Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M301337200 on June 26, 2003

J. Biol. Chem., Vol. 278, Issue 37, 35024-35032, September 12, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/37/35024    most recent
M301337200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhao, Y.
Right arrow Articles by Hammarström, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhao, Y.
Right arrow Articles by Hammarström, L.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Physical Mapping of the Bovine Immunoglobulin Heavy Chain Constant Region Gene Locus*

Yaofeng Zhao {ddagger}, Imre Kacskovics §, Hodjattallah Rabbani ¶ and Lennart Hammarström {ddagger} ||

From the {ddagger}Center for Biotechnology, Department of Bioscience at Novum, Karolinska, Institutet, SE-14157, Huddinge, Sweden, the §Department of Physiology and Biochemistry, Faculty of Veterinary Science, Szent István University, H-1400, Budapest, Hungary, and the Immune and Gene Therapy Laboratory, Cancer Center Karolinska (CCK), Karolinska Hospital, SE-17176 Stockholm, Sweden

Received for publication, February 6, 2003 , and in revised form, June 9, 2003.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Bovine antibodies have recently attracted increasing attention, as they have been shown to exhibit prophylactic and therapeutic properties in selected infectious diseases in humans. In the present study, we have isolated bacterial artificial chromosomes and cosmid clones containing the bovine JH, µ, {delta}, {gamma}1, {gamma}2, {gamma}3, {epsilon}, and {alpha} genes, which allowed us to make a contig of the genes within the bovine IGHC locus. The genes are arranged in a 5'-JH–7 kb–µ–5 kb–{delta}–33 kb–{gamma}3–20 kb–{gamma}1–34 kb–{gamma}2–20 kb–{epsilon}– 13 kb–{alpha}-3' order, spanning ~150 kb DNA. Examination of the bovine germline JH locus revealed six JH segments, two of which, JH1 and JH2, were shown to be functional although there was a strong preference for expression of the former. Sequence alignment of the bovine 5' Eµ enhancer core region with those of other mammals, demonstrated an absence of the µE3 motif and a shortened spacer between the µA and µB sites within the bovine Eµ enhancer core region. Furthermore, the essential sequence element for class switching, switch µ, spanning ~3-kb repetitive sequence and abundant in the switch region motifs CTGGG (187 repeats) and CTGAG (127 repeats), was identified immediately upstream of the µ gene. A further sequence comparison revealed that the bovine IGHC genes display an extensive polymorphism leading to expression of multiple antibody allotypes.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The mammalian immunoglobulin heavy chain constant region gene (IGHC)1 loci have only been well characterized in humans and mice (1, 2). Five classes of immunoglobulin heavy chain constant region genes, µ, {delta}, {gamma}, {epsilon}, and {alpha} are present in both species, although the number of subclasses of {gamma} and {alpha} vary. The locus in the mouse (JH–µ–{delta}–{gamma}3–{gamma}1–{gamma}2b–{gamma}2a–{epsilon}–{alpha}) differs from that in the human (JH–µ–{delta}–{gamma}3–{gamma}1–{psi}{epsilon}2–{alpha}1–{psi}{gamma}–{gamma}2–{gamma}4–{epsilon}1–{alpha}2) due to a duplication during evolution of the latter. While six functional JH segments and 3 pseudogenes have been identified in the human JH locus (3), the corresponding locus in the mouse only contains four functional genes and two pseudogenes (4). In addition, 27 D segments (5) and 123 VH segments (of which 79 are pseudogenes) (6), have been identified by sequencing of the human VH and DH loci.

In ruminants such as cow and sheep, genes encoding µ, {delta}, {gamma}, {alpha}, {epsilon} have all been described (7–14). Like other mammalian species, multiple {gamma} genes, three in the cow (7, 11) and two in the sheep, have been identified (15), whereas the {alpha} and {epsilon} genes exist as single copy genes (7). The functional bovine IGHC genes have been assigned to the Bos taurus chromosome 21q23-q24 (16, 17), whereas the lambda light chain constant region gene maps to chromosome 17 (18). Interestingly, a bovine µ gene-like sequence, IGHML1, was previously detected on chromosome 11q23 (16, 19). Although all seven bovine IGHC genes have been shown to be transcriptionally active in vivo or in vitro, the {delta} and {gamma}3 genes are likely to be expressed at a very low level.

The bovine immunoglobulins have been shown to use a restricted set of VH genes (20), some of which contain unusually long CDR3 regions (21). In addition, an examination of all the available expressed bovine VH sequence in the NCBI GenBankTM suggests that only a single JH gene is employed.

Recently, bovine immunoglobulins, have attracted increasing attention, as they have been shown to exhibit prophylactic and therapeutic effects in selected infectious diseases in humans and animals (22–26). Transgenic calves, expressing human immunoglobulins, have also recently been generated (27), although the restricted transport of human immunoglobulins into colostrum/milk may limit their usefulness. In the present study, we have characterized the bovine IGHC gene locus, aiming to promote a better understanding of the evolution and expression of the mammalian IGHC genes.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Bovine BAC and Cosmid Libraries—Bovine IGHC gene-positive BAC clones were isolated from a previously constructed BAC library (28), which was generated using pBeloBAC11, a BAC vector. A bovine pWE15 cosmid library was purchased from Stratagene (La Jolla, CA). All screenings were carried out using a PCR procedure. The BAC and cosmid DNA was amplified in Escherichia coli, DH10B and XL1-Blue MR, respectively. The preparation of both BAC and cosmid DNA was performed using the Qiagen-tip 500 (Qiagen, Valencia, CA) following the protocol from the manufacturer. Bovine high molecular weight genomic DNA was isolated by phenol-chloroform extraction of proteinase K-digested blood samples.

Pulsed Field Gel Electrophoresis (PFGE) and Southern Blotting— PFGE was used to separate large DNA fragment (CHEF-DR, III system, Bio-Rad, Hercules, CA). The DNA was run in a 1% agarose gel in 0.5x TBE buffer (6 V/cm). The switch time was adjusted based on the size of DNA, according to the manufacturer's instruction. The separated DNA was transferred to nylon membrane for hybridization. An oligolabeling kit (Amersham Biosciences) was used to label the probes. All hybridizations were performed with ExpressHyb hybridization solution purchased from Clontech (Palo Alto, CA).

Long PCR Amplifications and Sequencing—All the long PCR reactions were performed on GeneAmp PCR system 9700 using an ExpandTM Long Template PCR system Kit (Roche Applied Science). Gene-specific primers were designed as following: bIgDS: 5'-AGC CCC ACA CTC GGT CCA TCA CAG A-3', bIgG3S: 5'-CAG TGT TCC AAA TGC CCA GGT AAG T-3', bIgG1As: 5'-TGA TGG GGA GAC TGG GTG ACT TAC G-3', bIgG1S: 5'-CGT AAG TCA CCC AGT CTC CCC ATC A-3', bIgG2As: 5'-CAG CCA TCC CCC TCC ACC CGC ACA C-3', bIgG2S: 5'-GAT GGC TGC CTT GGA TGA GTG AGA C-3', BACR7C7-Fs: 5'-CAC CTG CCT TTG CCC TGC TTT GTC T-3', BACR7C7-Fas: 5'-AGA CAA AGC AGG GCA AAG GCA GGT G-3', bIgELas1: 5'-TGG CTG GTG GTA ATG TAG AGA CTG G-3', bIgELs1: 5'-AAG AGG GGC GAT GAG TTC ACC TGC CAA GTG-3', bIgALas1: 5'-GCG GGA AGA TGC TGG GGC TGG TTT CAC TCT-3'. The two primers, BACSU (5'-GTC GCT GAT TTG TAT TGT CTG AAG T-3') and BACSL (5'-CGC CTG GTT GCT ACG CCT GAA TAA G-3') were derived from the BAC vector, pBeloBAC11. The common parameters for the PCR were 92 °C 2 min, followed by 10 cycles of 92 °C 10 s and 68 °C 14 min, then 20 cycles of 92 °C10 s, 68 °C for 14 min with 20-s increments per cycle were started, finally hold at 68 °C for 10 min. The extension time was adjusted according to the expected size of the PCR products. PCR products were separated on both the normal and PFGE agarose gels to determine their size. For sequencing, the PCR products were cloned into pGEM-T vector (Promega, Madison, CA) and sequencing reactions were performed by PCR using BigdyeTM Terminator Ready Reaction Kit (PerkinElmer, Foster, CA).

Cloning and Sequencing of the Bovine Sµ Region—A genomic fragment covering the JH and Cµ1 was amplified from BAC66R4C11, and subsequently digested with KpnI and XbaI. The resulting 4.2-kb XbaI-KpnI fragment was initially cloned into the pBluescript II KS(+) vector. The recombinant plasmid was cut again, using SacI and KpnI, to generate an 800-bp SacI fragment, and an ~3.4-kb SacI-KpnI fragment. As the 800-bp SacI fragment was directly cloned into pGEM-7Zf(+) for sequencing using T7 and Sp6 primers, the 3.4-kb SacI-KpnI fragment was inserted into pGEM-3Zf(+), and the insert was sequenced using the Erase-a-Base® System (Promega, Madison, WI).

JH Segment-specific PCR—JH segment-specific PCR was conducted to investigate whether the JH genes were functional. While the common forward primer bIgVH-leaders (P1 in Fig. 4, 5'-GCT CCA AGA TGA ACC CAC TGT G-3') is derived from the leader exon of the VH genes, both bIgJH1as (P2 in Fig. 4, 5'-GAG GAG ACG GTG ACC AGG AGT-3') and bIgJH2as (P3 in Fig. 4, 5'-GAG GAG ACG GTG ACC TCG ATC-3') are JH gene-specific primers. Both bovine genomic DNA (derived from blood, spleen, bone marrow) and cDNA (spleen) were employed as templates for PCR under conditions of 94 °C 3 min, then 30 cycles of 94 °C 30 s, 62 °C 30 s, 72 °C 40 s, finally hold at 72 °C for 10 min. The PCR products were separated on an agarose gel and subsequently transferred to nylon membranes for hybridization with a bovine VH gene fragment generated by PCR from a cloned IgD heavy chain cDNA (14) using primers bIgVH-hys (5'-GTG CAG CTG CGG GAG TCA-3') and bIgVH-hyas (5'-CTC AAC ATA AGG ACA AGC-3'). The VH gene fragment does not contain leader and JH sequences.



View larger version (45K):
[in this window]
[in a new window]
  		FIG. 4.
PCR amplifications of the bovine rearranged VDJ fragments. A, the strategy used for amplifications; B, the location and sequence of the JH1 and JH2 specific primers, P2 and P3. For the alignment of the bovine JH1 and JH2 sequences, identical sequences are indicated as stars, dash is used to adjust the sequences; C, PCR amplifications. C1, a, 1-kb DNA ladder; b, primers, P1 plus P2, template, spleen genomic DNA; c, primers: P1 plus P3, template: spleen genomic DNA; d, primers: P1 plus P2, template: blood genomic DNA; e, primers: P1 plus P3, blood genomic DNA; f, primers: P1 plus P2, template: spleen cDNA; g, primers: P1 plus P3, template: spleen cDNA. C2, a, 1-kb DNA ladder; b, primers: P1 plus P2, template: blood genomic DNA; c, primers: P1 plus P3, template: blood genomic DNA; d, primers: P1 plus P2, template: bone marrow genomic DNA; e, primers: P1 plus P3, template: bone marrow genomic DNA.

 

Computational Analysis of DNA Sequences—DNA sequence homology search was carried out using the NCBI BLAST program. Sequence alignment, editing and comparison, was performed using the MegAlign program (DNASTAR, Inc, Madison, WI). The dot plot comparison was performed using the same program.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
Screening of the Bovine BAC and Cosmid Library—Using a PCR screening strategy, 21 µ, 18 {gamma}3, 15 {epsilon}, and 1 {alpha} positive clones were isolated from the bovine pWE15 cosmid library. Out of these clones, six were shown to be positive for the µ, {delta}, and {gamma}3 genes, and one clone contained both the {epsilon} and {alpha} genes.

Four BAC clones were obtained by screening of a BAC library (28), where BAC66R4C11 contained the µ, {delta}, {gamma}3, {gamma}1 genes, BAC416R4C8 contained the µ, {delta}, and a part of the C{gamma}3 gene, BAC389R7C7 contained the {gamma}1 and {gamma}2 genes, while BAC412R7C5 contained only the {gamma}1 gene according to results based on Southern blotting and PCR analysis. The NotI-digested BAC DNAs were run on a PFGE agarose gel, showing the size of the respective inserts (185, 115, 55, and 45 kb in BAC66R4C11, BAC416R4C8, BAC389R7C7, and BAC412R7C5) (Fig. 1A).



View larger version (117K):
[in this window]
[in a new window]
  		FIG. 1.
PFGE electrophoresis of the digested BAC clones and long PCR products. A, digested BAC clones; 1, 1-kb DNA ladder; 2, 5-kb DNA ladder; 3, BAC66R4C11/NotI; 4, BAC389R7C7/NotI; 5, BAC412R7C5/NotI; 6, BAC416R4C8/NotI; 7, BAC416R4C8/NotI+Mlu I; 8, 5-kb DNA ladder. B, long PCR products; 1, 1-kb DNA ladder; 2, BACR7C7-Fas plus bIgELas1; 3, bIgELs1 plus bIgALas1; 4, 5-kb DNA ladder.

 

The Bovine IGHC Gene Locus Is Arranged in an Order of 5'-µ–{delta}–{gamma}3–{gamma}1–{gamma}2–{epsilon}–{alpha}-3'—Since it was already known that the µ and {delta} genes are situated most 5' in the bovine IGHC gene locus (7, 14), the co-existence of the µ, {delta}, and {gamma}3 genes in some BAC and cosmid clones suggested that the {gamma}3 gene may be the first constant region gene located downstream of the {delta} gene. As BAC66R4C11 contained the µ, {delta}, {gamma}3, {gamma}1 genes and BAC389 R7C7 contained the {gamma}1 and {gamma}2 genes, it could be concluded that the genes were arranged in a µ–{delta}–{gamma}3–{gamma}1–{gamma}2 order. Consistent with a previous publication (7), the {epsilon} and {alpha} gene were both detected in a cosmid clone, supporting the notion that the bovine IGHC gene locus is structurally similar to that of the mouse, where the {epsilon} and {alpha} genes are situated in the most 3'-portion of the locus. Although we did not obtain any BAC or cosmid clones containing both the {gamma}2 and {epsilon} genes, the bovine IGHC gene locus is thus most likely arranged in a 5'-µ–{delta}–{gamma}3–{gamma}1–{gamma}2–{epsilon}–{alpha}-3' order on chromosome 21q23-q24.

Determination of the Distances between the Bovine IGHC Genes—To determine the size of the bovine IGHC gene locus, the approximate length of the introns between the bovine IGHC genes was analyzed using long PCR amplifications and pulse field gel electrophoresis (PFGE).

Using the primers bIgDS and bIgG3As, bIgG3S and bIgG1as, and BAC66R4C11 as a template, 33 and 22 kb PCR products could be obtained, suggesting that the {gamma}3 gene is located ~33 kb downstream of the {delta} gene, followed by the {gamma}1 gene, ~20 kb further downstream.

We failed to PCR amplify the DNA fragment between the {gamma}1 and {gamma}2 genes using BAC389R7C7, possibly reflecting a long distance between the two genes. To circumvent this problem, we amplified the DNA fragments between the BAC vector cloning sites and the two genes, where, as shown in Fig. 2B, the presence of an ~34-kb intron between the {gamma}1 and {gamma}2 genes could be deduced based on the PCR results.



View larger version (17K):
[in this window]
[in a new window]
  		FIG. 2.
Physical mapping of the bovine IGHC gene locus. A, a physical map of the bovine IGHC gene locus. B, structural analysis of BAC389R7C7.

 

Analysis of the {epsilon} and {alpha} gene positive cosmid clone also using long PCR amplifications, allowed us to determine the size of the {epsilon}-{alpha} intron, which was ~13 kb. As the cosmid and BAC libraries were constructed using different cow strains, long PCR was performed using genomic DNA isolated from blood of an Angus cow, the strain employed to construct the BAC library (28). The amplification generated a ~14-kb (Fig. 1B3) band, which was consistent with the analysis of the cosmid clone. These two results also confirmed previous data from analysis of overlapping phage clones (7).

As we did not obtain any clone that contained both the {gamma}2 and {epsilon} genes, there was an obvious difficulty to determine the distance between the two genes. However, a comparison with the physical maps of the human and mouse IGHC gene loci, suggested that a less than 25-kb {gamma}2-{epsilon} intron would be expected. Therefore, we attempted to amplify the intron fragment employing a long PCR kit under stringent conditions, using bovine genomic DNA as a template. A weak 20-kb PCR fragment was seen after separating the PCR reactions on an agarose gel, indicating that the size of the bovine {gamma}2-{epsilon} intron is probably not largely different from those of humans and mice. To confirm this conclusion, we analyzed the clone BAC389R7C7, which was found to contain ~8 kb of sequence downstream of the {gamma}2 gene. We thus sequenced BAC389R7C7 from its 3' end to close to the {gamma}2 gene and designed a new primer BACR7C7-Fas, which was based on the sequence ~8-kb downstream of the {gamma}2 gene. The primers BACR7C7-Fas and bIgELas1 yielded a 13-kb PCR product when using the bovine genomic DNA (Angus) as a template (Fig. 1B2), suggesting that the size of the {gamma}2-{epsilon} intron is ~20 kb.

Thus, in summary, the bovine IGHC gene locus is arranged sequentially in the following order: 5'-µ–5 kb–{delta}–33 kb–{gamma}3–20 kb–{gamma}1–34 kb–{gamma}2–20 kb–{epsilon}–13 kb–{alpha}-3', spanning roughly 150 kb contiguous DNA on chromosome 21 (Fig. 2A).

The Three {gamma} Genes Can All Be Functionally Expressed but at Different Levels—It is well known that the {gamma}1 and {gamma}2 genes are functionally expressed at the protein level, as both the IgG1 and IgG2 can be detected in bovine serum (29). The {gamma}3 gene has only shown to be functionally expressed in vitro (7), but the gene can be at least transcribed in vivo, as the {gamma}3 encoding cDNA could be cloned from a bovine spleen cDNA library (12).

A large bovine EST data base containing ~319,775 EST clones (Jun 8, 2003), is available in NCBI GenBankTM. Principally, the abundance of genes in the EST data base would roughly reflect their transcriptional levels, as almost all sequences in the EST data base have been obtained by sequencing of randomly picked clones from cDNA libraries. Although the EST sequences are derived from a variety of tissues, we do not expect transcription of immunoglobulin genes in non-lymphoid cells. By searching the NCBI bovine EST data base, more than 55 {gamma}1, 27 {gamma}2, and 11 {gamma}3 EST clones were identified. In addition, 35 clones were found that could not unambiguously be identified as {gamma}1 or {gamma}2. These data indicate that the {gamma}3 gene is transcribed at a lower level than those of the other {gamma} genes. In addition, more than 82 µ, 5 {delta}, 74 {alpha}, and 2 {epsilon} EST clones could be identified in the data base, suggesting that both the {delta} and {epsilon} genes are expressed at very low levels in cows.

The Bovine JH Locus Has Two Functional JH Genes—To analyze the bovine JH germline sequence and 5' Eµ intronic enhancer region, a ~7-kb DNA fragment, spanning a part of the JH locus and Cµ from the BAC clone 66R4C11 was amplified and sequenced (AY158087 [GenBank] ). Another 2.6 kb further up-stream sequence was also cloned to ensure that the germline JH locus was identified in its entirety. In the ~2 kb of sequence (AY158087 [GenBank] ), only two potentially functional JH genes, termed JH1 and JH2, were identified, 862 bp apart, encoding 15 and 17 amino acids respectively (Fig. 3). The two JH segments share a five amino acid motif, VTVSS, at their 3'-ends.



View larger version (67K):
[in this window]
[in a new window]
  		FIG. 3.
The bovine germline JH genomic sequence. The pseudo-JH genes, JH-PS1, JH-PS2, JH-PS3, and JH-PS4 are numbered to be consistent with the sheep JH locus (30). The potential RSS sites are underlined. The numbering of the sequences is according to our submitted data (accession number: AY158087 [GenBank] ).

 

A BLAST search of the NCBI GenBankTM and bovine EST data base suggests that the JH1 is the only JH used in hitherto reported bovine VH sequences. More than 84 clones in the NCBI GenbankTM, and 150 clones from the bovine EST data base were found to contain the JH1 segment, suggesting that the JH2 may represent a pseudogene. However, a close examination of the flanking sequences of JH1 and JH2 shows that they exhibit almost the same 5'-recombination signal sequences and 3'-donor splice sites, although a large sequence difference can be observed in the spacer regions between the heptamer and nonamer. To prove whether the JH2 gene is at all functional or not in vivo, bovine genomic DNA and cDNA were both subjected to JH specific PCR as indicated in Fig. 4. Primer P1 (bIgVH-Leaders) is derived from the leader exon of the bovine VH genes and supposed to be conserved within most expressed bovine VH genes based on a comparison of VH sequences (data not shown). The two JH-specific primers, P2 (bIgJH1as) and P3 (bIgJH2as) were designed based on the JH1 and JH2 sequences (Fig. 4B). Theoretically, if VH and DH genes recombine to the JH1 gene, the primer combination P1 and P2 should generate ~500-bp PCR products (Fig. 4A1). In this case, the primer combination P1 and P3 should also be able to yield ~1.3-kb PCR products (Fig. 4A1). On the other hand, if the JH2 gene is functional in vivo and a recombination of VH and DH genes to the JH2 occurs, the primers P1 and P3 would also amplify ~500 bp rearranged genomic VDJ fragments (Fig. 4A2). As shown in Fig. 4C, the PCR results clearly showed that at the genomic level, VH and DH genes recombine to both the JH1 and JH2 genes in bovine B cells. However, the recombination rate to the JH2 is much lower than that of the JH1 according to the intensity of the PCR bands generated using bovine spleen, blood, and bone marrow genomic DNA as templates (Fig. 4C). Both the recombined VDJH1 and VDJH2 genomic fragments can be normally transcribed and spliced, as we could amplify VDJH1 and VDJH2 fragments at the cDNA level. The nature of the PCR products in Fig. 4C was proven by hybridization using a bovine VH gene probe (data not shown). These data thus indicate that the JH2 is expressed but at a low level.

Four ovine JH pseudogenes have previously been identified in a ~2-kb DNA region containing the two functional JH genes (30). In the bovine JH locus, there are also four JH pseudogenes corresponding to the ovine JH segments (Fig. 3), where the RSS and 3'-donor splice sites for the four pseudo-JH segments have diverged from the canonical sequences (Table I).


View this table:
[in this window]
[in a new window]
  		TABLE I
RSS and splice sites for the bovine JH genes

 

The Bovine 5' Ig Intronic Enhancer—The putative bovine 5' Eµ intronic enhancer was identified through a comparison of the bovine JH-Cµ intron sequence with other well studied mammalian Eµ enhancers. As shown in Fig. 5A, the bovine 5' Eµ enhancer core region shows a conserved organization, where several nuclear binding motifs, µE1–µE5–µE2–µA–µB–µE4–O (octamer motif), are tightly clustered in a very short region. The most striking feature of the bovine 5' enhancer core region is that the space between the µA and µB motifs is shorter than in other mammalian 5' Eµ enhancers (Fig. 5B). Furthermore, AT-rich sequences, which are supposed to be matrix attachment region (MAR), could be identified at either side of the bovine Eµ enhancer core region as previously noted both in humans and mice.



View larger version (40K):
[in this window]
[in a new window]
  		FIG. 5.
The bovine 5' Eµ intronic enhancer region. A, the germline sequence of the bovine 5' Eµ intronic enhancer. The nuclear factor binding sites are underlined and in bold. The numbering of the sequence is according to our submitted data (GenBankTM accession number: AY158087 [GenBank] ); B, a comparison of mammalian 5' Eµ intronic enhancer core regions. The bovine sequence is presented in this study and the ovine sequence is derived from the NCBI GenBankTM (Z98207 [GenBank] ), all other sequences are taken from Refs. 35, 43, 46, and 47. The nuclear factor binding sites are underlined and in bold. Identical nucleotides are indicated as stars, dash is used to adjust the sequence alignment.

 

Characterization of the Bovine Switch mu (Sµ) Region—The Sµ region is located upstream of the Cµ gene in mammals. The region is involved in switching to the production of other antibody classes, downstream of the Cµ, through non-homologous recombination. A dot plot analysis of the bovine JH-Cµ genomic intron revealed a ~3-kb repetitive region (4380–7380, accession number: AY158087 [GenBank] ) abundant in switch region motifs (CTGGG and CTGAG) similar to both the human and mouse Sµ regions (Fig. 6, A, D, and E). The 3-kb bovine Sµ, containing ~187 CTGGG and 127 CTGAG repeats, is slightly shorter than the human Sµ(3.5 kb) but double as long as the mouse Sµ(1.5 kb). The longest repeats that contain the 123-bp DNA fragment (5865–5987, 6053–6175, accession number: AY158087 [GenBank] ). Another 87-bp long repeat is located from 5918 to 6004 and again from 6012 to 6098. In addition, a 24-bp long sequence (GGCAGAGTGGGTGAGCTGGGCTGA) appears dispersed as 9 repeats within the bovine Sµ.



View larger version (41K):
[in this window]
[in a new window]
  		FIG. 6.
Dot plot analysis of the bovine JH-Cµ intron sequence. A, a self-comparison of the bovine sequence, window: 30, percentage: 80; B, a dot plot comparison of the bovine JH-Cµ intron with its reverse complementary sequence, window: 30, percentage: 65; C, a dot plot comparison of the bovine JH-Cµ intron with the bovine Cµ-C{delta} intron sequences, window: 30, percentage: 80; D, a dot plot comparison of the bovine sequence with the human JH-Cµ sequence, window: 30, percentage: 85; E, a dot plot comparison of the bovine JH-Cµ intron with the mouse sequence, window: 30, percentage: 80.

 

It was previously proposed that immunoglobulin switch regions are rich in palindromic and stem-loop structures, which serve as targets of switch recombination (31). A dot plot comparison of the bovine JH-Cµ intron and its reverse complementary sequence indicates that the bovine Sµ is indeed abundant in palindromic sequences (Fig. 6B).

Bovine Immunoglobulin Allotypes—The bovine IGHC gene sequences obtained in this study were found to contain polymorphic sequences as compared with previously published cDNA or genomic DNA, suggesting allotypic variants. Most strikingly, a bovine {delta} heavy chain cDNA transcript lacking the {delta}CH2 exon, probably resulting from alternative RNA splicing, was identified based on RT-PCR amplification of bovine spleen-derived RNA (32), indicating that there could be two different IgD molecules expressed on the surface of the bovine B cells. The CH2 domain, lacking IgD molecule has previously been only found in rodents (where the CH2-encoding exon has been deleted in the rodent germline {delta} sequences). The biological significance of the co-presence of these two IgD heavy chain molecules in cows remains unclear.

We have previously reported the genomic sequences of both the bovine µ and {epsilon} genes (8, 13). Extensive DNA polymorphisms, as summarized in Table II, were found in the coding regions of both genes. Furthermore, sequence variants of the {gamma}1 and {gamma}2 hinge regions were also identified based on a BLAST search of the bovine ETS data base at NCBI (Fig. 7).


View this table:
[in this window]
[in a new window]
  		TABLE II
Polymorphism of the µ and {epsilon} genes

The sequence positions are based on the µ (derived from BAC66R4C11, GenBank® accession number: AY230207 [GenBank] ) and {epsilon} sequences (GenBank® accession number, AY221098 [GenBank] ) which have been deposited into the NCB1 GenBank®. {Delta} denotes deletion.

 


View larger version (7K):
[in this window]
[in a new window]
  		FIG. 7.
The hinge region sequences of the bovine {gamma} genes. A, hinge region variation of the {gamma}1, {gamma}1a (10) (also exhibited by EST clones, BE753591 [GenBank] , BG688263 [GenBank] , BE477968 [GenBank] , BG691099 [GenBank] ), {gamma}1b (11) (also exhibited by EST clones, BF231464 [GenBank] , BG691729 [GenBank] ), {gamma}1c (EST clones, BE479646 [GenBank] , BG692664 [GenBank] ), {gamma}1d (EST clone, BG691650 [GenBank] ). B, {gamma}2a (11) (EST clones, BG691685 [GenBank] , CA034906 [GenBank] , BE480883 [GenBank] ), {gamma}2b (EST clones, BE484750 [GenBank] , BE589048 [GenBank] , BG692303 [GenBank] , AW669600 [GenBank] , BE483848 [GenBank] ).

 


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
The combination of restriction mapping of bovine IGHC genes, positive BAC clones and long PCR amplifications, have allowed us to conclude that the bovine IGHC gene locus is contained within an ~150 kb contiguous DNA as a gene cluster (5'-JH–7 kb–µ–5.1 kb–{delta}–33kb–{gamma}3–20 kb–{gamma}1–34 kb–{gamma}2–20 kb–{epsilon}–13 kb–{alpha}-3'), which essentially resembles the structure of the human and the mouse IGHC gene loci. Consistent with the lesser number of genes however, the bovine IGHC locus is smaller in size than that of human (~350 kb) and mouse (~200 kb) (1, 2).

Investigations on the human IGHC locus, suggests that duplications of entire genes or even a large block of DNA has occurred during its evolution. Interestingly, duplication of individual exon sequences has also recently been observed within the bovine locus (14). The transposition of these exons probably occurred through a process involving reverse transcription and re-integration into the genome and may help explain the location of a Cµ gene like sequence on chromosome 11 (16, 17).

Several publications have suggested that there may be four subclasses of {gamma} genes in the bovine IGHC locus (7, 11). However, we could only identify three {gamma} genes using the available BAC library, as the results derived from Southern blotting and sequencing of PCR products clearly showed that both the BAC66R4C11 and BAC389R7C7 contained the {gamma}1 and one additional {gamma} gene ({gamma}3 and {gamma}2, respectively). Furthermore, as indicated in Fig. 2, there is only ~12 kb DNA that is not covered by the BAC389R7C7 and Cosmid 3 clones. Hybridization of this region with a {gamma} probe did not generate a positive signal, indicating that the suggested fourth {gamma} gene is most probably a polymorphic allele of {gamma}1, {gamma}2, or {gamma}3.

The number of {gamma} genes in mammals varies from one in the rabbit (33), two in sheep (15), three in cow (7), and four in human (34), mouse and rat (2, 35), to 6 in horse (36), suggesting that duplication of the {gamma} gene has occurred at different time points during evolution of the IGHC locus in mammals. As only {gamma}1 and {gamma}2 have been identified in sheep, it is likely that the bovine {gamma}3 gene appeared after the speciation of cows and sheep ~20 million years ago (37). The bovine {gamma}1 gene is most probably the ancestral gene, since it shows an 87.1% similarity to the ovine {gamma}1 at the protein level, which is higher than the similarity between the {gamma}2 in the two species (79.8%). This suggests that, during evolution, the {gamma}1 gene was initially duplicated to form the {gamma}2 gene, then later again duplicated in the cow to generate the {gamma}3 gene. This notion is supported by the greater homology of the {gamma}3 gene with the {gamma}1 gene (85.1%) than with the {gamma}2 gene (83.4%).

The dot plot comparison of the bovine JH-Cµ with that of human and mouse shows that the region from JH locus to the Eµ enhancer, despite some discontinuous sequences with a low degree of homology, is still largely linear (Fig. 6, D and E), indicating a common origin for the mammalian JH and Eµ loci. The JH gene locus, partially contributing to the diversity of the immunoglobulins, has however diverged in mammals not only with regard to the sequences but also the number of the JH genes. The latter vary from only one in pigs (38), four in mice (4), to six in humans and rabbits (3, 39). The bovine JH locus is quite similar to the locus in another ruminant species, the sheep (30). Both loci contain four pseudogenes with abnormal RSS or without normal 3'-splicing sites in addition to the two functional JH genes. An interesting point regarding the JH genes in both ruminant species is that the JH1 gene appears to be extremely preferentially used. The mechanism mediating the quantitatively selective recombination is however not clear as yet. A sequence examination of JH genes and their flanking sequences in cow and sheep did not provide a clue as to why the JH2 gene is only rarely involved in VDJ recombination even in B cells of bone marrow. A possible explanation might be found at the protein level, as the amino-terminal sequence of the FR4 portion contributed by the JH sequence contains an invariant Trp followed by GXG (where X is frequently Gln, Pro, or Ala but rarely Arg) (40). However, in the JH2 sequence presented in this study, the Trp is replaced by a Cys, probably resulting in a nonfunctional protein sequence. It is however not known whether the JH2 is employed more frequently in fetal stages, as a varied utilization pattern of JH genes in human and mouse has been demonstrated during different developmental stages (41–43).

Comparison of the JH locus sequence obtained in this study with the sequence derived from NCBI GenBankTM (accession number: AY149283 [GenBank] ) suggests that the bovine JH locus is highly polymorphic in different breeds or individuals. All the six JH genes in the two haplotypes differ from each other. Strikingly, the two functional JH genes, JH1 and JH2, showed even greater sequence diversities from their corresponding genes than the four JH pseudogenes. The bovine VH sequences deposited in the NCBI GenBankTM (including the EST data base) showed a highly biased usage of the JH1 gene as described in this study. However, neither the JH1 nor JH2 corresponding genes in the previously reported haplotype (accession number: AY149283 [GenBank] , denoted as JH4 and JH6) could be observed in rearranged bovine VH sequences in the public data base. However, the sequence submitter pointed out that the JH6 (corresponding to the JH2 gene in this study) could be detected in bovine heavy chain cDNA at a low frequency, indicating that the bovine JH genes might be expressed in a haplotype-dependent manner.

Sequence comparison of mammalian µ enhancer core regions shows highly conserved µA and µB motifs. Although the µE3 motif found in the mouse and rat enhancers, located between the µA and µB, is absent in enhancers cloned from human, rabbit, sheep and cow, the number of nucleotides between the µA and µB sites (n = 18), which has been shown to be essential for the activity of the µ enhancer in B cells (44), are invariant in human, rabbit, rodents and sheep. However, in the cow, the µA and µB sites are separated by 9 nucleotides only (Fig. 5B). It is however still unclear whether this deletion has some functional significance.

Another interesting point associated with the bovine µ enhancer was identified through comparison of the JH-Cµ and Cµ-C{delta} introns. We have previously shown that a duplication of the µCH1 exon and up to 4 kb upstream sequence, replaced the pre-existing {delta} gene ~20 million years ago (14). The duplication spans from the 3' flanking region of the bovine 5' Eµ enhancer to the 3'-end of µCH1 exon, but does not encompass the enhancer core region (Fig. 6C). In some extant primitive vertebrates such as channel catfish (Ictalurus punctatus), it was previously shown that a functional µ enhancer was located downstream of the Cµ gene (45). This finding has been taken as evidence that the current mammalian 5' Eµ enhancer was originally transposed or duplicated from the 3'-end of the Cµ gene (46). The search for 5' Eµ enhancer motifs in the bovine Cµ-C{delta} intron did however not show any remnants of an enhancer core region, supporting the concept that the placement of a functional µ enhancer in the 5'-end of the IGHC locus is essential for the expression of the mammalian IGHC genes through class switch recombination.

In summary, mapping of the bovine IGHC gene locus indicated that mammalian IGHC gene loci exhibit a roughly similar organization, but differ in ways that have created the immunoglobulin diversities in different species.


   FOOTNOTES
 
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EBI Data Bank with accession number(s) AY158087 [GenBank] , AY221098 [GenBank] , and AY230207 [GenBank] .

* This work was supported by the Swedish Research Council. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

|| To whom correspondence should be addressed: Center for Biotechnology, Novum, SE-14157 Huddinge, Sweden. Tel.: 46-8-6089115; Fax: 46-8-7745538; E-mail: lennart.hammarstrom{at}biosci.ki.se.

1 The abbreviations used are: IGHC, immunoglobulin heavy chain constant region; BAC, bacterial artificial chromosome; PFGE, pulsed field gel electrophoresis; EST, expressed sequence tag. Back



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Hofker, M. H., Walter, M. A., and Cox, D. W. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 5567–5571[Abstract/Free Full Text]
  2. Shimizu, A., Takahashi, N., Yaoita, Y., and Honjo, T. (1982) Cell 28, 499–506[CrossRef][Medline] [Order article via Infotrieve]
  3. Ravetch, J. V., Siebenlist, U., Korsmeyer, S., Waldmann, T., and Leder, P. (1981) Cell 27, 583–591[CrossRef][Medline] [Order article via Infotrieve]
  4. Sakano, H., Maki, R., Kurosawa, Y., Roeder, W., and Tonegawa, S. (1980) Nature 286, 676–683[CrossRef][Medline] [Order article via Infotrieve]
  5. Corbett, S. J., Tomlinson, I. M., Sonnhammer, E. L., Buck, D., and Winter, G. (1997) J. Mol. Biol. 270, 587–597[CrossRef][Medline] [Order article via Infotrieve]
  6. Matsuda, F., Ishii, K., Bourvagnet, P., Kuma, K., Hayashida, H., Miyata, T., and Honjo, T. (1998) J. Exp. Med. 188, 2151–2162[Abstract/Free Full Text]
  7. Knight, K. L., Suter, M., and Becker, R. S. (1988) J. Immunol. 140, 3654–3659[Abstract]
  8. Mousavi, M., Rabbani, H., Pilstrom, L., and Hammarstrom, L. (1998) Immunology 93, 581–588[CrossRef][Medline] [Order article via Infotrieve]
  9. Brown, W. R., Rabbani, H., Butler, J. E., and Hammarstrom, L. (1997) Immunology 91, 1–6[CrossRef][Medline] [Order article via Infotrieve]
  10. Kacskovics, I., and Butler, J. E. (1996) Mol. Immunol. 33, 189–195[CrossRef][Medline] [Order article via Infotrieve]
  11. Symons, D. B., Clarkson, C. A., and Beale, D. (1989) Mol. Immunol. 26, 841–850[CrossRef][Medline] [Order article via Infotrieve]
  12. Rabbani, H., Brown, W. R., Butler, J. E., and Hammarstrom, L. (1997) Immunogenetics 46, 326–331[CrossRef][Medline] [Order article via Infotrieve]
  13. Mousavi, M., Rabbani, H., and Hammarstrom, L. (1997) Immunology 92, 369–373[CrossRef][Medline] [Order article via Infotrieve]
  14. Zhao, Y., Kacskovics, I., Pan, Q., Liberles, D. A., Geli, J., Davis, S. K., Rabbani, H., and Hammarstrom, L. (2002) J. Immunol. 169, 4408–4416[Abstract/Free Full Text]
  15. Clarkson, C. A., Beale, D., Coadwell, J. W., and Symons, D. B. (1993) Mol. Immunol. 30, 1195–1204[CrossRef][Medline] [Order article via Infotrieve]
  16. Tobin-Janzen, T. C., and Womack, J. E. (1992) Immunogenetics 36, 157–165[CrossRef][Medline] [Order article via Infotrieve]
  17. Chowdhary, B. P., Fronicke, L., Gustavsson, I., and Scherthan, H. (1996) Mamm Genome 7, 297–302[CrossRef][Medline] [Order article via Infotrieve]
  18. Tobin-Janzen, T. C., and Womack, J. E. (1996) Anim. Biotechnol. 7, 163–172
  19. Hayes, H. C., and Petit, E. J. (1993) Mamm. Genome 4, 207–210[CrossRef][Medline] [Order article via Infotrieve]
  20. Sinclair, M. C., Gilchrist, J., and Aitken, R. (1997) J. Immunol. 159, 3883–3889[Abstract]
  21. Berens, S. J., Wylie, D. E., and Lopez, O. J. (1997) Int. Immunol. 9, 189–199[Abstract/Free Full Text]
  22. Hammarstrom, L., Gardulf, A., Hammarstrom, V., Janson, A., Lindberg, K., and Smith, C. I. (1994) Immunol. Rev. 139, 43–70[CrossRef][Medline] [Order article via Infotrieve]
  23. Weiner, C., Pan, Q., Hurtig, M., Boren, T., Bostwick, E., and Hammarstrom, L. (1999) Clin. Exp. Immunol. 116, 193–205[CrossRef][Medline] [Order article via Infotrieve]
  24. Korhonen, H., Marnila, P., and Gill, H. S. (2000) Br. J. Nutr. 84, Suppl. 1, S135–S146
  25. Lilius, E. M., and Marnila, P. (2001) Curr. Opin. Infect. Dis. 14, 295–300[Medline] [Order article via Infotrieve]
  26. Casswall, T. H., Nilsson, H. O., Bjorck, L., Sjostedt, S., Xu, L., Nord, C. K., Boren, T., Wadstrom, T., and Hammarstrom, L. (2002) Scand. J. Gastroenterol. 37, 1380–1385[CrossRef][Medline] [Order article via Infotrieve]
  27. Kuroiwa, Y., Kasinathan, P., Choi, Y. J., Naeem, R., Tomizuka, K., Sullivan, E. J., Knott, J. G., Duteau, A., Goldsby, R. A., Osborne, B. A., Ishida, I., and Robl, J. M. (2002) Nat. Biotechnol. 20, 889–894[CrossRef][Medline] [Order article via Infotrieve]
  28. Cai, L., Taylor, J. F., Wing, R. A., Gallagher, D. S., Woo, S. S., and Davis, S. K. (1995) Genomics 29, 413–425[CrossRef][Medline] [Order article via Infotrieve]
  29. Butler, J. E., and Heyermann, H. (1986) Mol. Immunol. 23, 291–296[CrossRef][Medline] [Order article via Infotrieve]
  30. Dufour, V., and Nau, F. (1997) Immunogenetics 46, 283–292[CrossRef][Medline] [Order article via Infotrieve]
  31. Tashiro, J., Kinoshita, K., and Honjo, T. (2001) Int. Immunol. 13, 495–505[Abstract/Free Full Text]
  32. Tucker, P. W., Liu, C. P., Mushinski, J. F., and Blattner, F. R. (1980) Science 209, 1353–1360[Abstract/Free Full Text]
  33. Knight, K. L., Burnett, R. C., and McNicholas, J. M. (1985) J. Immunol. 134, 1245–1250[Abstract]
  34. Flanagan, J. G., and Rabbitts, T. H. (1982) Nature 300, 709–713[CrossRef][Medline] [Order article via Infotrieve]
  35. Bruggemann, M., Free, J., Diamond, A., Howard, J., Cobbold, S., and Waldmann, H. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 6075–6079[Abstract/Free Full Text]
  36. Wagner, B., Greiser-Wilke, I., Wege, A. K., Radbruch, A., and Leibold, W. (2002) Immunogenetics 54, 353–364[CrossRef][Medline] [Order article via Infotrieve]
  37. Kumar, S., and Hedges, S. B. (1998) Nature 392, 917–920[CrossRef][Medline] [Order article via Infotrieve]
  38. Butler, J. E., Sun, J., and Navarro, P. (1996) Int. Immunol. 8, 1897–1904[Abstract/Free Full Text]
  39. Becker, R. S., Zhai, S. K., Currier, S. J., and Knight, K. L. (1989) J. Immunol. 142, 1351–1355[Abstract]
  40. Kabat, E. A., Wu, T. T., Perry, H. M., Gottesman, K. S., and Foeller, C. (1991) Sequence of Proteins of Immunological Interest, 5th Ed., U. S. Government Printing Office, Bethesda, MD
  41. Yamada, M., Wasserman, R., Reichard, B. A., Shane, S., Caton, A. J., and Rovera, G. (1991) J. Exp. Med. 173, 395–407[Abstract/Free Full Text]
  42. Cuisinier, A. M., Gauthier, L., Boubli, L., Fougereau, M., and Tonnelle, C. (1993) Eur. J. Immunol. 23, 110–118[Medline] [Order article via Infotrieve]
  43. Bangs, L. A., Sanz, I. E., and Teale, J. M. (1991) J. Immunol. 146, 1996–2004[Abstract]
  44. Nikolajczyk, B. S., Nelsen, B., and Sen, R. (1996) Mol. Cell. Biol. 16, 4544–4554[Abstract]
  45. Magor, B. G., Wilson, M. R., Miller, N. W., Clem, L. W., Middleton, D. L., and Warr, G. W. (1994) J. Immunol. 153, 5556–5563[Abstract]
  46. Magor, B. G., Ross, D. A., Pilstrom, L., and Warr, G. W. (1999) Immunol. Today 20, 13–17[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Immunol.Home page
I. Achour, P. Cavelier, M. Tichit, C. Bouchier, P. Lafaye, and F. Rougeon
Tetrameric and Homodimeric Camelid IgGs Originate from the Same IgH Locus
J. Immunol., August 1, 2008; 181(3): 2001 - 2009.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
Y. Zhao, Q. Pan-Hammarstrom, S. Yu, N. Wertz, X. Zhang, N. Li, J. E. Butler, and L. Hammarstrom
Identification of IgF, a hinge-region-containing Ig class, and IgD in Xenopus tropicalis
PNAS, August 8, 2006; 103(32): 12087 - 12092.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
Y. Ohta and M. Flajnik
IgD, like IgM, is a primordial immunoglobulin class perpetuated in most jawed vertebrates
PNAS, July 11, 2006; 103(28): 10723 - 10728.
[Abstract] [Full Text] [PDF]

Home page
 Int ImmunolHome page
A. Hosseini, G. Campbell, M. Prorocic, and R. Aitken
Duplicated copies of the bovine JH locus contribute to the Ig repertoire
Int. Immunol., June 1, 2004; 16(6): 843 - 852.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/37/35024    most recent
M301337200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhao, Y.
Right arrow Articles by Hammarström, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhao, Y.
Right arrow Articles by Hammarström, L.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement