| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 278, Issue 36, 34158-34166, September 5, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the Department of Pediatrics, Section of Pediatric Nephrology, Tulane University Health Sciences Center, New Orleans, Louisiana 70112
Received for publication, April 30, 2003 , and in revised form, May 28, 2003.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
-synthase, and superoxide
dismutase), muscle differentiation (phosphoglycerate mutase), extracellular
matrix production (plasminogen activator inhibitor-1, collagen type IV,
1), membrane protein trafficking (caveolin), and vascular tone
regulation (endothelin-2)
(15–21).
In addition, studies from our laboratory have identified a group of renal
function genes (bradykinin B2 receptor, angiotensin type 1
receptor, aquaporin-2, and Na,K-ATPase) as novel p53-responsive genes
(22).
p53-mediated activation of transcription is largely dependent on
sequence-specific DNA binding. The consensus p53-binding motif consists of two
half-sites separated by 0–13 nucleotides
(18,
23). Each half-site consists
of the sequence RRRC(A/T)(T/A)GYYY. p53 binds the response element as a
tetramer, each half-site bound to a p53 dimer
(24). p53 also represses
transcription of a number of genes. The mechanisms of p53-mediated repression
are not well understood, because the majority of p53-repressed genes do not
contain a consensus response element. Although initial studies suggested that
p53 selectively represses TATA box-containing promoters, more recent studies
indicated that p53 is capable of repressing TATA-less promoters as well
(25). Protein-protein
interactions with the basal transcription machinery have been proposed as the
underlying mechanism for p53-mediated repression of these promoters. Binding
to and interference with the binding or function of upstream transcriptional
activators such as SP1 and AP-1 has also been shown to mediate p53-induced
repression
(26–29).
In addition, recruitment of chromatin-modifying enzymes or modification of the
acetylation status of p53 by interaction with and recruitment of histone
deacetylase plays an important role in p53-mediated repression, for some
(e.g. MAP-4 and -fetoprotein
(AFP)1) but not all
genes (e.g. p202)
(30–33).
In several instances, p53 mediates promoter repression via direct DNA binding
to a canonical p53-binding motif, as has been demonstrated in the AFP, p202,
and survivin genes (31,
34–36).
At least in one case, the AFP gene, p53-mediated repression was dependent on
displacement of an adjacent overlapping transcriptional activator, HNF-3. In
cells lacking HNF-3, p53 mediates activation rather than repression of the AFP
promoter (35). In another
case, the MDR1 gene, p53-mediated repression was dependent on binding
to a novel p53-binding motif in which the two copies of the p53-binding site
are arranged in head-to-tail orientation. Replacement of the head-to-tail site
with a head-to-head site converted the activity of p53 from repression to
activation (37). This finding
provided the initial demonstration that inherent features in the p53-response
element can confer differential functional responses. More recently, a novel
21-bp DNA element, called the p53 transcriptional repressor element (p53TRE),
was identified in the promoter of the placental transforming growth factor
gene (38). This
sequence (GYYDCCCAGGCTGGARTGSWR, where R is purine, Y is pyrimidine, W is
adenine or thymine, S is guanine or cytosine, and D is guanine, adenine, or
thymine) diverges from the consensus p53 sequence and represses p53
transactivation in a position- and promoter-independent fashion.
We recently identified the BdkrB2 gene, which encodes the bradykinin B2 receptor (B2R), as a direct transcriptional target for p53 (39). B2R is a G protein-coupled receptor that is involved in the regulation of cardiovascular and renal functions as well as inflammation. The rat BdkrB2 promoter contains two functional p53-binding sites: a P1 site located at nucleotide positions –70; and P2, located at –707 bp, relative to the transcription start site. The P1 and P2 sequences bear 80% or greater homology to the p53 consensus sequence and bind to recombinant p53 with high affinity (22, 39). Initial promoter function analysis suggested that p53 activates the BdkrB2 promoter via the P1 site and that P2 down-modulates P1 function (39). However, the potential mechanisms of such effects were not addressed. By manipulating the sequence and context (location and spacing) of the P1 and P2 sites, we investigated in this study whether p53-mediated promoter activation and repression are dictated by the sequence of the p53-response element and/or its context. In addition, we have examined some of the potential mechanisms of P2-mediated repression within the context of the BdkrB2 promoter. The results indicate that the functions of P1 and P2 elements as activator and repressor, respectively, are dependent on their intrinsic DNA sequence. Moreover, the function of P2 as a repressor is dependent on its presence within its native promoter context. p53-mediated repression of BdkrB2 via P2 is unaffected by histone acetyltransferases, histone deacetylases, and mutation of the minimal repression C-terminal domain of p53 but may involve competitive displacement of transcriptional activators.
|
EXPERIMENTAL PROCEDURES |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
-galactosidase vector pSVZ (Promega, 0.5 µg of DNA/well)
was cotransfected to correct for transfection efficiency. Transfections were
performed using LipofectAMINE Plus Reagent (Invitrogen) according to the
manufacturer's recommendations. Four hours after transfection, fresh medium
was replaced and cell extracts were prepared 48 h later using a reporter lysis
reagent (Promega). CAT activity was measured by thin layer chromatography as
described after normalization for protein concentrations or
-galactosidase activity
(39).
Promoter Constructs—The original promoter-reporter construct
pB-dkrB2 –1184/+55-CAT and its derivative lacking the P2 site,
–1184/CAT-
P2, were described
(39). Utilizing the above two
plasmids as templates, a series of point mutations, deletion, substitution,
swap, and insertion constructs were engineered using the QuikChange
site-directed mutagenesis kit (Stratagene). The promoter constructs and
mutagenesis primers are depicted in Table
I. The mutant clone p53(M340P,F341D) was obtained by the same
method. The –358P2/P1 construct was generated by inserting P2 at nt
position –358 in the P2/P1 construct. All clones were subjected
to DNA sequencing. Transfections were performed in duplicate and performed at
least three times. In experiments utilizing Trichostatin A (TSA, Sigma
Chemicals), TSA was added concentrations of 100 µM for 18 h or
100 ng/ml for 2 h.
|
Electrophoretic Mobility Shift Assays—Bacterially produced
recombinant p53 (Santa Cruz Biotechnology) or tissue nuclear extracts were
used as described (22).
Double-stranded oligonucleotides (Operon Biotechnologies) were
5'-end-labeled with [
-32P]dATP with T4 kinase for use
as probes in EMSA. The labeled probe was incubated for 20 min at room
temperature with nuclear extracts and the binding buffer (20 mM
Hepes, pH 7.9, 10% glycerol, 50 mM KCl, 0.2 mM EDTA, 0.5
mM dithiothreitol, 1 mM spermidine, 1.0 µg of
poly(dI-dC). Specific competitor oligonucleotides were added in 50- to
200-fold molar excess 15 min before addition of the radioactive probe. For
supershift experiments, antibodies to p53 (phospho-ser20p53 and
phospho-ser15p53, Cell Signaling; lys382 acetyl p53, Upstate Biotechnologies)
were added 30 min before addition of radioactive probe. The sequences of the
oligonucleotides (double-stranded) used in EMSA are as follows: P1,
5'-AGGGGGGAGGTGCCCAGGAGAGTGATGACA-3'; P2,
5'-ACTTCACTCTTGCCTGGTCTTCCCTGCACC-3'; p53-Consensus
(23),
5'-AGGCATGTCTAGGCATGTCT-3'; NF-
B-Consensus,
5'-AGTTGAGGGGACTTCCCAGGC-3'; KLF4 (human p21 promoter),
GCCCCGGGGAGGGCGGTCCCGGGCGGCGCGG-3'; CRE-Consensus,
5'-AGTGATGACATCACCGGC-3'; and AP-1-Consensus,
5'-CGCTTGATGACTCAGCCGGAA-3'.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
P1). The results showed that elimination of P1
completely abrogates p53-mediated activation
(Fig. 1C).
