Originally published In Press as doi:10.1074/jbc.M208033200 on October 22, 2002
J. Biol. Chem., Vol. 278, Issue 4, 2533-2540, January 24, 2003
Calcium Signaling in Excystation of the Early Diverging
Eukaryote, Giardia lamblia*
David S.
Reiner
,
Michael L.
Hetsko
,
J. Gary
Meszaros§¶,
Chin-Hung
Sun
,
Hilary G.
Morrison**,
Laurence L.
Brunton§, and
Frances D.
Gillin

§§
From the
Department of Pathology and the
§ Department of Pharmacology,

Center for Molecular Genetics, University
of California, San Diego, California 92103 and ** The
Josephine Bay Paul Center for Comparative Molecular Biology and
Evolution, Marine Biological Laboratory,
Woods Hole, Massachusetts 02543-1015
Received for publication, August 7, 2002, and in revised form, October 21, 2002
 |
ABSTRACT |
Excystation of Giardia lamblia, which
initiates infection, is a poorly understood but dramatic
differentiation induced by physiological signals from the host. Our
data implicate a central role for calcium homeostasis in excystation.
Agents that alter cytosolic Ca2+ levels
(1,2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic
acid-tetra(acetyloxymethyl) ester, a Ca2+ channel blocker,
Ca2+ ionophores, and thapsigargin) strongly inhibit
excystation. Treatment of Giardia with thapsigargin raised
intracellular Ca2+ levels, and peak Ca2+
responses increased with each stage of excystation, consistent with the
kinetics of inhibition. Fluorescent thapsigargin localized to a likely
Ca2+ storage compartment in cysts. The ability to sequester
ions in membrane-bounded compartments is a hallmark of the eukaryotic cell. These studies support the existence of a giardial
thapsigargin-sensitive Ca2+ storage compartment resembling
the sarcoplasmic/endoplasmic reticulum calcium ATPase pump-leak system
and suggest that it is important in regulation of differentiation and
appeared early in the evolution of eukaryotic cells. Calmodulin
antagonists also blocked excystation. The divergent giardial calmodulin
localized to the eight flagellar basal bodies/centrosomes, like protein
kinase A. Inhibitor kinetics suggest that protein kinase A signaling
triggers excystation, whereas calcium signaling is mainly required
later, for parasite activation and emergence. Thus, the basal bodies
may be a cellular control center to coordinate the resumption of
motility and cytokinesis in excystation.
 |
INTRODUCTION |
Parasite differentiations are elegant biological adaptations for
survival in the environment and transmission (1), yet few life cycles
have been completed in vitro (2). The life cycle of
Giardia lamblia is initiated by excystation, a highly regulated differentiation which is required for transmission (3-5) that may be too rapid to rely entirely on new gene expression (6, 7).
Therefore, we propose that second messengers are central for its
regulation. Cell signaling is poorly understood in the lower
eukaryotes. Recently, we reported that protein kinase A activity may
play a role in initiating excystation (8). Here, we tested the
hypothesis that subsequent trophozoite emergence from the
cyst wall and cytokinesis may require calcium signaling pathways.
G. lamblia is a major cause of water-borne intestinal
disease whose basic biology is not well understood, although a genome project is in progress (9-12). The ability of the parasite to undergo
complex differentiations in response to signals from the host is key to
its pathogenesis. Like most intestinal parasites, G. lamblia
has a dormant cystic form that persists outside the host and is
responsible for transmission when ingested (1, 2, 13). Excystation in
response to host gastrointestinal stimuli releases active trophozoites
that colonize the small intestine and can cause disease (1, 3, 5).
Although exposure to gastric acid is required to trigger excystation of
G. lamblia (5), if the cyst wall should open in the stomach,
the parasite within would be killed. On the other hand, upon passage
into the small intestine, Giardia must quickly emerge from
the cyst wall, polarize, and re-assemble its adhesive disc and flagella
in order to attach and not be carried away by the flow of intestinal
fluid. At the same time, the "excyzoite" is becoming metabolically
active and dividing into two binucleate trophozoites (7, 14).
Upon ingestion, G. lamblia cysts are exposed to extreme
changes in osmolarity (from fresh water to isotonic conditions), to temperature increases of up to 33 °C, and to drastic decrease in pH
(from ~5 to 6 in fresh water to ~2.0 in the human stomach). After
the gastric acid is neutralized, the pH of the small intestine is
slightly alkaline (~7.5 to 8.0). Excystation in
vitro models the passage of the cyst from fresh cold water through
the human stomach and into the small intestine where resumption of
trophozoite motility, emergence from the wall, cytokinesis, and
attachment occur (3, 15). This paradigm allows dissection of responses to individual signals and crucial triggering and emergence stages.
Although the external stimuli for giardial excystation are identified
(5, 15), the mechanism(s) by which the signals are transduced are not
known. We showed previously that exposure of cysts to the
gastric pH and temperature that trigger excystation ("Stage I")
lead to decreased cytoplasmic pH, mRNA changes, and novel
cytoplasmic re-arrangements that may establish cellular polarity (7).
Signals modeling the small intestine ("Stage II") then lead to
degradation of cyst wall proteins and increased cytosolic pH (7).
In cells of later diverging eukaryotes, the flow of information between
the extra- and intracellular environment is frequently mediated by
rapid, transient changes in free intracellular Ca2+.
Ca2+ acts as a powerful second messenger, because its
levels are regulated within narrow limits by channels, pumps, and
specific Ca2+-binding proteins. Ca2+ is also
sequestered within internal storage compartments, mainly the
endoplasmic reticulum (ER)1
(16-19). Later diverging eukaryotes (17, 18) have one or more Ca2+-ATPases
(sarcoplasmic/endoplasmic reticulum
calcium ATPase, SERCA), pumps that maintain low
cytosolic Ca2+ by pumping it into a membrane compartment,
generally the ER in non-muscle cells and the SR in muscle cells. This
pump also retrieves Ca2+ that has leaked into the cytosol
and is critical for Ca2+ homeostasis and cell function
(17).
Many of the actions of Ca2+ in later eukaryotes are
mediated by the calcium-binding protein, CaM (16). CaM and its
signaling cascades are highly conserved from fungi to mammals, and
blocking CaM signaling arrests these cells in the G1 or
G2 phase of the cell cycle (20, 21). However, giardial
cysts are quadrinucleate, reported to be 16N, and to undergo two rounds
of cytokinesis after excystation before re-entering the cell cycle
(14). Munoz et al. (22) have purified giardial (g)CaM and
shown that it resembled bovine CaM biochemically. They also reported
that CaM antagonists inhibit excystation of fecal Giardia
cysts (23). In the present study, we have examined the roles of
cytoplasmic Ca2+ homeostasis and CaM in giardial excystation.
 |
EXPERIMENTAL PROCEDURES |
G. lamblia Differentiation--
G. lamblia
trophozoites (strain WB, clone C6, ATCC 50803) were cultured, encysted,
and excysted as described (3). Briefly, trophozoites and incomplete
cysts were lysed by incubation in double distilled water for 20 min at
room temperature. Water-resistant cysts were washed and stored in
distilled water at 4 °C overnight (pre-excystation). In Stage I of
excystation, cysts were exposed to HCl, pH 4.0, with cysteine and
reduced glutathione for 20 min at 37 °C. In Stage II, acid-treated
cysts were washed and treated with trypsin in pH 8.0 bicarbonate-buffered Tyrode's solution for 60 min at 37 °C (7, 15).
Cells were then collected by centrifugation and resuspended in TYI-S-33
growth medium at 37 °C for 30 min. Emerged motile trophozoites were
enumerated in hemocytometer chambers using differential interference
contrast microscopy. The percent excystation was calculated as the sum of the motile trophozoites and partially emerged trophozoites × 100, divided by the initial number of viable cysts with type I
morphology (3).
Inhibition of Excystation--
Inhibitors were dissolved in
double-distilled water, ethanol, or Me2SO and
diluted into water (pre-excystation) or excystation solutions. Solvent
was the control in each case. For initial screening and determination
of 50% inhibitory concentrations (IC50) of active compounds, each inhibitor was present for a 1-h preincubation at
4 °C and added again during Stages I and II of excystation, because
cysts were pelleted between stages. Inhibitors were not included in the
emergence step to avoid possible effects on trophozoites. Viability was
determined by trypan blue exclusion and by differential interference
contrast microscopy (3). To determine the specific stage(s) at which
each inhibitor acted, cysts were preincubated with the inhibitor
(generally at greater than IC50 concentration) in water for
1 h at 4 °C, or during Stage I, or Stage
II of excystation (8).
The % excystation in the presence of each agent was normalized to the
solvent controls for each experiment. Data shown are mean (± S.D.) for
at least two independent experiments. p values were
calculated by paired two-tailed Student's t test with the normalized comparison value set at 100% for excystation in solvent controls (3, 8).
Intracellular Ca2+ Measurements--
G.
lamblia were cultured to the appropriate life cycle stages and
then harvested and washed twice by centrifugation in HEPES buffered
saline (HBS: 130 mM NaCl, 5 mM KCl, 10 mM glucose, 1 mM MgCl2, 1.0 mM CaCl2, 25 mM HEPES, pH 7.4) and
labeled by incubating in 2 ml of HBS containing 1 µM
Indo-1/AM at 37 °C for 30 min. Cells were then washed with HBS,
suspended to 6 × 105, and seeded on 22-mm glass
coverslips placed in a 37 °C chamber containing HBS. Groups of
15-30 G. lamblia were viewed using an inverted Nikon
Diaphot microscope. Fluorometric measurements were collected using the
DX-1000 System (Solamere Technology, Salt Lake City, UT), where the
field was excited at 385 nm and the emission ratio was collected at 405 and 495 nm, as described previously (24, 25). Ca2+
concentrations were calculated using Equation 1,
|
(Eq. 1)
|
In this equation, R was the ratio at any time, and
Rmin, Rmax, and
were
determined by the ratio of fluorescence under Ca2+-depleted
(+EGTA) and Ca2+-saturated (+ionomycin) conditions. The
Ca2+ dissociation constant, Kd, was
determined for this dye and optics at 37 °C to be 250 nM. Pharmacological agents were diluted from 1000× stocks.
Staining Live Parasites with Fluorescent TG--
Parasites were
harvested by gentle scraping and resuspended at 107/ml in
phosphate-buffered saline (PBS). Cells were labeled using 500 µM BODIPY-TG (26) (Molecular Probes, Eugene, OR)
diluted in PBS for 30 min at 37 °C in an 8-well chamber
coverslip slide. The unattached cells were removed, and PBS was
replaced with encystation medium and a coverslip. Live parasites were
imaged using a Zeiss LSM 510 laser scanning confocal microscope
equipped with an argon-krypton (455:488) laser and appropriate filter set.
Sequencing the Calmodulin Gene--
Preliminary BLASTX
annotation of single-pass reads in the Giardia Genome Project data base
(www.mbl.edu/Giardia) indicated that clone EJ2820 contained a
likely CaM homologue. Complete coding information for the
Giardia calmodulin ORF was obtained by directed sequencing
of EJ2820. We amplified the clone insert using PCR and primers specific
to the Giardia sequences, and then sequenced this product
completely using a LICOR automated scanner (27). The sequence has since
been confirmed by additional random sequence data from the genome
project data base and by sequencing constructs. The CaM amino acid
alignment was produced using the ClustalW WWW Service at the European
Bioinformatics Institute (www.ebi.ac.uk/clustalw). The structure
of gCaM was modeled against a template of bovine CaM, crystallized with
Ca2+, 1CLL (28), using Swiss-Model and Swiss-PDB Viewer
(29).
Constructs and Transfection for Immunolocalization of
gCaM--
Plasmid pNLop2-GItetR was digested by XhoI and
SalI and then self-ligated to generate pNLop2. The gCaM gene
with its 5'-untranslated region was amplified from genomic DNA using
PCR and oligonucleotides CM5NF (GGCGGCTAGCGGTAGAATTAAAATTCAGAA)
and CMAUMR
(GGCGCAATTGTTAGATGTATCGATACGTATCCCTCCTGCAGAGTATCTTTACGA), digested with NheI/MfeI, and ligated in place of
the NheI/EcoRI-excised luciferase gene and 32-bp
ran promoter and two copies of a 19-bp tet operator sequence in
pNLop2 (30). The resulting plasmid pNCM contains the gCaM gene
controlled by its own promoter with an AU1 tag fused at the C terminus.
Cells were transfected with pNCM and selected with G418 as described
(31), and stable transfectants were maintained in G418 (600 µg/ml).
Immunolocalization of gCaM--
pNCM transfectants were
harvested after 24 h in growth or encystation media with G418,
washed in PBS, and attached to glass coverslips (2 × 106 cells/coverslip), then fixed and stained for indirect
immunofluorescence assay (8). Cells were reacted with anti-AU1
monoclonal antibodies (Covance, Princeton, NJ, 1:300 in blocking
buffer), which was detected with anti-mouse ALEXA 568 (Molecular
Probes, Eugene, OR, 1:500 in blocking buffer). Localization of gCaM was
observed on a Zeiss LSM 510 laser scanning confocal microscope equipped with argon/krypton (455:488) and helium/neon (543:633) lasers and
appropriate filter sets.
 |
RESULTS |
Role of Calcium Homeostasis in Excystation--
Our initial
findings that excystation was strongly (>70%) inhibited by decreasing
free extracellular Ca2+ with EGTA (5 mM) or by
buffering intracellular free Ca2+ with 5 mM
BAPTA-AM (Calbiochem) suggested a central role for Ca2+
homeostasis. BAPTA-AM crosses the plasmalemma because of its acetomethoxy group, which is hydrolyzed by cellular esterases. The
charged BAPTA molecule is kept within the cytoplasm where it chelates
cytosolic free Ca2+ (32).
We tested the hypothesis that Ca2+ homeostasis might be
important for excystation and that Giardia may be
particularly susceptible to perturbation of Ca2+ during the
cellular activation that occurs late in excystation (Stage II). We
found that verapamil, a Ca2+ channel blocker that should
lower cytoplasmic Ca2+ concentrations (33), strongly
inhibited excystation. The IC50 for verapamil when it was
present throughout excystation was 49 µM. No inhibition
was observed when verapamil (100 µM) was present only
during pre-excystation or Stage I, but it inhibited >75% in Stage II
(Fig. 1A). Ionomycin is a
carboxylic ionophore (34), and A23187 is a Ca2+-selective
carboxylic ionophore that stimulates
Ca2+-dependent biological reactions without
disturbing Na+ or K+ gradients (35). These two
Ca2+ ionophores should greatly increase cytoplasmic
Ca2+ by allowing influx of Ca2+ from the
medium. Ionomycin (1 µM) and A23187 (1 µM)
were also most inhibitory in Stage II, although they also inhibited
significantly in Stage I (Fig. 1, B and C). When
each ionophore was present throughout excystation, the IC50
for ionomycin was 38 nM and for A23187 the IC50
was 126 nM. The idea that these inhibitors were acting
specifically was supported by 45Ca uptake studies (data not
shown). Ionomycin increased the rate of 45Ca uptake by
~2.5-fold, relative to solvent controls. Measurements of
intracellular Ca2+ levels (see below) confirmed that
ionomycin functions as a Ca2+ ionophore in
Giardia cysts and trophozoites, because we calibrated each
trace with ionomycin to obtain the Rmax needed
to calculate intracellular levels of Ca2+.

View larger version (11K):
[in this window]
[in a new window]
|
Fig. 1.
Inhibition of excystation by agents that
decrease or increase cytoplasmic Ca2+.
A, the Ca2+ channel blocker verapamil
(100 µM); B, the Ca2+ ionophore
A23187 (1 µM); and C, the Ca2+
ionophore ionomycin (1 µM). Each inhibitor was present
only during the stage indicated, and cells were washed between each
step of excystation. Higher than IC50 concentrations were
used in order to maximize differences between the susceptibility at
each stage. *, p < 0.05, significant inhibition of
excystation compared with the solvent control.
|
|
Evidence of a Calcium-pumping ATPase Needed for
Excystation--
In most eukaryotic cells, Ca2+ pump
activity due to SERCA is specifically inhibited by the sesquiterpene
lactone, TG (36). The addition of 5 µM TG (Calbiochem) to
Indo-1 loaded trophozoites, cysts, or excysting cells produced an
immediate and sustained rise in Indo-1 fluorescence, corresponding to
an increase in free intracellular Ca2+ (Fig.
2A). The traces shown in Fig.
2A are qualitative in nature and do not allow for accurate
comparisons across all stages, due to differences in calibration values
(see "Experimental Procedures"). Therefore, we converted all
fluorescence ratio data to nanomolar cytosolic Ca2+
levels. Giardia maintain a low basal cytosolic
Ca2+ concentration, ranging from 40 to 85 nM
(data not shown). The data in Fig. 2B show that the addition
of TG caused significant increases in cytosolic Ca2+
levels. The effect of TG did not depend on extracellular
Ca2+, because similar data were obtained when
Indo-1-labeled cells were resuspended briefly in Ca2+-free
medium containing 0.3 mM EGTA (data not shown). This
indicates that the source of the elevated Ca2+ is an
intracellular Ca2+ store dependent on a TG-sensitive,
presumably SERCA-like pump.

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 2.
TG-induced increases in intracellular
Ca2+ in Giardia during the course of
excystation. A, Indo-1/AM fluorescence was monitored
continuously, and TG (5 µM) was added at the time
indicated by the arrow. Qualitative elevations in
[Ca2+]i were evident at each life cycle stage.
These raw qualitative traces (which cannot be compared directly) are
representative of at least three similar experiments. B,
conversion of Indo-1/AM fluorescence ratio to quantitative
[Ca2+]i levels. Peak changes in
[Ca2+]i in response to TG (as in A)
were calculated as described under "Experimental Procedures." Data
plotted are mean ± S.E., n = 4. *, cysts had a
significantly lower peak response to TG compared with that of all other
stages tested, p < 0.05. **, stages I and II were
significantly different from cysts and excyzoites/trophozoites
p < 0.05. +, excyzoites and trophozoites had
significantly higher peak responses than other stages,
p < 0.05.
|
|
Under the conditions of our experiments, we did not detect significant
changes in the basal Ca2+ levels during excystation (data
not shown). Excysting cells in all stages exhibited an increase in
intracellular Ca2+ in response to TG. Moreover, the
magnitude of peak TG-induced Ca2+ release increased
with progression through excystation (Fig. 2B). The peak
effect of TG was lowest in the dormant cyst form (656 ± 66 nM), intermediate in Stage I (1158 ± 108 nM) and Stage II (1035 ± 92 nM) excysting
cells, and greatest in newly excysted cells (1577 ± 116 nM), which were similar to trophozoites (1517 ± 234 nM). The effect of TG on cysts was significantly lower and on trophozoites and excyzoites was higher than in all other stages (p < 0.05).
TG inhibition of excystation also increased during the course of
differentiation. The IC50 for TG when present throughout excystation was 7 µM. TG at 10 µM
significantly inhibited giardial excystation only during Stage II (Fig.
3). However, inhibition by TG was greater
when it was present in both Stages I and II, in contrast to the other
inhibitors that did not show any additive effects (not shown). The
lower response of non-induced cysts to TG may be because this is a
dormant form or because of lower penetration into the intact cyst wall.
However, giardial cysts (Fig. 4) stained with fluorescent TG, which localized to a likely Ca2+
storage compartment, resembling the ER (37), by confocal microscopy. Taken together, our data suggest that function of a TG-sensitive calcium storage compartment resembling the SERCA pump-leak system is
important in regulation of giardial excystation.

View larger version (38K):
[in this window]
[in a new window]
|
Fig. 3.
Kinetics of excystation inhibition by
TG. 10 µM TG was present only at the stage or stages
indicated. *, p < 0.05, significant inhibition
compared with solvent control.
|
|

View larger version (90K):
[in this window]
[in a new window]
|
Fig. 4.
Giardia cyst stained
with BODIPY-labeled TG. TG localized to a
likely calcium storage compartment. Differential interference contrast
and confocal fluorescence image.
|
|
Evidence of CaM as a Central Mediator in Excystation--
We found
that three specific CaM inhibitors (38) blocked excystation (Fig.
5). The calculated IC50
values are as follows: chlorpromazine 28 µM,
trifluoperazine ~15 µM (Fig. 5), and calmidazolium 1 µM (data not shown) (23, 38), when present throughout
excystation. These inhibitors may also primarily affect parasite
emergence from the cyst wall, because they were most effective during
the late stage that models cyst arrival in the host small intestine (Fig. 5).

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 5.
Inhibition of excystation by CaM
inhibitors. A, trifluoperazine (25 µM);
B, chlorpromazine (50 µM). *,
p < 0.05 significant inhibition of excystation
compared with solvent control.
|
|
Sequence and Structural Analyses of gCaM--
We sequenced a
giardial CaM gene (GenBankTM AAK97377) from a genomic DNA
clone identified by the Giardia Genome Project (Fig.
6). Searching this data base
(www.mbl.edu/Giardia) for additional homologues by BLAST, using bovine
CaM as the query sequence, did not reveal other giardial CaM homologues
but only previously reported centrin/caltractin genes in the CaM family
with p values <10
37 and 3 × 10
37 (39). Several A- or A-T-rich regions typical of
giardial initiator sequences are upstream of the start of translation
of gCaM and a slightly divergent putative giardial polyadenylation
signal, GGTAAAT (consensus: AGTRAAY, overlaps with the stop
codon (data not shown)), which is not unusual for Giardia
(10). Interestingly, the gCaM gene has a completely overlapping ORF,
with no known homologues, on the opposite strand. Both the gCaM gene
and the antisense ORF are transcribed during growth and
differentiation (not shown). This is also not unusual for
Giardia (40). Southern analyses also showed that
Giardia CaM is a single copy gene (data not shown). This is
important because the gCaM we cloned differs in amino acid composition
from CaM purified from giardial extracts by Munoz et al.
(22). The amino acid composition determined by Munoz et al.
(22) for bovine CaM also differed from the published bovine CaM
sequence (28). We cannot explain these differences, but we have
confirmed our sequence, and gCaM expressed in Escherichia coli was active in stimulating cAMP phosphodiesterase activity (data not shown).

View larger version (50K):
[in this window]
[in a new window]
|
Fig. 6.
Alignment of giardial CaM. Positions
that are completely conserved among the species considered are marked
with *, highly similar positions are marked with :, and similar
positions are marked . according to ClustalW. Positions where gCaM has
a substitution of a conserved methionine are marked with an
arrow, and the unique cysteine residue near the C terminus
is marked with an arrowhead. Highly conserved positions
where gCaM differs from human CaM are in boldface (similar)
or boldface underlined letters (non-similar). The four EF
hand motifs are boxed.
|
|
CaM senses calcium by binding up to four Ca2+ ions with
four conserved 12-residue helix-loop-helix "EF hands" (41, 42). Because gCaM is so divergent overall, we modeled its three-dimensional structure using bovine CaM (1CLL, crystallized with
Ca2+ at 1.7 Å, Ref. 28) as a template. Despite the
differences in sequence, the backbone carbon atoms could be
superimposed. Moreover, the portions of each sequence predicted to have
helical secondary structure were identical. In each EF hand,
positions 1 (Asp), 6 (Gly), and 12 (Glu) are the most
highly conserved (43), and gCaM differs only in having Asp instead of
Glu-12 in the fourth EF hand (Fig. 6, data not shown).
Cellular Location of gCaM--
In trophozoites (Fig.
7) and encysting cells (not shown), gCaM
expressed with either an N-terminal or C-terminal AU-1 epitope tag
localized to the flagellar basal bodies or centrosomes that are between
and slightly anterior to the two nuclei. A variable amount of gCaM also
localized to the cytosol (Fig. 7). gCaM also localized to the basal
bodies in water-resistant
cysts.2

View larger version (169K):
[in this window]
[in a new window]
|
Fig. 7.
Immunolocalization of gCaM. AU-1-tagged
gCaM localized to the basal bodies anterior to the nuclei in
trophozoites. Some gCaM also localized within the cytoplasm. The
intensity of the fluorescence prevents resolution of the eight
individual basal bodies.
|
|
 |
DISCUSSION |
Giardia excystation is an excellent model for studies
of cellular activation from dormant states (44). Unlike many other parasites, the G. lamblia life cycle can be completed
in vitro (3). Because both the external milieu and host
gastrointestinal tract are extremely variable, Giardia must
constantly monitor and react to stimuli from its environment.
Therefore, cell signaling via second messengers may be especially
important in giardial differentiation. Although the giardial genome
contains many genes in signaling pathways (10-12), there is little
understanding of their biological roles.
The inhibition of excystation by agents that affect cytoplasmic
Ca2+ levels by very diverse mechanisms strongly supports
the importance of regulation by Ca2+ signaling. The
Ca2+ channel blocker verapamil, which should decrease
cytoplasmic Ca2+ levels, inhibited excystation, as did EGTA
and BAPTA-AM. Similarly, the Ca2+ ionophores, A23187 and
ionomycin, which elevated intracellular Ca2+, also
inhibited excystation. These ionophores create channels in the bilayer
lipid membrane that are selectively permeable to Ca2+. We
found that ionomycin increased cytosolic Ca2+ and abolished
the gradient across the giardial plasma membrane in all stages. Taken
together, these data suggest that cytosolic Ca2+ levels
must be closely controlled, especially in Stage II, for excystation to proceed.
In studies with inhibitors, it is crucial to determine the specificity
of the effect or target, especially in an organism as divergent as
Giardia. Importantly, the targets of the inhibitors used in
these studies have been identified at the biochemical and/or molecular
level in G. lamblia. Another criterion is whether an
inhibitor is active in the concentration range where its effects are
specific. In general, the inhibitors used in these studies were
effective within the concentration ranges used in mammalian cells,
despite the need for them to penetrate or act across the cyst wall. A
third criterion is absence of nonspecific toxicity. None of the
inhibitors used in these studies killed cysts, and the lower numbers of
trophozoites that emerged after exposure to the inhibitors had normal
morphology and motility (see Ref. 23 and this work).
The divergence between prokaryotes and eukaryotes is the most
significant of evolutionary discontinuities. G. lamblia may straddle this boundary, as it is a true eukaryotic cell that has important prokaryotic properties (40, 44, 45). In evolutionary terms,
the divergence of Giardia is reported to be at least twice as ancient as the common ancestor of yeast and man (46). Thus, Giardia may be a valuable model for study of the
evolutionary appearance of Ca2+ signaling pathways because
this key function diverges so greatly between prokaryotic and
eukaryotic cells.
Unlike the bacteria and the archaea, which actively extrude
Ca2+ but do not appear to use it commonly for intracellular
signaling, eukaryotes sequester this ion in endomembrane-bounded
compartments. In contrast, cyclic AMP functions as a second messenger
in both bacteria and eukaryotic cells (47, 48). Similar to this work, modulators of cytosolic Ca2+ blocked ookinete
differentiation in Plasmodium (49). This ion is also
important in invasion of host cells by Leishmania mexicana (50) and in cellular aggression by Entamoeba histolytica
(51). Ca2+ ionophores also trigger rupture of the parasite
vacuole and escape of Toxoplasma gondii from host cells
(52). Trypanosomatids and malaria parasites sequester Ca2+
in novel acidic organelles (53).
Our studies with TG suggest that the giardial ER may sequester
Ca2+, a key function of the ER in higher eukaryotic cells.
TG increases cytoplasmic Ca2+ levels by inhibiting its
re-uptake into the ER. The rapid and robust increase in giardial
[Ca2+]i in response to TG suggests that this
storage system may have a large capacity to store Ca2+ and
that the Ca2+ cycles into and out of the storage
compartment rapidly. Thus, kinetically, the TG-sensitive
Ca2+ storage compartment in Giardia resembles
the SERCA pump-leak system found in many mammalian cells (18, 36). The
ability of G. lamblia to release Ca2+ into the
cytoplasm in response to TG was evident throughout the life cycle.
Further studies are needed to characterize the exact mechanisms and
sites of Ca2+ pumping and sequestration in
Giardia and to characterize gene(s) encoding putative
Ca2+-transporting ATPase.
Giardia excystation may also be an important model for study
of Ca2+ signaling because of its relative simplicity.
Giardia lacks mitochondria, which act as a high capacity,
low affinity Ca2+ segregation system (9, 19). Genomic and
molecular analyses to date have also revealed fewer genes or isoforms
of many proteins in the calcium/CaM signaling pathway. There is no
biological or genomic (www.mbl.edu/Giardia) (12) evidence for the
existence of a guanylyl cyclase homologue or nitric-oxide synthase
pathway to generate cyclic GMP or NO as potential second
messengers,3 suggesting that
certain eukaryotic mediator pathways may not function in
Giardia. Alternatively, these genes may be too divergent to
be recognized readily by search programs.
The two major arms of Ca2+ signaling are mediated by CaM
and protein kinase C (48). A potential protein kinase C homologue is in the Genome Project Data base (www.mbl.edu/ Giardia), but specific inhibitors did not affect excystation (see Ref. 23 and this
work). Thus, there appears to be specificity in Ca2+
signaling in excystation, and Ca2+ signaling in
Giardia may reflect an ancestral or early diverging state.
Moreover, blocking excystation by CaM inhibitors does not appear to be
due to cell cycle arrest, as in higher organisms, because giardial
cysts undergo two rounds of cytokinesis before they re-enter the cell
cycle (14). In the long run, our studies of excystation may reveal
novel functions for CaM signaling that are not readily accessible in
other cell systems.
Although CaM is among the most conserved proteins known (16, 54, 55),
gCaM appears to be highly divergent. The identity of numerous CaM
sequences from animals, plants, and fungi ranged from 63 to 67% and
similarity ranged from 83 to 87% based on multiple sequence alignment.
For example, gCaM has 63% identity and 86% similarity to bovine CaM
and 67% identity and 83% similarity to P. falciparum CaM
(54). In contrast, malaria CaM is 87% identical and 97% similar to
bovine CaM. Compared with a 1998 analysis of conserved residues (55),
gCaM differed from the consensus of all available sequences in 10 positions. Therefore, gCaM may give valuable insights into CaM
evolution and structural requirements.
Although it has no enzyme activity, CaM can bind to and modulate the
activities of many enzymes (56, 57). CaM has nine conserved methionine
residues that have been shown to be important for interaction with
target proteins (58, 59). Single mutations of most of these methionines
to glutamine had profound effects on CaM binding to target proteins or
peptides (58). However, mutation of four methionines to leucine had
little, if any, effect (59, 60). A striking divergence of giardial CaM
is that four of the canonical Met positions are occupied by leucine,
one by isoleucine, and one by serine. In addition, unlike most CaMs
that are devoid of cysteine, gCaM has a cysteine residue near its C terminus (Fig. 6).
Our analyses support the hypothesis that because of its highly
divergent amino acid sequence, gCaM will provide a valuable model for
probing CaM structure/function in an early eukaryotic cell. Thus, gCaM
is a "natural mutant" for investigation of structure/function relationships in this key regulatory protein. It is consistent with
findings with site-specific mutants showing that leucine can substitute
for methionine (60). Study of gCaM and identification of its downstream
targets may help understand why this substitution has rarely happened
in nature.
Earlier, we found that the myristoylated PKA inhibitor, amide 14-22, inhibited excystation and was most effective at the early stages,
suggesting that PKA activity is needed for triggering excystation (8).
Cysts have a very low rate of glucose uptake and metabolism (61).
Because cysts are filled with glycogen (37), glycogenolysis stimulated
by PKA may be important to provide initial energy for excystation. In
contrast, CaM and Ca2+ homeostasis appear to be more
important later, during the cellular activation and emergence phase.
gCaM may activate one of its downstream effectors, calcineurin (protein
phosphatase PP2B), to decrease PKA activity, which is needed early in
excystation. This could reflect a change from early dominance of gPKA
to gCaM signaling later in excystation. PKA regulatory subunit is a
favored substrate of PP2B (62). Moreover, dephosphorylation of cyst
wall proteins was reported to be important in excystation (63),
although the possibility that this may be due to degradation by
protease (7) was not ruled out.
In the case of signaling proteins with many potential downstream
effectors, functional specificity can be attained by proximity to
cellular structures. PKA localizes to specific cellular sites by
interacting with corresponding anchoring proteins (8). CaM is cytosolic
in many cells but localizes to the bull sperm midpiece (64) and to the
paraflagellar rod in trypanosomes (65). The association of CaM with
different flagellar structures may suggest roles for CaM in regulating
the motility of diverse flagellated cells. Interestingly, we found that
both gCaM (Fig. 7) and gPKA (8) localize to the flagellar basal bodies
between and slightly anterior to the two nuclei in trophozoites.
Flagella from protists to sperm, as well as cilia, each originate in a
basal body, which organizes and regulates growth of microtubules. Basal
bodies correspond to the spindle pole bodies in budding yeast and the
centrioles in many other eukaryotic cells. In higher eukaryotic cells,
centrosomes consist of two centrioles and associated pericentriolar
material. As microtubule organizing centers, centrosomes are important
in cellular motility, polarity, and cytokinesis. Centrioles and spindle
pole bodies appear to have regulatory roles in cell cycle checkpoints
(66). CaM is a central protein of yeast spindle pole bodies (66). In
contrast, in HeLa cells, CaM was localized to spindle polar regions
only during mitosis, when it was also recruited to the cleavage furrow of cytokinesis (67). Unlike yeast and other crown group eukaryotes, mitosis in Giardia does not appear to involve spindle
formation (9). Thus, it is interesting that gCaM localizes to the basal bodies/centrosomes.
Trophozoites have eight flagella that are required for attachment (9).
During encystation, trophozoites, which are shaped like a half-pear,
round up and lose the ability to re-attach because their flagella and
adhesive disc are curled up inside the cyst wall (68). A major
challenge of excystation in the duodenum is for the excyzoite to emerge
from the cyst wall, recover motility, undergo its first round of
cytokinesis, and attach before being carried away by intestinal flow.
The location of gCaM, especially in proximity to PKA, suggests that the
basal bodies may be important cellular control centers that help
coordinate the assembly of new flagella with the location of the
cleavage furrow for equal distribution of nuclei and cytoskeletal
structures to each daughter cell.
Ca2+ strongly influences cell mobility, in part by effects
on microtubule stability, and microtubules originate at the basal bodies. We found that taxol, which binds to microtubules and stabilizes their polymerization (48), also inhibited excystation (IC50 = 10 µM) at any stage but most strongly in Stage II (data
not shown). This is consistent with changes we have observed in the giardial cytoskeleton throughout excystation (7). In contrast, cytochalasin (100 µM), which is a microfilament inhibitor
and inhibits trophozoite attachment (11), did not affect excystation (not shown). Most microtubule-mediated cellular functions require remodeling of microtubules, which is inhibited by taxol (48). Thus,
taxol likely acts at a number of steps in giardial excystation that
require microtubules.
Taken together, these data support the idea that Ca2+ is a
key second messenger in regulating excystation of G. lamblia. Many other medically important protozoan parasites,
e.g. Cryptosporidium parvum, E. histolytica, and T. gondii, several tapeworms, and nematodes, are transmitted as resistant cyst or oocyst forms. Infection
of a new host depends upon the ability to excyst after exposure to
gastric and intestinal stimuli (1). Giardia may be a
valuable model for understanding parasite differentiation in the
intestinal tract. On a basic level, giardial excystation is also a
unique model of cellular awakening from dormancy in response to
environmental signals. Therefore, it provides valuable opportunities to
understand the evolutionary appearance of eukaryotic signaling
mechanisms. Conservation of pathways from Giardia to man
supports universal function and importance for eukaryotic cells,
whereas differences may reflect either early divergence or adaptation
to a parasitic life style.
 |
ACKNOWLEDGEMENTS |
We thank A. R. Means, M. Parsons, L. Ruben, K. E. Barrett, and members of the Gillin laboratory for
critical reading of the manuscript and helpful suggestions. We are
grateful to N. Passamaneck, Y. Andersen, and E. Cimina for
technical help.
 |
FOOTNOTES |
*
This work was supported by United States Public Health
Service Grants AI42488, DK35108, GM61896, AI51687, and AI43273 (to M. Sogin) from the National Institutes of Health.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
Present address: Dept. of Physiology, Northeastern Ohio
Universities College of Medicine, 4209 State Rte. 44, Rootstown, OH 44272.
Present address: Dept. of Parasitology, College of Medicine,
National Taiwan University, Taipei 110, Taiwan.
§§
To whom correspondence should be addressed: Dept. of Pathology,
University of California School of Medicine, 214 Dickinson St., San
Diego, CA 92103-8416. Tel.: 619-543-7831; Fax: 619-543-6614; E-mail: fgillin@ucsd.edu.
Published, JBC Papers in Press, October 22, 2002, DOI 10.1074/jbc.M208033200
2
S. Shah, personal communication.
3
D. S. Reiner, H. G. Morrison, and
F. D. Gillin, unpublished observations.
 |
ABBREVIATIONS |
The abbreviations used are:
ER, endoplasmic
reticulum;
CaM, calmodulin;
PKA, protein kinase A;
BAPTA-AM, 1,2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic
acid-tetra(acetyloxymethyl) ester;
SERCA, sarcoplasmic/endoplasmic
reticulum calcium ATPase;
TG, thapsigargin;
PBS, phosphate-buffered
saline;
gCaM, giardial CaM;
BODIPY, 4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-propionic
acid.
 |
REFERENCES |
| 1.
|
Despommier, D. D.,
and Karapelou, J. W.
(1987)
Parasite Life Cycles
, Springer-Verlag Inc., New York
|
| 2.
|
Eichinger, D.
(2001)
J. Eukaryot. Microbiol.
48,
17-21[CrossRef][Medline]
[Order article via Infotrieve]
|
| 3.
|
Boucher, S-E. M.,
and Gillin, F. D.
(1990)
Infect. Immun.
58,
3516-3522[Abstract/Free Full Text]
|
| 4.
|
Marshall, M. M.,
Naumovitz, D.,
Ortega, Y.,
and Sterling, C. R.
(1997)
Clin. Microbiol. Rev.
10,
67-85[Abstract]
|
| 5.
|
Bingham, A. K.,
and Meyer, E. A.
(1979)
Nature
227,
301-302[CrossRef]
|
| 6.
|
Cardenas, M. E.,
Sanfridson, A.,
Cutler, N. S.,
and Heitman, J.
(1998)
Trends Biotechnol.
16,
427-433[CrossRef][Medline]
[Order article via Infotrieve]
|
| 7.
|
Hetsko, M. L.,
McCaffery, J. M.,
Svard, S. G.,
Meng, T.-C.,
Que, X.,
and Gillin, F. D.
(1998)
Exp. Parasitol.
88,
172-183[CrossRef][Medline]
[Order article via Infotrieve]
|
| 8.
|
Abel, E. S.,
Davids, B. J.,
Robles, L. D.,
Loflin, C. E.,
Gillin, F. D.,
and Chakrabarti, R.
(2001)
J. Biol. Chem.
276,
10320-10329[Abstract/Free Full Text]
|
| 9.
|
Adam, R. D.
(1991)
Microbiol. Rev.
55,
706-732[Abstract/Free Full Text]
|
| 10.
|
Adam, R. D.
(2001)
Clin. Microbiol. Rev.
14,
447-475[Abstract/Free Full Text]
|
| 11.
|
Feely, D. E.,
and Erlandsen, S. L.
(1982)
J. Parasitol.
68,
869-873[CrossRef][Medline]
[Order article via Infotrieve]
|
| 12.
|
McArthur, A. G.,
Morrison, H. G.,
Nixon, J. E. J.,
Passamaneck, N. Q. E.,
Kim, U.,
Reich, C. I.,
Holder, M. E.,
Hinkle, G.,
Crocker, M. K.,
Farr, R.,
Olsen, G. E.,
Aley, S. B.,
Adam, R.,
Gillin, F. D.,
and Sogin, M. L.
(2000)
FEMS Microbiol. Lett.
189,
271-273[CrossRef][Medline]
[Order article via Infotrieve]
|
| 13.
|
Lujan, H. D.,
Mowatt, M. R.,
and Nash, T. E.
(1997)
Microbiol. Mol. Biol. Rev.
61,
294-304[Abstract]
|
| 14.
|
Bernander, R.,
Palm, J. E. D.,
and Svärd, S. G.
(2001)
Cell. Microbiol.
3,
55-62[CrossRef][Medline]
[Order article via Infotrieve]
|
| 15.
|
Rice, E. W.,
and Schaefer, F. W., III.
(1981)
J. Clin. Microbiol.
14,
709-710[Abstract/Free Full Text]
|
| 16.
|
Chin, D.,
and Means, A. R.
(2000)
Trends Cell Biol.
10,
322-328[CrossRef][Medline]
[Order article via Infotrieve]
|
| 17.
|
Guerini, D.,
and Carafoli, E.
(1999)
in
Calcium as a Cellular Regulator
(Carafoli, E.
, and Klee, C., eds)
, pp. 249-278, Oxford University Press, New York
|
| 18.
|
Furuya, T.,
Okura, M.,
Ruiz, F. A.,
Scott, D. A.,
and Docampo, R.
(2001)
J. Biol. Chem.
276,
32437-32445[Abstract/Free Full Text]
|
| 19.
|
McCormack, J. G.,
and Denton, R. M.
(1999)
in
Calcium as a Cellular Regulator
(Carafoli, E.
, and Klee, C., eds)
, pp. 529-544, Oxford University Press, New York
|
| 20.
|
Wang, J.,
Moreira, K. M.,
Campos, B.,
Kaetzel, M. A.,
and Dedman, J. R.
(1996)
Biochim. Biophys. Acta
1313,
223-228[Medline]
[Order article via Infotrieve]
|
| 21.
|
Joseph, J. D.,
and Means, A. R.
(2000)
J. Biol. Chem.
275,
38230-38238[Abstract/Free Full Text]
|
| 22.
|
Munoz, M. L.,
Weinbach, E. C.,
Wieder, S. C.,
Claggett, C. E.,
and Levenbook, L.
(1987)
Exp. Parasitol.
63,
42-48[CrossRef][Medline]
[Order article via Infotrieve]
|
| 23.
|
Bernal, R. M.,
Tovar, R.,
Santos, J. I.,
and Munoz, M. D. L.
(1998)
Parasitol. Res.
84,
687-693[CrossRef][Medline]
[Order article via Infotrieve]
|
| 24.
|
Lorell, B. H.,
Apstein, C. S.,
Cunningham, M. J.,
Schoen, F. J.,
Weinberg, E. O.,
Peeters, G. A.,
and Barry, W. H.
(1990)
Circ. Res.
67,
415-425[Abstract/Free Full Text]
|
| 25.
|
Meszaros, J. G.,
Gonzalez, A. M.,
Endo-Mochizuki, Y.,
Villegas, S.,
Villarreal, F.,
and Brunton, L. L.
(2000)
Am. J. Physiol.
278,
C154-C162
|
| 26.
|
Zhong, L.,
and Inesi, G.
(1998)
J. Biol. Chem.
273,
12994-12998[Abstract/Free Full Text]
|
| 27.
|
Middendorf, L. R.,
Bruce, J. C.,
Bruce, R. C.,
Eckles, R. D.,
Grone, D. L.,
Roemer, S. C.,
Sloniker, G. D.,
Steffens, D. L.,
Sutter, S. L.,
and Brumbaugh, J. A.
(1992)
Electrophoresis
13,
487-494[CrossRef][Medline]
[Order article via Infotrieve]
|
| 28.
|
Chattopadhyaya, R.,
Meador, W. E.,
Means, A. R.,
and Quiocho, F. A.
(1992)
J. Mol. Biol.
228,
1177-1192[CrossRef][Medline]
[Order article via Infotrieve]
|
| 29.
|
Guex, N.,
and Peitsch, M. C.
(1997)
Electrophoresis
18,
2714-2723[CrossRef][Medline]
[Order article via Infotrieve]
|
| 30.
|
Sun, C. H.,
and Tai, J. H.
(2000)
Mol. Biochem. Parasitol.
105,
51-60[CrossRef][Medline]
[Order article via Infotrieve]
|
| 31.
|
Sun, C. H.,
Chou, C. F.,
and Tai, J. H.
(1998)
Mol. Biochem. Parasitol.
92,
123-132[CrossRef][Medline]
[Order article via Infotrieve]
|
| 32.
|
Tsien, R. Y.
(1999)
in
Calcium as a Cellular Regulator
(Carafoli, E.
, and Klee, C., eds)
, pp. 28-54, Oxford University Press, Oxford
|
| 33.
|
Balakumaran, A.,
Campbell, G. A.,
and Moslen, M. T.
(1996)
Toxicol. Appl. Pharmacol.
139,
122-127[CrossRef][Medline]
[Order article via Infotrieve]
|
| 34.
|
Kachintorn, U.,
Vongkovit, P.,
Vajanaphanich, M.,
Dinh, S.,
Barrett, K. E.,
and Dharmasathaphorn, K.
(1992)
Am. J. Physiol.
262,
C15-C22[Abstract/Free Full Text]
|
| 35.
|
Wentzell, B.,
and Epand, R. M.
(1978)
FEBS Lett.
86,
255-258[CrossRef][Medline]
[Order article via Infotrieve]
|
| 36.
|
Guerini, D.,
Guidi, F.,
and Carafoli, E.
(2002)
FASEB J.
16,
519-528[Abstract/Free Full Text]
|
| 37.
|
McCaffery, J. M.,
and Gillin, F. D.
(1994)
Exp. Parasitol.
79,
220-235[CrossRef][Medline]
[Order article via Infotrieve]
|
| 38.
|
Gauthier, M. L.,
and O'Day, D. H.
(2001)
Cell. Signal.
13,
575-584[CrossRef][Medline]
[Order article via Infotrieve]
|
| 39.
|
Meng, T.-C.,
Aley, S. B.,
Svärd, S. G.,
Smith, M. W.,
Huang, B.,
Kim, J.,
and Gillin, F. D.
(1996)
Mol. Biochem. Parasitol.
79,
103-108[CrossRef][Medline]
[Order article via Infotrieve]
|
| 40.
|
Knodler, L. A.,
Svärd, S. G.,
Silberman, J. D.,
Davids, B. J.,
and Gillin, F. D.
(1999)
Mol. Microbiol.
34,
327-340[CrossRef][Medline]
[Order article via Infotrieve]
|
| 41.
|
Lee, H. W.,
Yang, W., Ye, Y.,
Liu, Z.,
Glushka, J.,
and Yang, J. J.
(2002)
Biochim. Biophys. Acta
1598,
80-87[Medline]
[Order article via Infotrieve]
|
| 42.
|
Slupsky, C. M.,
and Sykes, B. D.
(1999)
in
Calcium as a Cellular Regulator
(Carafoli, E.
, and Klee, C., eds)
, pp. 73-99, Oxford University Press, New York
|
| 43.
|
Nelson, M. R.,
and Chazin, W. J.
(1998)
in
Calmodulin and Signal Transduction
(Van Eldik, L. J.
, and Watterson, D. M., eds)
, pp. 17-64, Academic Press, San Diego
|
| 44.
|
Ward, W.,
Alvarado, L.,
Rawlings, N. D.,
Engel, J. C.,
Franklin, C.,
and McKerrow, J. H.
(1997)
Cell
89,
437-444[CrossRef][Medline]
[Order article via Infotrieve]
|
| 45.
|
Sanchez, L. B.,
Morrison, H. G.,
Sogin, M. L.,
and Muller, M.
(1999)
Gene (Amst.)
233,
225-231[CrossRef][Medline]
[Order article via Infotrieve]
|
| 46.
|
Sogin, M. L.,
Gunderson, J. H.,
Elwood, H. J.,
Alonso, R. A.,
and Peattie, D. A.
(1989)
Science
243,
75-77[Abstract/Free Full Text]
|
| 47.
|
Williams, R. J. P.
(1999)
in
Calcium as a Cellular Regulator
(Carafoli, E.
, and Klee, C., eds)
, pp. 3-27, Oxford University Press, New York
|
| 48.
| Alberts, B., Bray, D., Lewis, J., Raff, M., Roberts, K., and Walter, P. (2002) Molecular Biology of the Cell, pp. 854-865 and
927-928, Garland Science, New York
|
| 49.
|
Silva-Neto, M. A. C.,
Atella, G. C.,
and Shahabuddin, M.
(2002)
J. Biol. Chem.
277,
14085-14091[Abstract/Free Full Text]
|
| 50.
|
Lu, H. G.,
Zhong, L.,
Chang, K. P.,
and Docampo, R.
(1997)
J. Biol. Chem.
272,
9464-9473[Abstract/Free Full Text]
|
| 51.
|
Ravdin, J. I.,
Murphy, C. F.,
Guerrant, R. L.,
and Long-Krug, S.
(1985)
J. Infect. Dis.
152,
542-549[Medline]
[Order article via Infotrieve]
|
| 52.
|
Black, M. W.,
and Boothroyd, J. C.
(2000)
Microbiol. Mol. Biol. Rev.
64,
607-623[Abstract/Free Full Text]
|
| 53.
|
Docampo, R.,
and Moreno, S. N.
(1999)
Parasitol. Today
15,
443-448[CrossRef][Medline]
[Order article via Infotrieve]
|
| 54.
|
Robson, K. J.,
and Jennings, M. W.
(1991)
Mol. Biochem. Parasitol.
46,
19-34[CrossRef][Medline]
[Order article via Infotrieve]
|
| 55.
|
Van Eldik, L. J.,
and Watterson, D. M.
(1998)
in
Calmodulin and Signal Transduction
(Van Eldik, L. J.
, and Watterson, D. M., eds)
, pp. 1-15, Academic Press, San Diego
|
| 56.
|
Means, A. R.
(2000)
Mol. Endocrinol.
14,
4-13[Free Full Text]
|
| 57.
|
Zhi, G.,
Abdullah, S. M.,
and Stull, J. T.
(1998)
J. Biol. Chem.
273,
8951-8957[Abstract/Free Full Text]
|
| 58.
|
Chin, D.,
and Means, A. R.
(2000)
J. Biol. Chem.
271,
30465-30471[Abstract/Free Full Text]
|
| 59.
|
Weljie, A. M.,
and Vogel, H. J.
(2000)
Protein Eng.
13,
59-66[Abstract/Free Full Text]
|
| 60.
|
Edwards, R. A.,
Walsh, M. P.,
Sutherland, C.,
and Voegl, H. J.
(1998)
Biochem. J.
331,
149-152
|
| 61.
|
Paget, T. A.,
Jarroll, E. L.,
Manning, P.,
Lindmark, D. G.,
and Lloyd, D.
(1989)
J. Gen. Microbiol.
135,
145-154[Medline]
[Order article via Infotrieve]
|
| 62.
|
Klee, C.,
Wang, X.,
and Ren, H.
(1999)
in
Calcium as a Cellular Regulator
(Carafoli, E.
, and Klee, C., eds)
, pp. 344-388, Oxford University Press, New York
|
| 63.
|
Slavin, I.,
Saura, A.,
Carranza, P. G.,
Touz, M. C.,
Nores, M. J.,
and Lujan, H. D.
(2002)
Mol. Biochem. Parasitol.
122,
95-98[CrossRef][Medline]
[Order article via Infotrieve]
|
| 64.
|
Leclerc, P.,
and Goupil, S.
(2000)
Biol. Reprod.
62,
1875-1881[Abstract/Free Full Text]
|
| 65.
|
Ridgley, E.,
Webster, P.,
Patton, C.,
and Ruben, L.
(2000)
Mol. Biochem. Parasitol.
109,
195-201[CrossRef][Medline]
[Order article via Infotrieve]
|
| 66.
|
Doxsey, S.
(2001)
Nat. Rev. Mol. Cell. Biol.
2,
688-698[CrossRef][Medline]
[Order article via Infotrieve]
|
| 67.
|
Li, C.-J.,
Heim, R., Lu, P., Pu, Y.,
Tsien, R. Y.,
and Chang, D. C.
(1999)
J. Cell Sci.
112,
1567-1577[Abstract]
|
| 68.
|
Faubert, G.,
Reiner, D. S.,
and Gillin, F. D.
(1991)
Exp. Parasitol.
72,
345-354[CrossRef][Medline]
[Order article via Infotrieve]
|
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
| This Article |
 |
 | | |