HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 278, Issue 42, 40679-40687, October 17, 2003

This Article Abstract Full Text (PDF) All Versions of this Article: 278/42/40679    most recent M302014200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Calzada, M. J. Articles by Roberts, D. D. Search for Related Content PubMed PubMed Citation Articles by Calzada, M. J. Articles by Roberts, D. D. Social Bookmarking                      What's this?

Recognition of the N-terminal Modules of Thrombospondin-1 and Thrombospondin-2 by ₆₁ Integrin^*

Maria J. Calzada , John M. Sipes , Henry C. Krutzsch , Peter D. Yurchenco , Douglas S. Annis ¶, Deane F. Mosher ¶ and David D. Roberts  ||

From the Laboratory of Pathology, NCI, National Institutes of Health, Bethesda, Maryland 20892-1500, the Department of Pathology and Laboratory Medicine, Robert Wood Johnson Medical School, Piscataway, New Jersey 08854, and the ^¶Department of Medicine, University of Wisconsin, Madison, Wisconsin 53706

Received for publication, February 25, 2003 , and in revised form, August 6, 2003.

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
In addition to its recognition by ₃₁ and ₄₁ integrins, the N-terminal pentraxin module of thrombospondin-1 is a ligand for ₆₁ integrin. ₆₁ integrin mediates adhesion of human microvascular endothelial and HT-1080 fibrosarcoma cells to immobilized thrombospondin-1 and recombinant N-terminal regions of thrombospondin-1 and thrombospondin-2. ₆₁ also mediates chemotaxis of microvascular cells to thrombospondin-1 and thrombospondin-2. Using synthetic peptides, LALERKDHSG was identified as an ₆₁-binding sequence in thrombospondin-1. This peptide inhibited ₆₁-dependent cell adhesion to thrombospondin-1, thrombospondin-2, and the E8 fragment of murine laminin-1. The Glu residue in this peptide was required for activity, and the corresponding residue (Glu⁹⁰) in the N-terminal module of thrombospondin-1 was required for its recognition by ₆₁, but not by ₄₁. ₆₁ was also expressed in human umbilical vein endothelial cells; but in these cells, only certain agonists could activate the integrin to recognize thrombospondins. Selective activation of ₆₁ integrin in microvascular endothelial cells by the anti-₁ antibody TS2/16 therefore accounts for their adhesion responses to thrombospondins and explains the distinct functions of ₄₁ and ₆₁ integrins as thrombospondin receptors in microvascular and large vessel endothelial cells.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Integrins play a major role in mediating interactions between cells and their extracellular matrix environment. In addition to providing physical anchoring of cells, engagement of integrins transmits signals into cells that regulate their survival and behavior (reviewed in Ref. 1). Conversely, cells can modulate their interactions with the extracellular matrix through regulating the expression or ligand-binding activities of specific integrins (1). Although some extracellular matrix ligands have been identified for most known integrins (reviewed in Ref. 2), our understanding of integrin ligand specificities remains incomplete.

Thrombospondins (TSPs)¹ are a family of five extracellular matrix proteins (3, 4). TSP1 modulates cell behavior by altering cell adhesion, motility, proliferation, survival, gene expression, and differentiation. Some cellular responses to TSP1 are mediated by non-integrin receptors (5–8), but integrins also play important roles in mediating activities of TSP1 in several cell types. To date, interactions of TSP1 with _v3, ₃₁, ₄₁, and ₅₁ have been demonstrated (9–12). ₄₁ also serves as a receptor for thrombospondin-2 (TSP2) (12), but the recognition site identified for ₃₁ is not conserved in TSP2 (13).

One of the best characterized biological activities of TSP1 and TSP2 is to modulate angiogenesis. Inhibition of endothelial cell chemotaxis is mediated by the TSP1 receptor CD36 (14). Heparan sulfate proteoglycans and CD47 may also contribute to the anti-angiogenic activities of TSP1 (15–17). In certain contexts, however, TSP1 and recombinant or proteolytic fragments of TSP1 exhibit pro-angiogenic activities (18, 19). We previous reported that ₃₁ mediates a pro-angiogenic activity of the N-terminal pentraxin module of TSP1 (18). This integrin is constitutively expressed on venous and microvascular endothelial cells, but its ability to bind TSP1 is regulated by cell-cell signaling involving VE-cadherin (18). Because ₁-dependent interactions of TSP1 or TSP2 with endothelial cells could not be completely inhibited by ₃₁ antagonists, we examined the role of additional ₁ integrins expressed on endothelial cells as TSP receptors.² This effort revealed that a second ₁ integrin, ₄₁, selectively functions as a TSP1 and TSP2 receptor in large vessel endothelial cells. However, microvascular cells are refractory to ₄₁ antagonists. We have therefore examined the role of additional ₁ integrins as TSP receptors in microvascular cells and report here that ₆₁ is a major integrin receptor for TSP1 and TSP2 that mediates adhesion and chemotaxis of microvascular endothelial cells. Furthermore, we identify a specific sequence in the N-terminal module of TSP1 that mediates this interaction and demonstrate that this sequence antagonizes interactions of ₆₁ with its well characterized ligand laminin-1.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Cell Culture—Human dermal microvascular endothelial (HDMVE) cells and human lung microvascular endothelial (HMVE-L) cells (Cambrex Bio Science Inc., Walkersville, MD) were grown under the conditions specified by the manufacturer. Adult iliac vein endothelial cells (AG10773A; NIA Repository, Coriell Institute for Medical Research, Camden, NJ) were grown on flasks coated with 0.1% gelatin in medium 199 containing 10% fetal bovine serum (FBS), 2 mM glutamine, 30 µg/ml endothelial cell mitogen (Biomedical Technologies, Inc., Stoughton, MA), and 30 µg/ml heparin. Human umbilical vein endothelial (HUVE) cells (Clonetics BioWhittaker Inc.) were maintained in medium 199 containing 20% FBS, 2 mM glutamine, 80 µg/ml endothelial cell mitogen, 10 µg/ml heparin, and penicillin/streptomycin. The human fibrosarcoma cell line HT-1080 (American Type Culture Collection, Manassas, VA) was grown in Dulbecco's modified Eagles medium containing 10% FBS. Jurkat T cells were maintained in RPMI 1640 medium (BIOSOURCE International, Camarillo, CA) supplemented with 10% FBS, 2 mM glutamine, and penicillin/streptomycin. The breast carcinoma cell line MDA-MB-231 (American Type Culture Collection) was propagated weekly in RPMI 1640 medium containing 10% fetal calf serum.

