation and the Transactivator Activating Transcription Factor 3
Endocrinology, February 1, 2008; 149(2): 783 - 792.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
S. Lotfi, Z. Li, J. Sun, Y. Zuo, P. P. L. Lam, Y. Kang, M. Rahimi, D. Islam, P. Wang, H. Y. Gaisano, et al.
Role of the Exchange Protein Directly Activated by Cyclic Adenosine 5'-Monophosphate (Epac) Pathway in Regulating Proglucagon Gene Expression in Intestinal Endocrine L Cells
Endocrinology, August 1, 2006; 147(8): 3727 - 3736.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
J. Wang, Y. Cao, Y. Chen, Y. Chen, P. Gardner, and D. F. Steiner
Pancreatic beta cells lack a low glucose and O2-inducible mitochondrial protein that augments cell survival
PNAS, July 11, 2006; 103(28): 10636 - 10641.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
A. Okamoto, Y. Iwamoto, and Y. Maru
Oxidative Stress-Responsive Transcription Factor ATF3 Potentially Mediates Diabetic Angiopathy
Mol. Cell. Biol., February 1, 2006; 26(3): 1087 - 1097.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
B. Hua, M. Tamamori-Adachi, Y. Luo, K. Tamura, M. Morioka, M. Fukuda, Y. Tanaka, and S. Kitajima
A Splice Variant of Stress Response Gene ATF3 Counteracts NF-{kappa}B-dependent Anti-apoptosis through Inhibiting Recruitment of CREB-binding Protein/p300 Coactivator
J. Biol. Chem., January 20, 2006; 281(3): 1620 - 1629.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
Y.-X. Pan, H. Chen, and M. S. Kilberg
Interaction of RNA-binding Proteins HuR and AUF1 with the Human ATF3 mRNA 3'-Untranslated Region Regulates Its Amino Acid Limitation-induced Stabilization
J. Biol. Chem., October 14, 2005; 280(41): 34609 - 34616.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
F. Yi, P. L. Brubaker, and T. Jin
TCF-4 Mediates Cell Type-specific Regulation of Proglucagon Gene Expression by {beta}-Catenin and Glycogen Synthase Kinase-3{beta}
J. Biol. Chem., January 14, 2005; 280(2): 1457 - 1464.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
H. Chen, Y.-X. Pan, E. E. Dudenhausen, and M. S. Kilberg
Amino Acid Deprivation Induces the Transcription Rate of the Human Asparagine Synthetase Gene through a Timed Program of Expression and Promoter Binding of Nutrient-responsive Basic Region/Leucine Zipper Transcription Factors as Well as Localized Histone Acetylation
J. Biol. Chem., December 3, 2004; 279(49): 50829 - 50839.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
J. Wang, G. Webb, Y. Cao, and D. F. Steiner
Contrasting patterns of expression of transcription factors in pancreatic {alpha} and {beta} cells
PNAS, October 28, 2003; 100(22): 12660 - 12665.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/35/32899    most recent
M305456200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, J.
Right arrow Articles by Steiner, D. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, J.
Right arrow Articles by Steiner, D. F.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement