| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 278, Issue 40, 38461-38469, October 3, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
¶
From the
Department of Biology, The Johns Hopkins University, Baltimore, Maryland 21218 and the Department of Biology, Syracuse University, Syracuse, New York 13244
Received for publication, April 18, 2003 , and in revised form, July 7, 2003.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
-factor. Interestingly a polytopic plasma membrane protein, Fig1p, was required for LACS activity but not required for activation of Mpk1p mitogen-activated protein kinase. Mpk1p was not required for LACS activity, suggesting Mpk1p and Fig1p define two independent branches in the pheromone response pathways. Fig1p-deficient mutants exhibit defects in the cell-cell fusion step of mating, but unlike other fus1 and fus2 mutants the fusion defect of fig1 mutants can be largely suppressed by high Ca2+ conditions, which bypass the requirement for LACS. These findings suggest Fig1p is an important component or regulator of LACS and provide the first evidence for a role of Ca2+ signals in the cell fusion step of mating. |
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
100 nM) by the activity of pumps and transporters in both the plasma membrane and internal compartments. When combined with the stimulus-dependent opening of Ca2+ channels in these compartments, increases in [Ca2+]c can be generated with diverse spatial and temporal dynamics and decoded by cellular factors to control such processes as initiation of transcription, alterations in cell shape, hormone secretion, neurotransmitter release, and membrane fusion. For example, binding of glycoprotein ligands to receptors on sperm leads to activation of T-type and TRPC-type Ca2+ channels, which elevate [Ca2+]c and trigger fusion of the acrosome with the plasma membrane to promote penetration of the egg extracellular matrix and fertilization (1–4).
Ca2+ signals are also generated in the budding yeast Saccharomyces cerevisiae during its mating cycle. Haploid cells of each mating type (a- and -cells) can differentiate into gametes and fuse pairwise to produce a diploid zygote (a/-cells) capable of vegetative growth and meiosis. Haploid cells secrete peptide pheromones (a- and -factor) that evoke a series of mating responses in cells of the opposite mating type. The earliest responses include induction of mating-specific genes and cell cycle arrest in G1 phase. Responsive cells can repolarize in a gradient of pheromones and eventually remodel the cell wall and extend a mating projection from the cell body toward the source. Increased rates of Ca2+ influx and elevated [Ca2+]c occur at about the same time as projection formation, beginning 45 min after exposure to pheromones (5, 6). Until now, these Ca2+ signals had no known roles in the conjugation process, although they are known to have essential roles in maintaining the viability of unmated cells during prolonged responses to pheromones (5, 7–10). At least two independent Ca2+ influx systems contribute to the generation of Ca2+ signals during the pheromone response. A high affinity Ca2+ influx system (HACS)1 composed at least of Mid1p and Cch1p can be stimulated in the absence of pheromones upon the activation of the transcription factor Ste12p (7, 10–13). Cch1p is homologous to the catalytic subunits of voltage-gated Ca2+ channels in animals, and Mid1p appears to function as a regulatory subunit in yeast (14), although Mid1p can stimulate unidentified mechanosensitive channels when expressed in vertebrate cell lines (15). In minimal medium, HACS is primarily responsible for generating Ca2+ signals during pheromone response. But in rich media, HACS is almost undetectable due to feedback inhibition by calcineurin, and a novel low affinity Ca2+ influx system (LACS) is strongly stimulated in response to pheromones (10, 16). Except for Cch1p and Yvc1p, a vacuolar Ca2+ channel not involved in Ca2+ influx (17, 18), no other homologs of the known mammalian Ca2+ channels are represented in the yeast genome. This study identifies the first regulator or membrane component of LACS that is not required for activation of the cell integrity MAP kinase Mpk1p.
The signal transduction cascades activated by mating pheromones have been characterized thoroughly. Binding of pheromones to serpentine receptors stimulates a heterotrimeric G-protein in which the G
subunits activate a small Rho-type GTPase (Cdc42p), a p21-activated protein kinase (PAK) kinase homologue (Ste20p), and a scaffolded MAP kinase signaling module (Ste5p, Ste11p, Ste7p, and the MAP kinases Kss1p and Fus3p) (19–21). The MAP kinases phosphorylate the transcription factor Ste12p and two of its negative regulators Dig1p and Dig2p to stimulate expression of mating-specific genes (22, 23). Fus3p also phosphorylates and stabilizes the cyclin-dependent kinase inhibitor Far1p, which causes cell cycle arrest in G1 via direct inhibition of Cdc28p (22–26). Far1p also participates in the polarized growth of the mating projection by scaffolding both the G subunits of the trimeric G-protein and the Cdc24p, a guanine nucleotide exchange factor for Cdc42p (27–29). These events are thought to supply positional cues necessary for sensing a pheromone gradient. In addition to Far1p, several other proteins are delivered to the tip of the mating projection and are required for polarity establishment, cell fusion, and/or nuclear fusion. These proteins include a formin homologue Bni1p and its interacting proteins Spa2p and Pea2p, which regulate both the actin and microtubule cytoskeleton and serve to locally organize multiple signaling proteins (30–35). Other participants in these events include Fus1p, a single pass transmembrane protein, which facilitates the localization of prezygotic vesicles thought to contain cell wall hydrolytic enzymes, plus Fus2p and Rvs161p, which interact with each other and also promote efficient removal of intervening cell wall material between mating pairs (36–39). How the mating response pathway regulates LACS and HACS is currently under investigation.
Here we screened for mutants deficient in LACS but not HACS and identified many of the factors involved in polarity establishment, projection formation, and cell fusion listed above. This screen also identified Fig1p, a pheromone-inducible plasma membrane protein with four predicted transmembrane helices (40). Unlike the other mutants, fig1 mutants possess a cell fusion defect that can be suppressed by increasing Ca2+ in the medium to levels that increase [Ca2+]c independently of LACS. Although Fig1p does not resemble any known Ca2+ channels, we propose that it functions as a novel membrane subunit or regulator of LACS.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
-factor mating pheromone was obtained from U.S. Biologicals. All yeast strains used in this study were derived from wild type yeast strains BY4741, BY4742, and W303-1A (42, 43) using standard methods of transformation and/or crossing (Table I). Gene knockouts in BY4741 and BY4742 backgrounds were confirmed by diagnostic PCR and/or phenotype analysis. In aequorin experiments, plasmid pEVP11/AEQ89 (2µ LEU2 ADH-aequorin) (44) was utilized. A reporter gene used to monitor activation of the Pkc1p-Mpk1p cell integrity MAP kinase pathway (2µ URA3 MPK1-lacZ) was described previously (45).
|
Plasmids carrying FIG1 (pSE98) and the epitope-tagged derivative FIG1-MYC (pSE250) were constructed by PCR amplification of genomic DNA. First FIG1 plus 500 base pairs upstream and downstream of the gene was PCR-amplified from genomic DNA of yeast strain Y800 (46) using primers 5'-ATAGGATCCTGAACTGGTTGATA TTATTACTGG and 5'-ATAGTCGACGATTTCTGGATAGGGGTTATAATTAGCTTG, and then the product was subcloned into low dosage plasmid pRS315 (47) after digestion with BamHI plus SalI to yield plasmid pSE98. A similar PCR product amplified from the FIG1-MYC yeast strain YSE218 was subcloned into pSE98 after digestion with HindIII plus SalI to yield plasmid pSE250. DNA corresponding to three repeats of the Myc epitope tag (63 amino acids in total length) was inserted just prior to the stop codon in the wild type FIG1 gene by a pop-in/pop-out strategy (48) using strain Y800. Primers used to amplify DNA corresponding to the epitope tag and selectable marker were 5'-TGTGCCCAAAATAGG TACAATAACTACTCTTCGGATTCATCTACATTGCATTCCAAAGTTAGGGAACAAAAGCTGG and 5'-AAAAATTGACATTCTGAAATATCCGCTCAAAACTTATATGTTTATTT GAGGATAAAACTACTATAGGGCGAATTGG. Both plasmids fully complemented the defective cell fusion and Ca2+ influx phenotypes of fig1 mutants.
45Ca2+ Accumulation Assays—Accumulation of 45Ca2+ into yeast cells growing in YPD media was measured as described previously (49). In a standard experiment, log-phase cells were harvested by centrifugation and resuspended in fresh medium with tracer amounts of 45CaCl2 (Amersham Biosciences), and aliquots were treated with 20 µM -factor with or without 1 µM FK506 for 4 h at 30 °C. Cells were collected by filtration onto GFF filters (Whatman), washed three times with 5 ml of ice-cold buffer A (5 mM Na-HEPES at pH 6.5, 10 mM CaCl2), dried, and processed for liquid scintillation counting. The specific activity of the culture medium was determined in each experiment and used to convert cpm into nmol of Ca2+. Cell number was determined by measurements of optical density at 600 nm (OD600).
Screen data were obtained with 45Ca2+ accumulation assays performed in six batches on a total of 204 different gene knockout mutants in the BY4741 strain background (see Supplemental Table I). LACS and HACS activities were estimated for each strain by simply subtracting background Ca2+ accumulation (in the absence of -factor treatment) from total Ca2+ accumulation in the presence of -factor and subtracting background plus LACS from total Ca2+ accumulation in the presence of -factor and FK506. To identify LACS-deficient mutants, the logarithm of the LACS/HACS ratio was determined, and then a Z-score representing the number of standard deviations away from the mean was calculated by subtracting the population mean and dividing the difference by the standard deviation of the population. Z-scores were determined separately for each of the six batches. Eleven mutants were found to have log ratios significantly lower than the mean (Z-score less than –2.0) and were analyzed in greater detail.
-Galactosidase Assays—Yeast strains carrying MPK1-LacZ were grown at 30 °C in SC minus uracil medium to log phase, harvested, and resuspended in fresh SC minus uracil medium, supplemented with 20 µM -factor, and shaken for2hat30 °Cin 24-well flat-bottomed dishes. -Galactosidase assays were performed at room temperature using chloroform/SDS-permeabilized cells and colorimetric substrate as described previously (50).
Aequorin Luminescence Assays—Cells were grown to log phase in SC media lacking leucine, harvested by centrifugation, resuspended in fresh medium at an OD600 of 10, and loaded with 25 µg/ml coelenterazine (Molecular Probes) for 20 min at room temperature. Loaded cells were raised in YPD to an OD600 of 0.250 and treated with 20 µM -factor. Luminescence was monitored in a LB9507 luminometer (EG&G Wallac) and expressed as relative luminescence units. This procedure resulted in equivalent loading of different strains as judged by measuring total relative luminescence units after cell lysis with digitonin.
Immunofluorescence Microscopy—Cells were grown overnight into log phase in SC-Leu media. Fixation was carried out in 100 mM potassium phosphate (pH 6.5) plus 4% formaldehyde in SC-Leu media for 1 h, then harvested, and reraised in 100 mM potassium phosphate plus 4% formaldehyde without media overnight. Spheroplasts were made by digesting cells with 45 µg/ml zymolase-100T for 30 min at room temperature in 1 ml of SHA buffer (1 M sorbitol, 0.1 M Na-Hepes (pH 7.5), 5 mM sodium azide, and 0.2% -mercaptoethanol), permeabilized with 1% SDS for 10 min at room temperature in SHA buffer, washed twice with 1 ml of SHA buffer, and adhered to glass coverslips precoated with poly-D-lysine. Coverslips with cells were blocked with WT buffer (0.5 mg/ml IgG-free bovine serum albumin, 150 mM NaCl, 50 mM Na-Hepes (pH 7.5), 0.1% Tween 20, 1 mM sodium azide) for 15 min and then incubated with monoclonal antibodies specific for the Myc epitope (9E10, Santa Cruz Biotechnology) in WT buffer for 1 h. Coverslips were washed five times with WT buffer and incubated for 45 min with donkey anti-mouse antibodies conjugated with the fluor Alexa-488 (Molecular Probes), washed an additional five times with WT buffer, and mounted on standard glass microscope slides with 0.1% antifade (DABCO) in 90% glycerol. Cells were viewed on a Zeiss Axiovert microscope with 100x objective after excitation at 488 nm. Images were acquired and deconvolved by the Applied Precision Deltavision algorithm for 15 iterations in conservative mode.
Western Blots—Cells were grown to log phase in SC media lacking leucine, harvested, and extracted for membrane proteins as described previously (51). In brief, 1 OD600 unit of log-phase cells pretreated for the indicated time at 30 °C with 20 µM -factor was lysed in breaking buffer (0.3 M sorbitol, 0.1 M NaCl, 5 mM MgCl2, 10 mM Tris-Cl (pH 7.6)) with glass beads by vortexing at high speed for 30 s followed by incubation on ice for 30 s a total of four times. Extracted proteins were solubilized in sample buffer (40 mM Tris-Cl (pH 6.8), 8 M urea, 15% SDS, 0.1 mM EDTA, 1% -mercaptoethanol, 0.01% bromphenol blue), heated at 37 °C for 1 min, centrifuged, fractionated by 10% SDS-PAGE, transferred to polyvinylidene difluoride (Millipore), and probed with 9E10 (Santa Cruz Biotechnology) monoclonal antibodies specific for the triple Myc epitope present in Fig1p-Myc. Cross-reacting proteins were then detected using an ECL kit (Amersham Biosciences).
Analyses of Mating Cell Fusion—Cell-cell fusion abilities of strains were quantified essentially as described previously (40). Strains were mated for 4 h on Noble agar plates containing calcium-free synthetic complete medium with the indicated supplements of CaCl2, fixed in formaldehyde, sonicated, stained, and imaged by epifluorescence microscopy. The frequency of mating pairs in which membrane and cell wall material were incompletely removed was determined for at least 100 mating pairs.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
-Factor—Previously in yeast we described the existence of LACS, a primary method for Ca2+ entry in wild type cells treated with -factor (10). Further addition FK506 strongly increases Ca2+ influx by inhibiting calcineurin and permitting activation of a second Ca2+ influx system HACS (10, 13). We found that transcription via the mating-specific transcription factor Ste12p was necessary and sufficient for this strong activation of HACS in the presence of FK506 (10). To investigate the regulation and composition of LACS, we first tested whether the activation of Ste12p was also sufficient to stimulate LACS as shown previously for HACS. Mutants lacking both the Dig1p and Dig2p repressors of Ste12p exhibit maximum expression of most mating-specific genes (22, 23). Accumulation of Ca2+ from the growth medium was not significantly enhanced in a dig1 dig2 double mutant relative to wild type, but addition of -factor stimulated Ca2+ accumulation to a similar degree in wild type and dig1 dig2 double mutants even in the absence of Cch1p and Mid1p (Fig. 1). However, mutants lacking Ste12p exhibit no LACS activity after treatment with -factor (10). Therefore, stimulation of LACS was independent of Dig1p and Dig2p but still dependent on Ste12p and signaling by upstream factors.
|
To identify new components or regulators of LACS, a collection of 204 gene knockout mutants was assembled based on high Ste12p-dependent induction of these genes in response to -factor (52) and directly screened for LACS and HACS activity using the 45Ca2+ accumulation assay. Eleven mutants were found to have a LACS/HACS ratio at least 2.0 standard deviations lower than the mean (Supplemental Table I). Two mutants (kre6 and bst1) exhibited elevated HACS activity, and one mutant (cik1) did not reproduce the phenotype when reconstructed in a different strain background. The remaining eight mutants (far1, fus1, fus2, fus3, fig1, rvs161, ydl133w, and ydr525w) were all as deficient in LACS activity as the previously identified bni1, pea2, and spa2 mutants (Fig. 2A). All of these LACS-deficient knockout mutants were verified by PCR, and their phenotypes were confirmed after independent reconstruction of each knockout mutation in the W303-1A strain background (data not shown). Interestingly all the named genes have been shown to play roles in polarized morphogenesis and/or fusion of the mating cells (29, 37, 40, 53–55). On the other hand, several other mutants with defects in these processes (axl1, bud1, fps1, kar9, kel1, and prm1) (56–60) did not exhibit reduced LACS activity in the conditions tested (see Supplemental Table I). Because YDL133w and YDR525w genes had not been previously characterized, we focused our attention on the remaining mutants. As an independent measure of LACS activity, the Ca2+-sensitive photoprotein aequorin was expressed in each of the mutants, reconstituted with coelenterazine, and monitored for luminescence after 90 min of treatment with -factor (near the peak of [Ca2+]c in wild type cells). Relative to wild type, all the LACS-deficient mutants exhibited profound defects in their abilities to elevate cytosolic Ca2+ after treatment with -factor (Fig. 2B).
|
Fus3p and Far1p Stimulate LACS Independently of Cell Cycle Arrest, Dig1p, and Dig2p—The Fus3p MAP kinase promotes expression of mating-specific genes by phosphorylating Dig1p, Dig2p, and Ste12p and also promotes cell cycle arrest in G1 phase by phosphorylating Far1p, an inhibitor of the G1 cyclin-dependent kinases (22–26). The role of Fus3p and a redundant MAP kinase, Kss1p, in gene expression is largely bypassed by the simultaneous loss of Dig1p and Dig2p (22, 23). LACS activity was not detectably stimulated in dig1 dig2 double mutants in the absence of -factor but was stimulated to high levels after treatment with -factor (Fig. 3A). The effect of -factor still depended on signaling by Fus3p because LACS was not stimulated by -factor in a fus3 dig1 dig2 triple mutant (Fig. 3A). Although Dig1p and Dig2p are important for Ste12p regulation, additional targets of Fus3p seem to be necessary for stimulation of LACS.
|
In addition to inhibiting cell cycle progression (26), Far1p promotes changes in cell polarity by interacting with Ste4p, a component of the heterotrimeric G-protein coupled to pheromone receptors, and Cdc24p, an activator of the Rho-type GTPase Cdc42p (27–29). The Far1p-C205Y and Far1p-K756stop variants of Far1p retain the ability to inhibit cell cycle progression but have lost the ability to interact with Ste4p and Cdc24p, respectively, and fail to polarize normally (28). In response to -factor, cells expressing Far1p-C205Y or Far1p-K756stop each failed to stimulate LACS over basal levels (Fig. 3B). For unknown reasons, the basal levels of 45Ca2+ accumulation in these mutants were 3 times higher than that of fus3 knockout mutants. This effect did not seem high enough to obscure detection of LACS in this experiment and was not sufficient to obscure the detection of HACS upon addition of FK506 (data not shown). Therefore, the roles of Far1p in polarized morphogenesis appeared to be necessary for LACS stimulation, presumably through its interactions with Ste4p and Cdc24p, although we cannot exclude other potential interacting factors.
Fig1p Defines a New Branch in the Mating Response Pathway—The cell integrity MAP kinase cascade in yeast becomes activated during the response to mating pheromones (61, 62). To test whether the genes necessary for LACS activity are also required for MAP kinase activation, expression of an MPK1-lacZ reporter gene was measured in fus3, far1, bni1, spa2, pea2, rvs161, fus2, fus1, and fig1 mutants with or without -factor treatment. MPK1-lacZ expression was induced 5-fold in wild type cells treated with -factor relative to untreated cells (Fig. 4A), and this response was completely abolished in mpk1 mutants. Induction of MPK1-lacZ was almost completely absent in the fus3, far1, bni1, spa2, pea2, rvs161, fus2, and fus1 mutants (52, 62), suggesting these factors may be necessary for generating a stimulus that activates the cell integrity MAP kinase cascade. In striking contrast to these mutants, fig1 mutants were found to be fully capable of MPK1-lacZ induction in response to -factor (Fig. 4A, last column). Mutants lacking Mpk1p, the MAP kinase of the cell integrity pathway, were still able to stimulate LACS to the same level as wild type cells (Fig. 4B). Fig1p was not required for the induction of MPK1-lacZ under these conditions (data not shown), which is consistent with earlier results showing no significant effect of Ca2+ or calcineurin on MPK1-lacZ expression in other conditions (16). Thus, Fig1p and Mpk1p define two independent branches of the pheromone response pathway. The requirement for Fus3p, Far1p, Bni1p, Spa2p, Pea2p, Rvs161p, Fus2p, and Fus1p for the activation of both branches is consistent with a model where these factors function upstream of Fig1p and Mpk1p (see Fig. 5), although more complicated models are also possible.
|
|
Fig1p Expression and Localization—Fig1p contains four hydrophobic segments predicted to span membrane bilayers (40). To monitor expression and subcellular localization of Fig1p, a functional epitope-tagged derivative termed Fig1p-Myc was constructed, introduced into wild type and mutant strains, and analyzed by immunofluorescence microscopy and Western blotting. Basal expression of Fig1p-Myc in the absence of mating pheromones was barely detectable by Western blotting and was not detectable by immunofluorescence microscopy. Consistent with previous studies of Fig1p-LacZ expression and localization (40), treatment with -factor for 180 min strongly induced Fig1p-Myc expression, the majority of which was localized to the plasma membrane, although intracellular reticular structures and small puncta were visible in a fraction of cells (Fig. 6A). At earlier time points, Fig1p-Myc appeared to be more concentrated over the projection in some cells, but fluorescence was still clearly visible in the plasma membrane of the cell bodies (data not shown). Fig1p-Myc was not detectably mislocalized in fus3, far1, bni1, spa2, pea2, rvs161, fus2, or fus1 mutants, although the mating projection morphology of many mutants was characteristically different from that of wild type (Fig. 6A). Although many of these mutants lack proteins that are highly concentrated near the tips of mating projections and necessary for stimulation of LACS, they did not appear to be essential for trafficking of Fig1p to the plasma membrane.
|
Western blot analysis of Fig1p-Myc in wild type and mutant cells treated with -factor revealed a major band migrating at 80 kDa in all cases (Fig. 6B). Incubation of extracts containing Fig1p-Myc with endo--N-acetylglucosaminidase H in vitro and treatment of cells with tunicamycin in vivo converted the 80-kDa band into a single band running near the position predicted for Fig1p-Myc (40 kDa, data not shown). These data suggest Fig1p is N-glycosylated in vivo at one or more of its four consensus sites. Although Fig1p-Myc glycosylation and localization were not affected by mutations in any of the other genes we examined, the levels of Fig1p-Myc expression appeared to vary significantly among the mutants. For example, fus3, far1, and bni1 mutants exhibited significantly lower levels of Fig1p-Myc expression, and spa2, pea2, and rvs161 mutants exhibited higher levels of expression relative to wild type cells (Fig. 6B).
In response to -factor treatment, Fig1p-Myc expression in wild type cells was highly induced after a short lag period, and high expression was maintained for at least 4 h (Fig. 7B). Although LACS activity (as detected by aequorin luminescence, Fig. 7A) rose with a time course similar to that of Fig1p-Myc, it peaked and eventually declined without a noticeable decline in Fig1p levels. Surprisingly treatment of dig1 dig2 double mutants with -factor strongly increased Fig1p-Myc accumulation (data not shown) consistent with the induction of FIG1 transcripts in dig1 dig2 double mutants as detected by DNA microarray methods (52). Overexpression of Fig1p-Myc in wild type cells, dig1 dig2 double mutants, or bni1 mutants failed to increase Ca2+ accumulation with or without -factor treatment (data not shown). These experiments did not reveal a consistent defect in Fig1p expression or localization in the various LACS-deficient mutants, although the possibility of transient Fig1p mislocalization could not be ruled out. Fig1p expression and localization to the plasma membrane appear to be necessary but not sufficient for the stimulation of LACS activity.
|
LACS Activity Promotes Cell Fusion During Mating—Fig1p-deficient mutants exhibit a relatively weak defect in the cell-cell fusion step of mating, but overall mating efficiency is not seriously compromised (40). To test whether LACS activity is important for cell-cell fusion, wild type and mutant matings were performed in media containing varying amounts of Ca2+ and analyzed microscopically for defects in cell fusion. Wild type matings exhibited relatively few abnormalities in cell fusion at all concentrations of Ca2+ tested, including 200 mM Ca2+, which elevates [Ca2+]c and activates calcineurin independently of LACS and HACS (63). In contrast, bilateral fig1 x fig1 matings were abnormal in 45% of the matings in Ca2+-free medium, and this defect was strongly suppressed to 11% as external Ca2+ was raised to 200 mM (Fig. 8). Ca2+ supplements had little or no ability to suppress either the severe cell fusion defects of bilateral fus1 and fus2 mutant matings or the weak defects of bilateral wild type matings (Fig. 8). These findings indicate an important role for intracellular Ca2+ at the cell fusion step of yeast mating and suggest that this requirement for Ca2+ is normally satisfied by the functions of Fig1p and LACS.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Fig1p and the Role of Ca2+ Signals During the Mating Response—Ca2+ signals in response to mating pheromones have long been recognized in yeast (5, 6). Cells responding to mating pheromones for prolonged periods of time in the absence of mating partners lose viability when Ca2+ influx is blocked or when the activities of calmodulin or calcineurin are abolished (5, 7–9, 11, 12). To date, no additional regulatory roles for Ca2+ signals in mating have been described. The decreased mating efficiency of fus1 mutants was exacerbated by Ca2+ chelators in the medium (38), but we found little or no suppression of this cell fusion defect by elevated Ca2+ in the medium (Fig. 8). Here we show that LACS is not detectable in fig1 mutants and that the relatively mild cell fusion defect of fig1 mutants can be almost completely suppressed by high Ca2+ conditions. Although the Ca2+-sensitive processes important in yeast cell fusion have not been identified, Ca2+ signals in gametes of many other species are well known to regulate events important for their fusion, such as the Ca2+-dependent acrosome reaction in mammalian sperm (2).
Because fig1 mutants mate at rates similar to wild type cells (40), Fig1p does not seem to be required for cell cycle arrest and induction of mating-specific genes. The loss of Fig1p had no detectable effect on activation of Mpk1p in response to -factor (Fig. 4A), a response that requires both cell cycle arrest and induction of mating-specific genes (52, 61, 62). Therefore, Fig1p appears to function as a subunit or close regulator of LACS. Fig1p is N-glycosylated and localized to the plasma membrane via its four predicted transmembrane helices. Fig1p expression is strongly induced upon activation of the pheromone signaling pathway, and the kinetics of its appearance are similar to that of LACS stimulation (Fig. 7). Overexpression of Fig1p, however, did not stimulate LACS activity in the absence of pheromone treatment or accelerate its appearance after treatment with -factor (Fig. 1 and data not shown). Homologs of Fig1p are evident in the genomes of other budding yeasts, fission yeast, and filamentous fungi, but none have been characterized to date, and no homologs are recognizable in more distantly related fungi or in animals. Additionally the sequence conservation among Fig1p and its homologs is not focused within the transmembrane segments like Cch1p and its homologs or Yvc1p and its homologs (data not shown). Collectively these findings suggest Fig1p is intimately associated with LACS perhaps as a regulatory subunit, although we cannot exclude the possibility it functions as a catalytic subunit. Fig1p may therefore operate like connexins or tetraspanins in animals. Connexins are a superfamily of four-transmembrane segment-containing proteins that function as Ca2+ channels at GAP junctions, sites of cell-cell contact and communication, in higher eukaryotes (64–66). Tetraspanins are unrelated to connexins but also contain four transmembrane segments and are well known to associate with integrins, receptors, and signaling complexes to coordinate processes such as fertilization (67–71). One hallmark of tetraspanins is a conserved group of disulfide bonds in their extracellular domains. Fig1p bears no obvious sequence similarity to tetraspanins, but a number of cysteine residues in its extracellular loops are highly conserved among its fungal homologs much like the conserved disulfide bridges among tetraspanins. More studies will be necessary to identify the collaborating partners of Fig1p and their specific functions in LACS.
Regulation of LACS and the Cell Integrity MAP Kinase Cascade—This study identifies Far1p, Fus1p, Fus2p, Fus3p, and Rvs161p as factors required for stimulation of LACS in addition to components of the polarisome (Bni1p, Spa2p, and Pea2p) identified previously (10). Fus3p and Far1p play multiple roles in the mating process, including cell cycle arrest in late G1 phase. Variants of Far1p that promote cell cycle arrest but fail to interact with either Ste4p or Cdc24p (27–29) also fail to stimulate LACS. During mating responses, all of these factors help to specify the site at which polarized growth will occur and either the cytoskeletal, membrane, or surface rearrangements necessary to form a projection that will become the site of fusion with a mating partner. Mutants lacking Fus1p, Fus2p, or Rvs161p fail to fuse with mating partners due to an inability to remove cell wall material that prevents the close apposition of membranes (36–38). These mutants accumulate a population of vesicles near the tips of mating projections similar to secretion-defective mutants (37). The origin and contents of these vesicles are not yet known, but an obvious possibility is that they would carry enzymes necessary for local degradation of the cell wall and modification of the cell surface. As Ca2+ signals can trigger vesicle fusion in other cell types (1, 2, 72, 73), it is possible that LACS serves to trigger the fusion of these vesicles with the plasma membrane as suggested by the ability of high Ca2+ to partially suppress defects associated with fig1 and, to a lesser extent, fus1 mutants. If these vesicles also carry key components or regulators of LACS, a positive feedback loop might exist where initially small Ca2+ signals would trigger fusion events and become rapidly amplified until the pool of vesicles is depleted.
During the mating response, it is necessary to specify the site at which polarized growth will occur. This is accomplished via alteration of cytoskeletal, membrane, or surface components, which are necessary for formation of a projection that will become the site of fusion with a mating partner, and is mediated by many of the proteins discussed above. In addition, mutants lacking Fus1p, Fus2p, or Rvs161p fail to fuse with mating partners due to an inability to remove cell wall material that prevents the close apposition of membranes (36–38). These mutants accumulate a population of vesicles near the tips of mating projections similar to secretion-defective mutants (37). The origin and contents of these vesicles are not yet known, but an obvious possibility is that they would carry enzymes necessary for local degradation of the cell wall and remodeling the surface. As Ca2+ signals can trigger vesicle fusion in other cell types (1, 2, 72, 73), it is possible that LACS serves to trigger the fusion of these vesicles with the plasma membrane, as suggested by the ability of high Ca2+ to partially suppress defects associated with fig1 and, to lesser extent, fus1 mutants. If these vesicles also carry key components or regulators of LACS, a positive feedback loop might exist where initially small Ca2+ signals would trigger fusion events and become rapidly amplified until the pool of vesicles is depleted.
The polarisome, composed at least of Bni1p, Spa2p, and Pea2p, helps to polarize the actin cytoskeleton toward the tips of mating projections and to position the nucleus through interactions with Kar9p and microtubules emanating from the spindle pole body (55, 71, 74). Interestingly mutants lacking Kar9p were fully capable of LACS stimulation. The polarisome responds to polarity cues from other sources such as Far1p, which integrates signals from the heterotrimeric G-protein (including Ste4p subunit) coupled to pheromone receptors and the small Rho-type GTPase Cdc42p and its regulator Cdc24p (27–29). These factors had little role in Fig1p localization to the plasma membrane, but some affected Fig1p expression levels in peculiar ways. Most of the cell polarity factors we identified as being required for LACS are cytoplasmic and localize strongly to the mating projections (74) in contrast to a more uniform distribution of Fig1p throughout the cell body and mating projection plasma membrane domains. However, one intriguing possibility is that Ca2+ influx occurs preferentially at sites where all of these factors colocalize (see below).
Except for Fig1p, all the factors required for stimulation of LACS were also required for activation of the Pkc1p-dependent cell integrity MAP kinase cascade culminating with Mpk1p and the stimulation of Rlm1p-dependent genes such as MPK1-lacZ (45). Mpk1p was not required for stimulation of LACS, indicating that LACS and the cell integrity MAP kinase pathway are independent branches of -factor-activated signal transduction. Our screen also identified two additional knockout mutants, ydl133w and ydr525w, that were deficient in LACS stimulation. Recently the YDR525w gene (renamed API2) was found to be necessary for polarized morphogenesis (75). Additional experiments will be necessary to position these potential new regulators or components of LACS with respect to Fig1p.
Ca2+ Signaling During the Pheromone Response—In addition to LACS, a HACS consisting of Cch1p and Mid1p can be stimulated by the response to mating pheromones. Stimulation of HACS did not require Fig1p or any of the upstream regulators characterized here but instead responded to activation of the Ste12p transcription factor in the absence of pheromones (10). The targets of Ste12p involved in HACS stimulation have not yet been identified. In complete culture medium, the contribution of HACS to cytosolic Ca2+ elevation was very small due to feedback inhibition by calcineurin even in LACS-deficient cells (Fig. 2) (10). HACS appears to be much more important in minimal culture medium possibly due to weaker inhibition by calcineurin (5, 7–12). The reasons why yeast cells maintain two separate Ca2+ influx systems that are independently regulated but capable of accomplishing similar tasks remain mysterious. It is common for mammalian cells to use multiple types of Ca2+ channels to regulate complex cellular phenomena. For example, acrosome fusion in mammalian sperm requires a brief Ca2+ signal generated by the T-type Ca2+ channel (homologous to Cch1p) as well as a sustained secondary Ca2+ signal generated by another Ca2+ influx system (1–4). Many other examples have been documented where distinct Ca2+ channels within the same cell activate completely different response pathways, probably due to spatial and temporal differences in the dynamics of the Ca2+ signals. It will be interesting to image Ca2+ in the cytoplasm of yeast cells responding to -factor and to evaluate the contributions of HACS and LACS in physiological conditions.
A number of new questions are raised by this study. How do morphogenesis and polarity establishment factors trigger or regulate LACS? Is Fig1p a subunit of a novel family of Ca2+ channels or regulator upstream of LACS functioning similarly to tetraspanins? What are the targets of Ca2+, and how do they promote fusion? It seems likely that the answers to these and other questions will provide further insight into the roles of Ca2+ dynamics in yeast and higher eukaryotes.
|
FOOTNOTES |
|---|
The on-line version of this article (available at http://www.jbc.org) contains Supplemental Table I.
¶ To whom correspondence should be addressed: Dept. of Biology, The Johns Hopkins University, 3400 N. Charles St., Baltimore, MD 21218. Tel.: 410-516-7844; Fax: 410-516-5213; E-mail: kwc{at}jhu.edu.
1 The abbreviations used are: HACS, high affinity Ca2+ influx system; LACS, low affinity Ca2+ influx system; MAP, mitogen-activated protein; SC, synthetic complete; YPD, yeast extract peptone.
|
ACKNOWLEDGMENTS |
|---|
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