Furthermore, elimination of P1 abolishes p53-mediated activation of the
–635/+55-CAT promoter construct, which lacks the repressor P2 element
(Fig. 1C). We have
previously shown that a DNA-binding mutant p53 cannot activate BdkrB2
transcription (39). Based on
these results, we conclude that p53 mediates direct activation of the
BdkrB2 promoter via the P1 p53-binding site.
|
To further define the role of P1, we inserted one copy of the P1 sequence
upstream of the TATA box in the TATA-Luciferase reporter construct
(P1/TATA-Luc). As shown in Fig.
1D, p53 causes a powerful dose-dependent activation of
the heterologous promoter construct. This activation is not observed in cells
transfected with pCMV-empty vector alone. In addition, as shown below, P1 is
capable of transactivation when substituted for P2, although the magnitude of
P1-mediated activation is higher when P1 is located closer to the basal
promoter region (compare P2/P1 with P1/P1 in
Fig. 2B). These
results confirm and extend the notion that P1 is a bona fide positive
p53-response element.
|
The P2 Element Mediates Sequence- and Context-dependent
Repression—To determine the role of P2, we generated several mutant
versions of the original P2/P1 construct, which include single or double
deletions (P2/P1, P2/P1, and P2/P1), a swap
(P1/P2), a swap with deletion (P2/P2 and P1/P1), and insertion
with substitution (P2/P2). Deletion of the P2 site (P2/P1) doubles
P1-mediated activation (Fig. 2, A
and B). Although the P1/P1 construct is responsive
to p53, the P1/P2 construct is not, confirming that P2 strongly represses
P1-mediated activation. However, because P2/P1 is more responsive to p53 than
P1/P2, we conclude that the location of the two elements is an important
determinant of P1 and P2 function. Relocation of P2 from its natural position
at nt –707 to nt –358 did not affect p53-mediated responses
(compare P2/P1 and –358P2/P1, Fig.
2B), suggesting that P2-mediated repression is
independent of the distance (spacing) between the P1 and P2 sites. Also, the
constructs in which P1 was substituted by P2 (P2/P2 and P2/P2) are
highly repressed by p53 as compared with P2/P1 and P2/P1
(Fig. 2, A and
B). Based on these findings, we conclude that the
presence of P2 dictates transcriptional repression in response to p53 in the
BdkrB2 promoter. Interestingly, the double deletion construct
(P2/P1) is responsive to p53-mediated activation (about 40% of
P2/P1 activity) (Fig.
2B). Because 5'-end truncation of
P2/P1 from –1184 to –827 (by NcoI
digestion) eliminates p53-mediated activation
(Fig. 2B), we conclude
that an additional positive p53-responsive element resides in the region
between nt –1184 and –827. The function of this upstream element
becomes apparent in the absence of P2 repressor activity.
To determine if p53-mediated repression via P2 is an intrinsic property of
the P2 DNA sequence, we first replaced the P2 sequence in the P2/P1 and
P2/P1 plasmids with a consensus p53 sequence (p53-CS)
(AGGCATGTCTAGGCATGTCT) to yield the plasmids CS/P1 and CS/P1.
Fig. 3A shows that
replacement of P2 with p53-CS converts p53-induced repression to activation.
The transcriptional activation by CS and P1 tended to be additive, because
deletion of P1 reduces the magnitude of p53-mediated activation (p =
0.06). In addition to P2 deletion or replacement, we evaluated the effects of
P2 mutagenesis (double or triple mutations) on p53-mediated repression.
Unexpectedly, a mutant P2 oligoduplex probe exhibited a higher binding
activity to recombinant p53 than the wild-type P2
(Fig. 3B). To
determine whether P2 interactions with p53 can be demonstrated in a more
physiological setting, we incubated wild-type and triple-mutant P2 with
nuclear extracts derived from newborn rat kidneys
(Fig. 3C). As
demonstrated here and previously
(39,
40), the newborn rat kidney
contains higher amounts of p53 than the adult kidney
(Fig. 3D). Similar to
the EMSA results using recombinant p53, the binding of the mutant P2 probe to
nuclear extracts was higher than that of the wild-type probe
(Fig. 3C). The
presence of p53 in the nuclear extracts is demonstrated by the supershift
induced by the p53 antibodies (Fig.
3C). Transient transfection assays showed that the double
and triple mutant P2 constructs are much more responsive to p53 than the
wild-type P2/P1 construct (Fig.
3E). Collectively, P2 deletion, replacement, and
mutagenesis provide firm evidence that P2-mediated repression is
sequence-specific.
|
To examine whether P2 function as a repressor can be maintained outside the context of the BdkrB2 promoter, we inserted three tandem P2 sites upstream of the 13 p53-binding sites in the PG13-Luc construct. Transient transfection in HeLa cells revealed that the P2(x3)-PG13-Luc construct had a higher basal activity than PG13-Luc, and p53 activated both constructs equally well (data not shown). Moreover, insertion of a single P2 site upstream of a TATA-Luc minimal promoter resulted in a strong dose-dependent p53-mediated activation rather than repression (Fig. 4). Therefore, the role of P2 as a repressor is promoter-dependent. A summary of the results of P2 and P1 mutagenesis is presented in Table II.
|
|
Mutagenesis of the Minimal Repression Domain (p53MRD) of p53 Does Not
Affect P2-mediated Repression—The C-terminal segment of p53
contains an 8-amino acid region termed p53MRD (amino acids 339–346).
Deletion of the p53MRD or mutagenesis of amino acids 340 and 341 abolishes
p53-mediated repression of the thymidine kinase-CAT promoter
(41). We therefore wished to
determine what role, if any, the p53MRD plays in P2-mediated repression. To
this end, we compared the effects of pCMV-p53 (wild-type) or pCMV-p53
(M340P/F341D) on the transcriptional activity of P2/P1, P2/P1, P2/P2,
and P2/P1. Because wild-type p53 is known to repress viral promoters
(5), we first tested the effect
of p53MRD mutagenesis on pSV-lacZ promoter activity. As expected, wild-type
p53 inhibited the expression of -galactosidase in a dose-dependent
manner; in contrast, p53 mutant MRD had no significant effect
(Fig. 5A). In
addition, mutations of the p53 MRD did not affect p53-mediated repression of
the P2/P1, P2/P1, or P2/P2 constructs
(Fig. 5B).
Interestingly, the mutant p53M340/F341D retained its ability to activate
transcription albeit at a lower efficiency than the wild-type p53
(Fig. 5B).
|
Role of Histone Acetylase and Deacetylase—Recruitment of
HDACs to the promoter by p53 has been shown to mediate p53 repression of
certain promoters and could account for P2-mediated repression
(33). Also, HDACs may
theoretically deacetylate p53. To test these possibilities, we first treated
HeLa cells with trichostatin A (TSA), a selective HDAC inhibitor, at doses
shown previously to reverse p53-mediated transcriptional repression. We then
performed transient transfection assays with the p53 and the promoter-reporter
constructs. As shown in Fig.
6A, treatment with TSA has no appreciable effect on
P2-mediated repression of the P2/P1 and P2/P1 constructs, indicating
that p53-mediated repression is probably exerted by a mechanism that is
independent of HDAC activity. In the absence of p53, TSA stimulated slightly
the basal activity of the promoterless CAT construct
(Fig. 6A).
|
We previously reported that p53-mediated activation of the P2/P1 construct
is further enhanced in the presence of cotransfected CBP-expressing vector
(39). We surmised that if P2
interferes with P1 function by competition for the available intracellular
pool of CBP/p300, constructs lacking P2 but having P1 should respond more
vigorously to CBP/p300 (and p53) than those with an intact P2 site. CBP
enhanced p53-mediated activation by 40% above that of p53 alone. However, the
magnitude of activation of P2/P1 and P2/P1 was not different
(Fig. 6B).
Differential Binding of p53 to P1 and P2—Differences in the
binding affinity of the P1 and P2 elements to p53 might account, at least
partly, for their differential roles as activator and repressor, respectively.
We therefore compared the binding activity of recombinant p53 to P1 and P2
using EMSA (Fig. 7A).
The protein·DNA complex is efficiently competed by unlabeled P1 or P2
in a dose-dependent manner. As judged from the amount of competitor
oligoduplex required to displace p53 binding, the relative affinity of p53 for
P1 is 
30% higher than P2 (Fig.
7B). We next tested the binding of radiolabeled P1 and P2
to newborn rat kidney nuclear extracts. The protein·DNA complexes
produced using P1 were more abundant and migrated more slowly than those of
P2. These qualitative and quantitative differences prompted further
investigations into whether other nuclear DNA-binding proteins share with p53
the ability to bind to P2. A transcription factor search revealed that the P2
sequence has putative overlapping binding sites for NF-B and
Kruppel-like factor-4 (formerly known as GKLF)
(Fig. 8A). Competitive
EMSA utilizing the P2 probe and unlabeled p53-CS, P1, NF-B, AP-1,
KLF-4, and cAMP-response element (CRE) oligoduplexes were performed
(Fig. 8B). The P2
probe produced three specific DNA·protein complexes (C1–C3). C1
is competed completely by unlabeled p53 CS. Unlabeled P1 also competes well
against P2 for binding. Interestingly, C1 is reduced equally well by unlabeled
KLF-4 and to a lesser extent by CRE and Jun/AP-1 but not by NF-B
oligoduplex. C2 is competed only weakly by p53 CS, P1, and other
oligoduplexes. C3 is completely eliminated by unlabeled KLF-4 oligoduplex and
decreased by unlabeled NF-B and AP-1 duplexes. These findings indicate
that P2 is a potential binding site for multiple transcription factors,
including p53, NF-B, and KLF-4 and possibly others, and suggest that
p53 competes with NF-B and KLF-4 for binding to the P2 sequence.
|
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
P1) maintains p53-mediated activation; and 4) P1 mediates activation
of a heterologous minimal promoter-reporter construct. Conversely, several
observations support the notion that P2 is a sequence-specific repressor
element: 1) interference with P2 function by either truncation, deletion, or
mutagenesis up-regulates p53-mediated activation via P1; 2) P2 represses
transcription when substituted for P1; 3) substitution of P2 by a consensus
p53-binding sequence converts the repression to activation; and 4) P2
maintains its repressor activity within the context of the BdkrB2
promoter irrespective of P2-P1 spacing. However, once taken out of its native
context and placed in front of a foreign promoter, P2 behaves as an activator.
Thus, the role of P2 is dictated by both its own sequence and the inherent
properties of the surrounding DNA elements. The mechanisms of p53-mediated transcriptional repression are complex and not fully understood but include sequence nonspecific and sequence-specific mechanisms (26–38). Nonspecific repression includes binding to and interference with basal transcription factors, binding to an activator (e.g. SP-1 or AP-1), or competition for a co-activator. Sequence-specific repression includes direct DNA binding to a p53 response element, recruitment of a co-repressor (e.g. msin3·HDAC complex) and competition for binding with other transcription factors with overlapping binding sites. Our results indicate that TSA, a selective HDAC inhibitor, had no effect on P2-mediated repression. Thus, a direct role for HDAC in histone or p53 deacetylation does not appear to be a mechanism. This is not surprising, however, because not all p53-repressed genes are TSA-sensitive. We also tested the possibility that P1 and P2 compete for a common co-activator, such as CBP/p300. However, forced CBP expression in the absence of P2 had no additional influence on p53-mediated activation. This finding suggests that competition for CBP is not a contributing factor.
We further considered whether p53-mediated repression via P2 is determined by structural elements in the p53 protein itself. Hong et al. (41) have identified a minimal repression domain (p53MRD) that inhibits p53-mediated transcriptional activation. The MRD maps to an 8-amino acid (339–346) segment of the C-terminal of native p53. The function of this domain is selective for p53, because it did not affect VP16-mediated activation. Also, mutations of two amino acids, M340P and F341D, were sufficient to prevent p53-mediated repression of the thymidine kinase promoter. We introduced p53M340P/F341D into HeLa cells and determined its effects on transcription from the P2/P1 construct and its mutant derivatives. We reasoned that, if the p53MRD contributes to P2-mediated repression, then the mutant p53 should not have such an effect. The results showed that P2-mediated repression is maintained in the presence of p53M340P/F341D. Interestingly, the mutant p53 construct exhibited a weaker transcriptional activity than native p53, despite similar transfection efficiency. These results suggest that p53-mediated repression via P2 is not dependent on the p53MRD. Although the MRD is the site of E6 binding by the papilloma viral protein and HeLa cells express the E6 protein, impaired E6-p53 interactions cannot explain the loss of repression mediated by mutant p53MRD. p53MRD-mediated repression may be more relevant to non-sequence-specific repression seen with overexpression of p53 than to sequence-specific repression. For example, p53-mediated repression of the survivin gene is not affected by mutation or deletion within the C-terminal domain, including the MRD (36). In the case of the P2 element, our results clearly show that p53 acts in a sequence-specific manner, and maintained p53mRD function is therefore consistent with the survivin example.
An important finding of this study is that P2 mediates repression of BdkrB2 promoter regardless of whether or not P1 is present and irrespective of the spacing between P1 and P2. Also, because replacement of P2 with P1 or the p53 consensus sequence strongly activates transcription and mutagenesis of P2 increases its p53-binding activity and enhances transcription, we suggest that P2-mediated repression of the BdkrB2 promoter is sequence-dependent. Finally, because P2 represses constructs lacking P1, P2-mediated repression cannot simply be attributed to interference with P1 function. However, because P2 activates, rather than represses, a minimal TATA-reporter construct, we conclude that P2-mediated repression is context-dependent and suggest further that sequences within and surrounding the P2 site in the BdkrB2 promoter play a crucial role in the determination of P2 function as a repressor.
The present studies have also allowed us to identify a potential third
p53-response element in the BdkrB2 promoter. This is because the
promoter construct lacking both the P2 and P1 sites, i.e.
P2/P1, is activated by p53 (about 40% of P2/P1 activity).
Because the –635/P1 construct is not activated by p53, we
hypothesized that one or more additional p53-responsive elements reside
further upstream of nucleotide –635 of the BdkrB2 promoter.
Indeed, deletion of the upstream region extending from nt –1184 to
–827 in the P2/P1 construct abrogated p53-mediated
activation. Additional studies will need to be performed to fully characterize
this new p53-responsive element.
It is important to point out additional intrinsic similarities and
differences in the functional behavior of P1 and P2. For example, in gel shift
assays, P1 and P2 bind recombinant p53 with different affinities (P1 > P2).
Also, when tissue nuclear extracts are utilized, the intensity and migration
of protein·P1 complexes are strikingly different from those of
protein·P2; the P1 complexes exhibit higher affinity and slower
mobility than P2 complexes. Therefore, the conformation and/or composition of
the P1 and P2 DNA·protein complexes are likely different. In this
regard, it is tempting to speculate that binding of p53 to P1 favors DNA
looping promoting nucleation of the preinitiation complex or that P1 recruits
p53 along with a co-activator, whereas P2 does not. Another possibility that
is suggested by the EMSA results is that p53 competes with other transcription
factors (e.g. NF-B and KLF-4) for binding to the P2 element,
which may contribute to P2-mediated repression.
The physiological relevance of p53-mediated regulation of the BdkrB2 gene is just beginning to be elucidated. For example, during kidney development, p53 co-localizes with B2R in renal epithelial cells undergoing terminal differentiation, and nuclear p53 levels are much higher in developing than mature kidneys as are B2R levels (22, 40). Further, p53-deficient pups on C57BL6 background manifest ectopic B2R expression in the kidney (22). Thus, p53 may regulate the developmental spatiotemporal expression of the BdkrB2 gene. It is not clear, however, how the interplay between P1 and P2 modulates these processes. Whereas P1 is evolutionarily conserved between rat, mouse, and human, P2 is not. This raises the intriguing possibility that the BdkrB2 gene has acquired enhanced responsiveness to p53 during evolution. Perhaps P2 serves to restrict P1-mediated activation of the BdkrB2 gene during terminal differentiation.
In summary, the rat BdkrB2 gene represents a rare example of a mammalian gene that is reciprocally regulated by a single transcription factor via sequence-specific DNA binding. Although promoters with more than one functional p53-binding site have been described (e.g. p21 and cyclin G) (42), the presence of two functionally divergent p53-binding elements within the same promoter is a novel finding. This should offer a useful system to investigate how p53 activates or represses gene transcription in the context of the endogenous promoter. More importantly, this system may allow us to determine whether the divergent p53-mediated transcriptional responses are stimulus-dependent (e.g. DNA damage versus development).
|
FOOTNOTES |
|---|
Supported by postdoctoral National Research Service Award Training Grant
1F32
[PDB]
DK-61137.
To whom correspondence should be addressed: Dept. of Pediatrics, Tulane
University Health Sciences Center, SL-37, 1430 Tulane Ave., New Orleans, LA
70112. Tel.: 504-588-5377; Fax: 504-584-1852; E-mail:
seldahr{at}tulane.edu.
1 The abbreviations used are: AFP, -fetoprotein; BdkrB2 and
B2R, bradykinin type 2 receptor gene and protein, respectively;
CAT, chloramphenicol acetyl transferase; EMSA, electrophoretic gel mobility
shift assay; TSA, trichostatin A; CBP, cAMP response element binding protein
(CREB)-binding protein; MRD, minimal repression domain of p53; CRE,
cAMP-response element; CMV, cytomegalovirus; nt, nucleotide(s); HDAC, histone
deacetylase.
|
ACKNOWLEDGMENTS |
|---|
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONEXPERIMENTAL PROCEDURESRESULTSDISCUSSIONREFERENCES |
|---|
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  S. S. El-Dahr, K. Aboudehen, and Z. Saifudeen Transcriptional control of terminal nephron differentiation Am J Physiol Renal Physiol, June 1, 2008; 294(6): F1273 - F1278. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Kesarwani, J. Yoo, and X. Dong Genetic Interactions of TGA Transcription Factors in the Regulation of Pathogenesis-Related Genes and Disease Resistance in Arabidopsis Plant Physiology, May 1, 2007; 144(1): 336 - 346. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Shen, L. M. Harrison-Bernard, A. J. Fuller, V. Vanderpool, Z. Saifudeen, and S. S. El-Dahr The Bradykinin B2 Receptor Gene Is a Target of Angiotensin II Type 1 Receptor Signaling J. Am. Soc. Nephrol., April 1, 2007; 18(4): 1140 - 1149. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Van Bodegom, Z. Saifudeen, S. Dipp, S. Puri, B. S. Magenheimer, J. P. Calvet, and S. S. El-Dahr The Polycystic Kidney Disease-1 Gene Is a Target for p53-mediated Transcriptional Repression J. Biol. Chem., October 20, 2006; 281(42): 31234 - 31244. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Fan, J. Stefkova, and S. S. El-Dahr Susceptibility to metanephric apoptosis in bradykinin B2 receptor null mice via the p53-Bax pathway Am J Physiol Renal Physiol, September 1, 2006; 291(3): F670 - F682. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Zamorano, S. Suchindran, and J. V. Gainer 3'-Untranslated region of the type 2 bradykinin receptor is a potent regulator of gene expression Am J Physiol Renal Physiol, February 1, 2006; 290(2): F456 - F464. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Saifudeen, V. Diavolitsis, J. Stefkova, S. Dipp, H. Fan, and S. S. El-Dahr Spatiotemporal Switch from {Delta}Np73 to TAp73 Isoforms during Nephrogenesis: IMPACT ON DIFFERENTIATION GENE EXPRESSION J. Biol. Chem., June 17, 2005; 280(24): 23094 - 23102. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. M. Bates Transcriptional control of renal collecting duct development Am J Physiol Renal Physiol, May 1, 2005; 288(5): F897 - F898. [Full Text] [PDF]
|
|