Proteins and Peptides—TSP1 was purified from human platelets obtained from the National Institutes of Health Blood Bank (20). The protein was >95% intact based on analysis by SDS gel electrophoresis. The recombinant trimeric proteins consisting of the N-terminal module (N), oligomerization sequence (o), and procollagen module (C) of TSP1 residues 1–356 (NoC1) and TSP2 residues 1–359 (NoC2) were prepared as described (21). A recombinant portion of TSP1 (residues 1–175 of the mature protein) was prepared as described previously (15). Site-directed mutagenesis of Glu⁹⁰ in TSP1-(1–175) to Ala was performed as described previously (12). Residue numbers refer to the mature sequence of secreted TSP1. The forward and reverse mutation-inducing primer sequences were 5'-GAGTGGTCTTTCCGCGCCAGGGCCAGCAGCGTG-3' and 5'-GAGTGGTCTTTCCGCGCCAGGGCCAGCAGCGTG-3', respectively. After growth on LB broth/ampicillin plates at 30 °C, the mutated plasmid was transformed into Escherichia coli XL-1 Blue cells for isolation, transformed into Rosetta cells (Novagen) for protein expression, and grown to log phase at 37 °C on LB broth plus carbenicillin (50 µg/ml) and chloramphenicol (34 µg/ml). Inclusion bodies were isolated, and the mutant recombinant protein was purified as described previously for the wild-type recombinant protein (15). Synthetic peptides derived from TSP1 were prepared as described previously (13). Recombinant S7D-VCAM-1 (soluble 7-domain vascular cell adhesion molecule-1, residues 1–674) was prepared as described previously (12). Murine laminin-1 was provided by Dr. Lance Liotta (Laboratory of Pathology, NCI). The E8 fragment of murine laminin-1 was prepared as described (22).

Antibodies and Reagents—The ₁-activating antibody TS2/16 (23) was produced by the hybridoma cell line obtained from the American Type Culture Collection. The function-blocking rat anti-human ₆ monoclonal antibody GoH3 was from Chemicon International, Inc. (Temecula, CA). The ₃₁-blocking antibody P1B5 was from Sigma. The fluorescein-conjugated anti-mouse antibody used in flow cytometry was purchased from ICN Biomedicals, Inc. (Aurora, OH). The ₄₁ integrin function inhibitor (4-((2-methylphenyl)aminocarbonyl)aminophenyl)acetyl-LDVP (24) was obtained from Bachem (Torrance, CA). Peroxidase-labeled goat anti-mouse IgG was from Kirkegaard & Perry Laboratories, Inc. (Gaithersburg, MD).

Cell Adhesion Assay—Laminin-1 (5 µg/ml), TSP1 (40 µg/ml), S7DVCAM-1 (5 µg/ml), and NoC1 and NoC2 (30 µg/ml) in Dulbecco's phosphate-buffered saline (DPBS) and TSP1-(1–175) (30 µg/ml) in 20 mM NaHCO₃ (pH 8.0) were absorbed (as triplicates of 8-µl drops) onto polystyrene dishes (Falcon 1008) by overnight incubation at 4 °C. The drops were aspirated, and the plates were blocked by incubation with 1% bovine serum albumin (BSA) in DPBS for 30 min. Cells were dissociated using 2 mM EDTA in DPBS and resuspended in medium 199 containing 0.1% BSA at 5 x 10⁶ cells/ml for HUVE cells or in Dulbecco's modified Eagle's medium containing 25 mM HEPES for HT-1080 cells. For activating ₁ integrins, antibody TS2/16 was added at 5–10 µg/ml. For inhibition studies, the anti-₆ antibody GoH3 at 5–10 µg/ml or peptide LALERKDHSG at 200 µM was added. After incubation for 1 h at 37 °Cin5%CO₂, the dishes were washed three times with DPBS and fixed for 30 min with 1% glutaraldehyde in DPBS. After staining with Diff-Quik solution II (Dade Behring, New Castle, DE), cells were counted microscopically in 0.25-mm² fields for each triplicate analysis. Only cells with a diameter >25 µm were considered spread, and cells with a diameter <25 µm were considered attached.

₆ Integrin Expression—Semiquantitative reverse transcription-PCR was used to determine the expression levels of ₆₁ integrin on endothelial cells. Total RNA was isolated from HUVE and HDMVE cells using TRIzol reagent (Invitrogen). First strand cDNA synthesis was performed with Superscript II reverse transcriptase (Invitrogen) using 2 µg of total RNA. The enzyme was inactivated at 70 °C for 15 min. The cDNA was amplified using platinum Taq DNA polymerase (Invitrogen) and specific primer pairs for ₆ integrin (sense, AAGTCTCAGTTTCTTGCTTGGG; and antisense, TTCTTTGTTGACCACCCTCC). Amplification was carried out for two cycles of 1 min at 95 °C and 4 min at 55 °C, followed by 30 cycles of 1 min at 95 °C, 2.5 min at 55 °C, and 10 min at 70 °C.

Flow Cytometry Analysis—HUVE and HDMVE cells were washed with DPBS containing 0.2% BSA and incubated with Puck's saline containing 0.2% EDTA and 10% FBS at 37 °C for 6 min. Cells were dislodged and resuspended in a large volume of Puck's saline/EDTA solution, centrifuged, resuspended in DPBS containing 0.2% BSA at a density of 6 x 10⁶ cells/ml, and stored on ice. Cells (1 x 10⁶/labeling reaction) were incubated with 2 µg of antibody TS2/16 as a control or with 2 µg of antibody GoH3 for 1 h. Cells were washed twice with DPBS and 0.2% EDTA and incubated with fluorescein isothiocyanate-conjugated anti-mouse antibody for 1 h. Labeled cells were washed again and fixed with 300 µl of 1% formaldehyde in DPBS. Flow cytometry acquisition was performed using a BD Biosciences flow cytometer.

Immunoprecipitation Analysis—HUVE or HDMVE cells grown in 10-cm dishes were dislodged with 2 mM EDTA, centrifuged, and resuspended (1 x 10⁶ cells/ml) in a 1 mg/ml solution of EZ-Link Sulfo-NHSLC-Biotin (Pierce) at room temperature for 1 h. After washing with DPBS, the cells were lysed with radioimmune precipitation assay buffer (50 mM Tris (pH 7.5), 150 mM NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, 1 mM EGTA, and 1 mM NaF supplemented with 10 µg/ml each antipain, pepstatin A, chymostatin, leupeptin, aprotinin, and soybean trypsin inhibitor and 1 mM phenylmethylsulfonyl fluoride), and the lysate was precleared by centrifugation. Equal volumes with equal protein concentrations were immunoprecipitated using the anti-₆ antibody GoH3 prebound to anti-mouse IgG agarose (Sigma). The immune complexes were washed six times with Tris-buffered saline, diluted with sample buffer containing 10% -mercaptoethanol, heated, and fractionated on precast SDS gels (Bio-Rad). After transfer to a polyvinylidene fluoride membrane, the proteins were detected using horse-radish peroxidase-conjugated streptavidin and visualized using chemiluminescent substrate (Pierce).

Chemotaxis—HDMVE cells at passages 5–8 were used 2–3 days after passage. Modified Boyden chambers and 8-µm pore polycarbonate membranes (NeuroProbe, Gaithersburg, MD) coated with 100 µg/ml gelatin in 0.1% aqueous acetic acid were used. Cells were dislodged with 2 mM EDTA and allowed to recover for 30 min suspended in complete medium. After centrifugation, the cells were resuspended in medium 199 containing 0.1% BSA and added (56 µl) to the upper chamber in the absence or presence of TSP1 (30 µg/ml), NoC1 or NoC2 (20 µg/ml), or blocking antibodies. Wells in the lower chamber contained 28 µl of assay medium alone or with TSP1 (30 µg/ml) or NoC1 or NoC2 (20 µg/ml). Cells were allowed to migrate for 6 h. The membranes were fixed and stained. Migrated cells were counted microscopically.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
₆₁ Integrin Mediates Microvascular Endothelial Cell Adhesion to TSP1—Residues 175–242 of the N-terminal module of TSP1 contain a recognition site for ₃₁ (13) that is partially responsible for adhesion of microvascular endothelial cells to TSP1 (18). However, TSP1-(1–175) was only severalfold less active than intact TSP1 in mediating adhesion of antibody TS2/16-activated HDMVE cells (Fig. 1A). This region contains an ₄₁-binding site that mediates adhesion of large vessel endothelial cells,² but an ₄₁ antagonist did not significantly inhibit adhesion of HDMVE cells to TSP1-(1–175) or intact TSP1 (Fig. 1B). Because adhesion to this region was inhibited by a ₁-blocking antibody (data not shown), we used function-blocking antibodies specific for other subunits to define its specificity. An antibody against ₉₁ integrin was inactive (data not shown), but an ₆-blocking antibody reproducibly decreased adhesion of HDMVE cells to TSP1 and TSP1-(1–175) (Fig. 1B). Inhibition of adhesion to TSP1-(1–175) by antibody GoH3 was comparable to that obtained using the known ₆₁ ligand laminin-1 (Fig. 1B).

View larger version (16K): [in this window] [in a new window]   FIG. 1. 61 integrin mediates microvascular endothelial cell adhesion to TSP1. A, adhesion of HDMVE cells was determined in the presence of 5 µg/ml antibody TS2/16 on substrates coated with the indicated concentrations of TSP1 and TSP1-(1–175) (expressed on a subunit basis). HDMVE cells (2–2.5 x 105/ml) were seeded, and cell attachment was quantified after 1 h by fixation with 1% glutaraldehyde and staining with Diff-Quick solution II. Results are expressed as the number of cells/mm2 (±S.D.) from at least three different experiments. B, the roles of 61 and 41 integrins in HDMVE cell adhesion were tested on immobilized TSP1, TSP1-(1–175), and laminin-1, a known 61 integrin ligand. Dishes were coated overnight with TSP1 (40 µg/ml), TSP-(1–175) (30 µg/ml), or murine laminin-1 (LN; 5 µg/ml). To inhibit 61- or 41-mediated adhesion, antibody GoH3 (5 µg/ml) or a specific 41 inhibitor ((4-((2-methylphenyl)aminocarbonyl)aminophenyl)acetyl-LDVP (phLDVP), 1 µM) was added in the presence of antibody TS2/16. C, 61-dependent adhesion of HDMVE cells to TSP1 or TSP1-(1–175) was tested in the absence or presence of the 1-activating antibody TS2/16 (5 µg/ml) and the 6-blocking antibody GoH3 (5 µg/ml).

₆₁ also played a significant role in adhesion of unstimulated HDMVE cells to TSP1 and TSP1-(1–175) (Fig. 1C). Antibody GoH3 inhibited adhesion of unstimulated cells by 50 ± 17% to intact TSP1 and by 52 ± 4% to TSP1-(1–175). Activation using antibody TS2/16 increased adhesion to TSP1-(1–175) by 5-fold, and this adhesion remained 56 ± 3% inhibitable by antibody GoH3. Therefore, TSP1 differs from the activation-independent ₆₁ ligand Cyr61 (25) in that its interaction with the integrin is partially activation-dependent.

Inhibition by the anti-₆₁ antibody was reproducibly observed using several independent isolates of HDMVE cells, but not using HUVE cells (Fig. 2A). An ₄₁ antagonist reproducibly inhibited adhesion of antibody TS2/16-activated HUVE cells to TSP1-(1–175), but not to laminin-1 (Fig. 2A). HUVE cell adhesion to this known ₆₁ ligand was only slightly inhibited by the anti-₆₁ antibody (Fig. 2A), suggesting that ₆₁ integrin is either absent or not functional in these cells. To determine whether the distinct behavior of HDMVE and HUVE cells was unique to endothelial cells from these anatomical sites, we tested microvascular and large vessel cells from different organs. Adhesion of iliac vein endothelial (AG10773A) cells was also insensitive to the anti-₆₁ antibody (Fig. 2B), whereas HMVE-L cell adhesion was inhibited by this antibody (Fig. 2C). Therefore, the selective expression or function of ₆₁ as a TSP1 receptor may be a general characteristic of microvascular endothelial cells.

View larger version (16K): [in this window] [in a new window]   FIG. 2. Selective functions of 61 integrin in microvascular endothelial cells. Antibody TS2/16-stimulated HUVE cells were seeded onto substrates coated with TSP1-(1–175) or laminin-1 (LN) in the absence or presence of (4-((2-methylphenyl)aminocarbonyl)aminophenyl)acetyl-LDVP (phLDVP) or antibody GoH3 (A). Unstimulated or antibody TS2/16 (5 µg/ml)-stimulated adult iliac vein endothelial cells (AG10773A) (B) or HMVE-L cells (C) (2–2.5 x 105 cells/ml) were seeded on dishes coated overnight with TSP1 (40 µg/ml) or laminin-1 (5 µg/ml). 61-Mediated adhesion was evaluated using antibody GoH3 (5 µg/ml). Cell attachment was quantified as described in the legend to Fig. 1. Adhesion is expressed as the number of cells/mm2 (±S.D.) from at least three different experiments.

₆₁ Integrin Also Recognizes TSP2—Adhesion of HDMVE cells to the trimeric N-terminal regions of both TSP1 (NoC1) and TSP2 (NoC2) was ₁-dependent (Fig. 3A), but the anti-₆ antibody was a more effective inhibitor of HDMVE cell adhesion to NoC2 than to NoC1 (Fig. 3B). The lesser sensitivity for NoC1 may be explained by the presence of an ₃₁-binding site in NoC1, but not in NoC2. However, ₆₁ appears to be the major ₁ integrin in HDMVE cells that recognizes TSP2.

View larger version (9K): [in this window] [in a new window]   FIG. 3. N-terminal regions of TSP1 and TSP2 support 61 integrin binding. Adhesion of antibody TS2/16-activated HDMVE cells to NoC1 and NoC2 (30 µg/ml) was assessed in the presence of the 1-blocking monoclonal antibody 13 (5 µg/ml) (A) or antibody GoH3 (5 µg/ml) (B). Cell attachment was quantified, and results are expressed as the number of cells/mm2 (±S.D.) from at least three different experiments.

₆₁ Integrin Expression Levels Are Similar in Large and Small Vessel Cells—The levels of ₆₁ expression were measured to examine why microvascular and large vessel endothelial cells differed in their utilization of ₆₁ as a TSP receptor. ₆ mRNA was expressed at similar levels in HUVE and HDMVE cells based on reverse transcription-PCR (Fig. 4A). Cell-surface expression of ₆ and ₁ subunits assessed by flow cytometry did not differ between HUVE and HDMVE cells (Fig. 4B). However, analysis of the total expression levels by immunoprecipitation using the same anti-₆ antibody revealed some differences in the ₆ subunit (Fig. 4C). On an underexposed blot (Fig. 4C, upper panel), more intact 120-kDa ₆ subunit was reproducibly detected in HDMVE cells than in HUVE cells. By densitometry, this represented a 1.6-fold difference in ₆ subunit between HDMVE and HUVE cells. After a longer exposure (Fig. 4C, lower panel), we could also detect differences in the pattern of processed ₆ subunits or integrin-associated proteins. In addition to the intact ₆ subunit, HUVE cell immunoprecipitates contained 70- and 43-kDa proteins. The apparent masses of these proteins are consistent with the unreduced and reduced molecular masses reported for a structural variant of the ₆ integrin called ₆ parvus (26). Although the gel was run under reducing conditions, it is possible that the 70-kDa band corresponds to partially unreduced ₆ parvus. In the ₆ immunoprecipitate from HDMVE cells, these bands were less abundant relative to the intact 120-kDa ₆ subunit, but an additional unknown protein was also detected. Likewise, a slight difference in the expression levels of this integrin was also found in HMVE-L and AG10773A cells (Fig. 4D). These minor differences may not be sufficient to account for the differential function of ₆₁ in these cells.

View larger version (36K): [in this window] [in a new window]   FIG. 4. Expression of 61 integrin in large vessel and small vessel endothelial cells. A, 6 mRNA levels were quantified by reverse transcription-PCR. Products were analyzed after 30 cycles of amplification using a 1.5% agarose gel stained with ethidium bromide. B, 6 and 1 integrin-specific antibodies were used to compare protein expression of this TSP1 receptor by flow cytometry on the surface of HUVE and HDMVE cells. C, HUVE and HDMVE cells were surface-biotinylated and immunoprecipitated using the anti-6 antibody GoH3. Precipitates were analyzed by SDS-7.5% polyacrylamide gel electrophoresis under reducing conditions, transferred to a polyvinylidene fluoride membrane, and visualized by chemiluminescence. D, 6 expression levels in HMVE-L and AG10773A cells were quantified in cell lysates prepared as described for C, immunoprecipitated with the anti-6 antibody GoH3, and visualized by chemiluminescence.

Activation States of ₆₁ Integrin Differ in HUVE and HDMVE Cells—The differences in expression of ₆₁ integrin in HUVE and HDMVE cells are probably insufficient to account for the differences in its function. Alternatively, the activating antibody TS2/16 may not stimulate ₆₁ integrin equally in microvascular and large vessel endothelial cells. To test this hypothesis, we compared the activity of other integrin activation agonists in these cells (Fig. 5). In contrast to antibody TS2/16, MnCl₂ and lipopolysaccharide stimulated anti-₆₁ antibody-inhibitable adhesion of HUVE cells to TSP1 and laminin-1. Notably, we previously found that lipopolysaccharide does not activate ₃₁ integrin in endothelial cells (18), suggesting that this agonist is selective for activating ₆₁ integrin. We also used antibody TS2/16 to activate HUVE cells exposed to conditioned medium from HDMVE cells to determine whether the latter cells release growth factors that facilitate ₆₁ activation. However, the ₆₁-blocking antibody had no effect under these conditions (Fig. 5). We consistently observed less inhibition of adhesion to TSP1 and laminin substrates by the ₆₁-blocking antibody following MnCl₂ or lipopolysaccharide addition in HUVE cells compared with HDMVE cells (data not shown). These results indicate that ₆₁ is more easily activated in microvascular than in large vessel endothelial cells.

View larger version (23K): [in this window] [in a new window]   FIG. 5. 61 integrin is differently activated in HUVE cells. Adhesion of HUVE cells to TSP1 and laminin-1 (LN) was assessed in the presence of different activation agonists. HUVE cells grown for 2 days in HDMVE cell-conditioned medium were activated with antibody TS2/16 (5 µg/ml) in the absence or presence of the 6-blocking antibody (5 µg/ml). HUVE cells grown in their growth medium were activated with lipopolysaccharide (LPS; 100 ng/ml) or MnCl2 (0.4 mM) in the absence or presence of the 6-blocking antibody. Cell attachment was quantified after 1 h. Results are expressed as the number of cells/mm2 (±S.D.) from three different experiments.

Identification of an ₆₁-Binding Sequence in the N-terminal Module of TSP1—The smallest portions of TSP1 and TSP2 that supported ₆₁-dependent adhesion contain amino acids 1–175 of mature TSP1 and amino acids 1–359 of TSP2, suggesting that the ₆₁-binding site is localized in the N-terminal modules of both proteins. The N-terminal modules of TSP1 and TSP2 are evolutionarily related to the G modules of laminin subunits (27). Given that the laminin G modules contain an ₆₁-binding site (28, 29), we considered that the position of the ₆₁-binding sequence may be conserved in TSP1. Therefore, two synthetic peptides were synthesized that aligned with a proposed ₆₁-binding sequence from laminin-1, peptide AG-32 (30). However, neither LFVQEDRAQLYI (TSP1-(140–151)) nor ATGQWKSITLF (TSP1-(131–141)) inhibited HDMVE cell adhesion to TSP1 or NoC2 (Fig. 6) (data not shown).

View larger version (48K): [in this window] [in a new window]   FIG. 6. Identification of an 61 inhibitory sequence in TSP1. Adhesion of HDMVE cells to NoC2 (30 µg/ml), TSP1-(1–175) (30 µg/ml), or the E8 fragment of laminin-1 (5 µg/ml) was assayed in the absence (Control) or presence of TSP1 synthetic peptides containing the underlined conserved acidic residues at positions 35, 111, 126, 127, and 145. HDMVE cells were seeded on dishes coated overnight with the proteins. Cells were incubated for 1 h in the presence of the 1-activating antibody TS2/16 (10 µg/ml) and the indicated peptides at 200 µM. Cell attachment was quantified after 1 h by fixation with 1% glutaraldehyde and staining with Diff-Quick solution II. Results are expressed as the number of cells attached per mm2 (±S.D.).

Because integrin recognition sites often require an Asp or Glu residue (2), our second approach to identify a sequence recognized by ₆₁ integrin in TSP1 and TSP2 was to search for conserved Asp or Glu residues in the N-terminal modules of the known TSP1 and TSP2 sequences. Such conserved acidic residues are present at positions 14, 35, 90, 111, 126, 127, 145, and 162 of TSP1. We tested synthetic peptides containing six of the conserved acidic residues that were identified on this basis. Control peptides for each had Ala substituted for the conserved Asp or Glu residues. The conserved Asp/Glu residue at position 162 was previously identified as an ₄₁-binding site in TSP1 and TSP2 (12) and did not affect ₆₁-mediated adhesion. Synthetic peptides containing acidic residues 35 (ELTGAARKGSGRRLVKGPD), 126 and 127 (VSVEEA), 111 (SNGKAGTLDLS), and 145 (LFVQEDRAQLYI) were inactive (Fig. 6). However, a peptide containing Glu⁹⁰ (LALERKDHSG) strongly inhibited HDMVE cell adhesion to NoC2 (Fig. 7A), TSP1-(1–175) (Fig. 7B), and the E8 fragment of laminin-1 (Fig. 6). This inhibition was dose-dependent and specific in that control peptide LALARKDHSG was inactive (Fig. 7, A and B).

View larger version (24K): [in this window] [in a new window]   FIG. 7. The TSP1 peptide LALERKDHSG specifically inhibits cell adhesion to 61-dependent substrates. Adhesion of HDMVE cells to NoC2 (A) and TSP1-(1–175) (B) and adhesion of HT-1080 fibrosarcoma cells to NoC2 (C) and the laminin-1 E8 fragment (D) were assayed in the presence of different concentrations of the 61 integrin inhibitory peptide (LALERKDHSG) or the control peptide (LALARKDHSG). HDMVE cells (A and B) and HT-1080 cells (C and D) (2–2.5 x 105 cells/ml) were seeded on dishes coated overnight with NoC2, TSP1-(1–175), or the E8 fragment at the same concentrations given in the legend to Fig. 6. Cells were incubated for 1 h in the presence of the 1-activating antibody TS2/16 (10 µg/ml). Jurkat T cell adhesion to TSP1 (10 µg/ml) was determined using cells activated with antibody TS2/16 (4 µg/ml) in the presence of the indicated TSP1 peptides (E). MDA-MB-231 breast carcinoma cell adhesion to NoC1 (15 µg/ml) or type I collagen (5 µg/ml) was determined using antibody TS2/16-activated cells in the presence or absence of LALERKDHSG (F). Cell attachment was quantified after 1 h by fixation with 1% glutaraldehyde and staining with Diff-Quick solution II. Results are expressed as the number of cells/mm2 (±S.D.).

To confirm that the peptide antagonized ₆₁, we tested HT-1080 cells, which exhibit ₆₁-dependent adhesion to the laminin-1 E8 fragment (31). HT-1080 cell adhesion to NoC2 (Fig. 7C) and to the E8 fragment of laminin-1 (Fig. 7D), which contains its ₆₁-binding site (29), was specifically inhibited by LALERKDHSG, but not by control peptide LALARKDHSG. Similar results were obtained for adhesion of HDMVE cells on the E8 fragment of laminin-1 (Fig. 6 and data not shown).

To further confirm the specificity of LALERKDHSG as an ₆₁ ligand, we examined its ability to inhibit adhesion mediated by three other ₁ integrins (Fig. 7, E and F). ₄₁-Dependent adhesion of Jurkat T cells (Fig. 7E) and ₃₁-dependent adhesion of MDA-MB-231 breast carcinoma cells to NoC1 and 2₁-dependent adhesion of MDA-MB-231 cells to type I collagen (Fig. 7F) were not significantly inhibited by LALERKDHSG.

₆₁ Integrin Mediates Cell Spreading on TSP1—Loss of cell-cell contact induces endothelial cell spreading on TSP1 mediated by ₃₁ integrin (18). ₄₁ integrin also mediates endothelial cell adhesion and spreading on TSP1 and fragments from the N-terminal heparin-binding domain of TSP1 and TSP2.² On the other hand, ₆₁ integrin mediates spreading on several cell types (32, 33). Our results show that HDMVE cells spread on TSP1 and TSP1-(1–175) in an ₆₁-dependent manner based on inhibition by peptide LALERKDHSG (Fig. 8). The residual spreading observed could be mediated by other TSP1 receptors. ₃₁ integrin is known to participate in HDMVE adhesion to TSP1 (18), and heparan sulfate proteoglycan or low density lipoprotein receptor-related protein may contribute to adhesion to TSP1-(1–175).

View larger version (73K): [in this window] [in a new window]   FIG. 8. 61 integrin mediates HDMVE cell spreading on TSP1 and TSP1-(1–175). HDMVE cell attachment and spreading on TSP1 (40 µg/ml) and TSP1-(1–175) (30 µg/ml) after 1 integrin stimulation were inhibited using the 6-blocking peptide LALERKDHSG (200 µM). 2 mM EDTA-detached cells (2–2.5 x 105/ml) were incubated on dishes precoated with TSP1 or TSP1-(1–175) for 1 h at 37 °C in 5% CO2. Attached cells were fixed and stained for examination by light microscopy. Bar = 50 µm.

Glu⁹⁰ of TSP1 Is Required for ₆₁ Integrin Recognition— Several residues in the inhibitory sequence LALERKDHSG are highly conserved among TSP1 and TSP2 sequences from different species (Fig. 9A). Notably, the Glu residue is completely conserved in all known TSP1 and TSP2 sequences. To test the role of this residue, we mutated Glu⁹⁰ in TSP1-(1–175). Mutation of Glu⁹⁰ to Ala completely inhibited HDMVE cell adhesion to this portion of TSP1 (Fig. 9B). This loss of activity was not due to a global alteration in folding of the protein because the same mutation did not affect adhesion of Jurkat T cells to TSP1-(1–175) mediated by ₄₁ integrin (Fig. 9C) (12). Furthermore, the mutant protein retained the heparin-binding activity of the native sequence (34) (data not shown). These results indicate that Glu⁹⁰ plays an important role in ₆₁-mediated adhesion to this portion of TSP1. The high degree of homology for this sequence among TSPs from different species and the total inactivation following mutation of the conserved Glu⁹⁰ residue strongly suggest that this constitutes the ₆₁-binding site.

View larger version (22K): [in this window] [in a new window]   FIG. 9. Glu90 in the N-terminal module of TSP1 is required for 61 integrin binding. A, alignment of the 61-binding peptides in TSP1 and TSP2 from different species. B and C, the mutation E90A in the TSP1-(1–175) fragment disrupts the recognition site for 61 integrin. Antibody TS2/16 (5 µg/ml)-activated HDMVE (B) or Jurkat T (C) cells were incubated on plates coated overnight with 30 µg/ml TSP1-(1–175) (black bars) or the TSP1-(1–175)(E90A) mutant (hatched bars). Cell adhesion was quantified microscopically after fixation with 1% glutaraldehyde and staining with Diff-Quick solution II. Results are expressed as the number of cells/mm2 (±S.D.). wt, wild-type.

Role of ₆₁ Integrin in Endothelial Cell Chemotaxis—TSP1 inhibits microvascular endothelial cell motility induced by fibroblast growth factor-2 through binding to its receptor CD36 (14), but TSP1 also stimulates chemotaxis of murine lung capillary cells (LE-II) and bovine aortic endothelial cells (35). The stimulatory activity of TSP1 was inhibited by an antibody that recognizes its N-terminal module (35), suggesting that this domain of TSP1 stimulates endothelial cell chemotaxis. Consistent with the function of ₃₁ integrin in aortic endothelial wound repair (18), the anti-₃₁ antibody P1B5 partially blocked HDMVE cell chemotaxis stimulated by TSP1 or NoC1 (Fig. 10, A and B). The anti-₆₁ antibody GoH3 partially blocked migration stimulated by TSP1, NoC1, or NoC2 (Fig. 10, A–C), demonstrating that ₆₁ integrin also mediates chemotaxis of endothelial cells to TSP1 and TSP2. The effects of the ₃- and ₆-blocking antibodies on TSP1- or NoC1-stimulated endothelial cell chemotaxis were additive (Fig. 10, A and B), indicating that both ₃₁ and ₆₁ integrins are necessary for migration to TSP1. Only the ₆-blocking antibody inhibited NoC2-stimulated migration, and no additivity was observed (Fig. 10C). Given that NoC2 lacks the binding site for ₃₁ integrin, ₆₁ integrin may be the primary receptor mediating endothelial cell chemotaxis to TSP2.

View larger version (13K): [in this window] [in a new window]   FIG. 10. 61-dependent endothelial cell chemotaxis to TSP1, NoC1, and NoC2. Chemotaxis was assessed in modified Boyden chambers. HDMVE cell chemotaxis was induced by 30 µg/ml TSP1 (A) or 20 µg/ml recombinant NoC1 (B) or NoC2 (C) in medium 199 with 0.1% BSA added to the lower chamber. Cells (2–3 x 105/well) added to the upper chamber were allowed to migrate for 6 h at 37 °Cin5%CO2. HDMVE cell migration induced by the indicated attractants was assayed in the absence or presence of the 31-blocking antibody (2 µg/ml), the 61-blocking antibody (10 µg/ml), or both combined. Migrated cells were counted microscopically after fixation. Results are presented as the number of cells migrated per field (±S.D.).

Motility responses of endothelial cells to TSP1 involve both random (chemokinesis) and directional (chemotaxis) components (35). To define the contribution of each to HDMVE cell migration induced by the ₆₁-binding domains of TSP1 and TSP2, we exposed the cells to each with or without a gradient (Table I). TSP1, NoC1, or NoC2 was added to the upper chamber, the lower chamber, or both. Our results show that TSP1, NoC1, or NoC2 in the lower chamber gave the strongest stimulation of migration (Table I). However, in the absence of gradient, when the proteins were added to the upper and lower chambers, we also observed endothelial cell motility. These results indicate that as reported for native TSP1, the N-terminal domains of TSP1 and TSP2 have both directional and random effects on cell migration.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 
Several extracellular proteins have been demonstrated to be ligands for ₆₁ integrin, including laminin-1 (111), laminin-8 (441) (36), laminin-10/11 (5) (37), invasin (38), fertilin-/ADAM-2 (39), Cyr61 (40), meltrin-/ADAM-9 (41), and human papiloma virus-16 (42). We have now demonstrated that TSP1 and TSP2 are two additional ligands for this integrin. Furthermore, we have identified a peptide sequence from TSP1 that is specifically recognized by ₆₁ and demonstrated that a specific Glu residue is essential for the activity of this peptide and that of a recombinant N-terminal module of TSP1. Microvascular endothelial cell ₆₁ mediates both adhesion and motility responses to TSP1 and TSP2.

Although linear peptides are sufficient for recognition by many integrins, previous attempts to define recognition sites for ₆₁ in its protein ligands have yielded conflicting results. The mechanism by which laminins bind ₆₁ has been the most extensively studied. An ₆₁-binding site in laminin-1 is clearly located in the C-terminal proteolytic E8 fragment (28, 29). Two peptides derived from this region of the laminin 1 subunit, NRWHSIYITRFG (AG-10) and TWYKIAFQRNRK (AG-32), show some specificity for antagonizing ₆₁ (30), but other studies using recombinant fragments containing the same sequences argue against this hypothesis (43, 44). Consistent with the latter, we detected no activity in TSP1 peptides paralogous to the laminin peptide AG-32.

Phage display screening for ₆₁ integrin ligands also failed to identify any known laminin sequences, but identified three peptides that inhibit laminin-1 binding to ₆₁: VSWFSRHRYSPFAVS, HRWMPHVFAVRQGAS, and FGRIPSPLAYTYSFR (45). These sequences also bear no relationship to our TSP1 peptide. Finally, an ₆₁-binding consensus sequence was identified in ADAM-2: X(D/E)ECD (46). The active ADAM-2 sequences resemble our TSP1 peptide in that they contain one or two Glu residues, the first having the same spacing from a conserved Asp residue as seen in the TSP1 sequences (Fig. 9A). However, based on differential regulation by phorbol esters and divalent cations, the activation states of ₆₁ that recognize laminin and ADAM-2 may be different (47), implying that the recognition mechanisms also differ. Therefore, it remains to be determined whether TSPs and ADAM-2 share a common binding mechanism for ₆₁.

Based on sequence alignment of TSP N-terminal modules with laminin G modules (27), the ₆₁-binding sequence in TSP1 should span the C-terminal end of strand D and the loop between strands D and E of its predicted secondary structure (Fig. 11). Therefore, we predict that ₆₁-binding sites in laminins may also reside in the D–E loops of their G modules. Based on a previous alignment of G modules (44), Glu residues are common in the D–E loops (Fig. 11). The positions of the Glu residues are variable, however; so further work is needed to determine whether any of these are part of the ₆₁-binding sites in laminins. The D–E loop is surface-exposed on laminin G modules (44), suggesting that the inhibitory sequence we identified may also be exposed on the TSP N-terminal modules.

View larger version (33K): [in this window] [in a new window]   FIG. 11. Alignment of laminin G module sequences with the 61-binding sequences of thrombospondins. Alignment of laminin 3–5 sequences and strand assignments are according to Ref. 44. Only the N-terminal portion of the extended D–E loop of laminin 1G3 is shown. The underlined sequence indicates the 61-binding peptide identified in human (h) TSP1.

Does ₆₁ play a role in angiogenesis? In vivo expression studies demonstrated that ₆ integrins are highly expressed in capillary endothelial cells (48), although ₆₁ and ₆₄ could not be distinguished by this method. The ₆ null mouse is not informative for this issue because ₆₄ plays a critical role in epithelial integrity that results in perinatal lethality (49). ₆₄ also recognizes laminin-8 and laminin-1 E8 fragments, but we do not know whether ₆₄ can recognize TSP1 or TSP2. However, an ₆₁-blocking antibody prevents cord formation by endothelial cells plated on Matrigel, implicating ₆₁ integrin in capillary morphogenesis (50). The ₆₁ ligand Cyr61 is also a stimulator of angiogenesis (51) and promotes vascular smooth muscle chemotaxis mediated by ₆₁ integrin (52). Deletion of Cyr61 disrupts developmental angiogenesis (53), and ₆₁ mediates pro-angiogenic activities of this molecule for HUVE cells (54). Our results demonstrate that ₆₁ integrin also mediates TSP1- and TSP2-stimulated chemotaxis in microvascular endothelial cells. Thus, the ₆₁ ligands TSP1 and Cyr61 share at least two target cell types and some biological activities. However, a report published during the review of this manuscript identified a recognition sequence in Cyr61 for ₆₁ that bears no similarity to the sequence we identified in TSP1 (25).

With the addition of ₆₁, microvascular and large vessel endothelial cells are now known to differ in their expression or regulation of three TSP1 receptors. CD36 is expressed selectively in capillary endothelium (55) and is clearly required for some activities of TSP1 (14). Both ₄₁ and ₆₁ are generally expressed in endothelial cells in vitro, but we have shown that ₄₁ functions selectively in large vessel endothelial cells,² whereas ₆₁ is preferentially activated in microvascular cells. We are currently investigating the mechanism for this differential integrin activation and its functional role in mediating the effects of thrombospondins on angiogenesis.

	FOOTNOTES

 
^* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

^|| To whom correspondence should be addressed: Lab. of Pathology, NCI, NIH, Bldg. 10, Rm. 2A33, 10 Center Dr., MSC 1500, Bethesda, MD 20892-1500. Tel.: 301-496-6264; Fax: 301-402-0043; E-mail: droberts{at}helix.nih.gov.

¹ The abbreviations used are: TSPs, thrombospondins; HDMVE, human dermal microvascular endothelial; HMVE-L, human lung microvascular endothelial; FBS, fetal bovine serum; HUVE, human umbilical vein endothelial; DPBS, Dulbecco's phosphate-buffered saline; BSA, bovine serum albumin.

² M. J. Calzada, L. Zhou, J. M. Sipes, J. Zhang, H. C. Krutzsch, M. L. Iruela-Arispe, D. S. Annis, D. F. Mosher, and D. D. Roberts, submitted for publication.

	ACKNOWLEDGMENTS

 
We thank Dr. Zhuqing Li for performing the flow cytometry.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

 

1. Hynes, R. O. (2002) Cell 110, 673-687[CrossRef][Medline] [Order article via Infotrieve]
2. Yamada, K. M. (1991) J. Biol. Chem. 266, 12809-12812[Free Full Text]
3. Lawler, J. (2000) Curr. Opin. Cell Biol. 12, 634-640[CrossRef][Medline] [Order article via Infotrieve]
4. Bornstein, P. (2001) J. Clin. Invest. 107, 929-934[CrossRef][Medline] [Order article via Infotrieve]
5. Brown, E. J., and Frazier, W. A. (2001) Trends Cell Biol. 11, 130-135[CrossRef][Medline] [Order article via Infotrieve]
6. Roberts, D. D. (1996) FASEB J. 10, 1183-1191[Abstract]
7. Chen, H., Sottile, J., Strickland, D. K., and Mosher, D. F. (1996) Biochem. J. 318, 959-963
8. Febbraio, M., Hajjar, D. P., and Silverstein, R. L. (2001) J. Clin. Invest. 108, 785-791[CrossRef][Medline] [Order article via Infotrieve]
9. Lawler, J., Weinstein, R., and Hynes, R. O. (1988) J. Cell Biol. 107, 2351-2361[Abstract/Free Full Text]
10. Yabkowitz, R., Dixit, V. M., Guo, N., Roberts, D. D., and Shimizu, Y. (1993) J. Immunol. 151, 149-158[Abstract]
11. Chandrasekaran, S., Guo, N., Rodrigues, R. G., Kaiser, J., and Roberts, D. D. (1999) J. Biol. Chem. 274, 11408-11416[Abstract/Free Full Text]
12. Li, Z., Calzada, M., Sipes, J., Cashel, J., Krutzsch, H., Annis, D., Mosher, D., and Roberts, D. (2002) J. Cell Biol. 157, 509-519[Abstract/Free Full Text]
13. Krutzsch, H. C., Choe, B., Sipes, J. M., Guo, N., and Roberts, D. D. (1999) J. Biol. Chem. 274, 24080-24086[Abstract/Free Full Text]
14. Dawson, D. W., Pearce, S. F., Zhong, R., Silverstein, R. L., Frazier, W. A., and Bouck, N. P. (1997) J. Cell Biol. 138, 707-717[Abstract/Free Full Text]
15. Vogel, T., Guo, N. H., Krutzsch, H. C., Blake, D. A., Hartman, J., Mendelovitz, S., Panet, A., and Roberts, D. D. (1993) J. Cell. Biochem. 53, 74-84[CrossRef][Medline] [Order article via Infotrieve]
16. Iruela-Arispe, M. L., Lombardo, M., Krutzsch, H. C., Lawler, J., and Roberts, D. D. (1999) Circulation 100, 1423-1431[Abstract/Free Full Text]
17. Kanda, S., Shono, T., Tomasini-Johansson, B., Klint, P., and Saito, Y. (1999) Exp. Cell Res. 252, 262-272[CrossRef][Medline] [Order article via Infotrieve]
18. Chandrasekaran, L., He, C.-Z., Al-Barazi, H. O., Krutzsch, H. C., Iruela-Arispe, M. L., and Roberts, D. D. (2000) Mol. Biol. Cell 11, 2885-2900[Abstract/Free Full Text]
19. Taraboletti, G., Morbidelli, L., Donnini, S., Parenti, A., Granger, H. J., Giavazzi, R., and Ziche, M. (2000) FASEB J. 14, 1674-1676[Free Full Text]
20. Roberts, D. D., Cashel, J., and Guo, N. (1994) J. Tissue Cult. Methods 16, 217-222
21. Misenheimer, T. M., Huwiler, K. G., Annis, D. S., and Mosher, D. F. (2000) J. Biol. Chem. 275, 40938-40945[Abstract/Free Full Text]
22. Yurchenco, P. D., and O'Rear, J. J. (1994) Methods Enzymol. 245, 489-518[Medline] [Order article via Infotrieve]
23. Hemler, M. E., Sanchez-Madrid, F., Flotte, T. J., Krensky, A. M., Burakoff, S. J., Bhan, A. K., Springer, T. A., and Strominger, J. L. (1984) J. Immunol. 132, 3011-3018[Abstract]
24. Lin, K., Ateeq, H. S., Hsiung, S. H., Chong, L. T., Zimmerman, C. N., Castro, A., Lee, W. C., Hammond, C. E., Kalkunte, S., Chen, L. L., Pepinsky, R. B., Leone, D. R., Sprague, A. G., Abraham, W. M., Gill, A., Lobb, R. R., and Adams, S. P. (1999) J. Med. Chem. 42, 920-934[CrossRef][Medline] [Order article via Infotrieve]
25. Leu, S.-J., Liu, Y., Chen, N., Chen, C.-C., Lam, S. C.-T., and Lau, L. F. (2003) J. Biol. Chem. 278, 33801-33808[Abstract/Free Full Text]
26. Davis, T. L., Rabinovitz, I., Futscher, B. W., Schnolzer, M., Burger, F., Liu, Y., Kulesz-Martin, M., and Cress, A. E. (2001) J. Biol. Chem. 276, 26099-26106[Abstract/Free Full Text]
27. Beckmann, G., Hanke, J., Bork, P., and Reich, J. G. (1998) J. Mol. Biol. 275, 725-730[CrossRef][Medline] [Order article via Infotrieve]
28. Hall, D. E., Reichardt, L. F., Crowley, E., Holley, B., Moezzi, H., Sonnenberg, A., and Damsky, C. H. (1990) J. Cell Biol. 110, 2175-2184[Abstract/Free Full Text]
29. Sonnenberg, A., Linders, C. J., Modderman, P. W., Damsky, C. H., Aumailley, M., and Timpl, R. (1990) J. Cell Biol. 110, 2145-2155[Abstract/Free Full Text]
30. Nomizu, M., Kim, W. H., Yamamura, K., Utani, A., Song, S. Y., Otaka, A., Roller, P. P., Kleinman, H. K., and Yamada, Y. (1995) J. Biol. Chem. 270, 20583-20590[Abstract/Free Full Text]
31. Aumailley, M., Timpl, R., and Sonnenberg, A. (1990) Exp. Cell Res. 188, 55-60[CrossRef][Medline] [Order article via Infotrieve]
32. Bosco, D., Meda, P., Halban, P. A., and Rouiller, D. G. (2000) Diabetes 49, 233-243[Abstract]
33. Le Bellego, F., Pisselet, C., Huet, C., Monget, P., and Monniaux, D. (2002) J. Endocrinol. 172, 45-59[Abstract]
34. Yu, H., Tyrrell, D., Cashel, J., Guo, N. H., Vogel, T., Sipes, J. M., Lam, L., Fillit, H. M., Hartman, J., Mendelovitz, S., Panel, A., and Roberts, D. D. (2000) Arch. Biochem. Biophys. 374, 13-23[CrossRef][Medline] [Order article via Infotrieve]
35. Taraboletti, G., Roberts, D., Liotta, L. A., and Giavazzi, R. (1990) J. Cell Biol. 111, 765-772[Abstract/Free Full Text]
36. Kortesmaa, J., Yurchenco, P., and Tryggvason, K. (2000) J. Biol. Chem. 275, 14853-14859[Abstract/Free Full Text]
37. Kikkawa, Y., Sanzen, N., Fujiwara, H., Sonnenberg, A., and Sekiguchi, K. (2000) J. Cell Sci. 113, 869-876[Abstract]
38. Isberg, R. R., and Leong, J. M. (1990) Cell 60, 861-871[CrossRef][Medline] [Order article via Infotrieve]
39. Almeida, E. A., Huovila, A. P., Sutherland, A. E., Stephens, L. E., Calarco, P. G., Shaw, L. M., Mercurio, A. M., Sonnenberg, A., Primakoff, P., Myles, D. G., and White, J. M. (1995) Cell 81, 1095-1104[CrossRef][Medline] [Order article via Infotrieve]
40. Chen, N., Chen, C.-C., and Lau, L. F. (2000) J. Biol. Chem. 275, 24953-24961[Abstract/Free Full Text]
41. Nath, D., Slocombe, P. M., Webster, A., Stephens, P. E., Docherty, A. J., and Murphy, G. (2000) J. Cell Sci. 113, 2319-2328[Abstract]
42. Yoon, C. S., Kim, K. D., Park, S. N., and Cheong, S. W. (2001) Biochem. Biophys. Res. Commun. 283, 668-673[CrossRef][Medline] [Order article via Infotrieve]
43. Sung, U., O'Rear, J. J., and Yurchenco, P. D. (1993) J. Cell Biol. 123, 1255-1268[Abstract/Free Full Text]
44. Timpl, R., Tisi, D., Talts, J. F., Andac, Z., Sasaki, T., and Hohenester, E. (2000) Matrix Biol. 19, 309-317[CrossRef][Medline] [Order article via Infotrieve]
45. Murayama, O., Nishida, H., and Sekiguchi, K. (1996) J. Biochem. (Tokyo) 120, 445-451[Abstract/Free Full Text]
46. Zhu, X., Bansal, N. P., and Evans, J. P. (2000) J. Biol. Chem. 275, 7677-7683[Abstract/Free Full Text]
47. Chen, M. S., Almeida, E. A., Huovila, A. P., Takahashi, Y., Shaw, L. M., Mercurio, A. M., and White, J. M. (1999) J. Cell Biol. 144, 549-561[Abstract/Free Full Text]
48. Enenstein, J., and Kramer, R. H. (1994) J. Investig. Dermatol. 103, 381-386[CrossRef][Medline] [Order article via Infotrieve]
49. van der Neut, R., Krimpenfort, P., Calafat, J., Niessen, C. M., and Sonnenberg, A. (1996) Nat. Genet. 13, 366-369[CrossRef][Medline] [Order article via Infotrieve]
50. Davis, G. E., and Camarillo, C. W. (1995) Exp. Cell Res. 216, 113-123[CrossRef][Medline] [Order article via Infotrieve]
51. Babic, A. M., Kireeva, M. L., Kolesnikova, T. V., and Lau, L. F. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 6355-6360[Abstract/Free Full Text]
52. Grzeszkiewicz, T. M., Lindner, V., Chen, N., Lam, S. C.-T., and Lau, L. F. (2002) Endocrinology 143, 1441-1450[Abstract/Free Full Text]
53. Mo, F. E., Muntean, A. G., Chen, C.-C., Stolz, D. B., Watkins, S. C., and Lau, L. F. (2002) Mol. Cell Biol. 22, 8709-8720[Abstract/Free Full Text]
54. Leu, S.-J., Lam, S. C.-T., and Lau, L. F. (2002) J. Biol. Chem. 277, 46248-46255[Abstract/Free Full Text]
55. Swerlick, R. A., Lee, K. H., Wick, T. M., and Lawley, T. J. (1992) J. Immunol. 148, 78-83[Abstract]

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				A. Liu, P. Garg, S. Yang, P. Gong, M. A. Pallero, D. S. Annis, Y. Liu, A. Passaniti, D. Mann, D. F. Mosher, et al. Epidermal Growth Factor-like Repeats of Thrombospondins Activate Phospholipase C{gamma} and Increase Epithelial Cell Migration through Indirect Epidermal Growth Factor Receptor Activation J. Biol. Chem., March 6, 2009; 284(10): 6389 - 6402. [Abstract] [Full Text] [PDF]

				S. Heymans, E. Hirsch, S. D. Anker, P. Aukrust, J.-L. Balligand, J. W. Cohen-Tervaert, H. Drexler, G. Filippatos, S. B. Felix, L. Gullestad, et al. Inflammation as a therapeutic target in heart failure? A scientific statement from the Translational Research Committee of the Heart Failure Association of the European Society of Cardiology Eur J Heart Fail, February 1, 2009; 11(2): 119 - 129. [Abstract] [Full Text] [PDF]

				G. Martin-Manso, S. Galli, L. A. Ridnour, M. Tsokos, D. A. Wink, and D. D. Roberts Thrombospondin 1 Promotes Tumor Macrophage Recruitment and Enhances Tumor Cell Cytotoxicity of Differentiated U937 Cells Cancer Res., September 1, 2008; 68(17): 7090 - 7099. [Abstract] [Full Text] [PDF]

				K. Tan, M. Duquette, J.-h. Liu, K. Shanmugasundaram, A. Joachimiak, J. T. Gallagher, A. C. Rigby, J.-h. Wang, and J. Lawler Heparin-induced cis- and trans-Dimerization Modes of the Thrombospondin-1 N-terminal Domain J. Biol. Chem., February 15, 2008; 283(7): 3932 - 3941. [Abstract] [Full Text] [PDF]

				O. I. Stenina, E. J. Topol, and E. F. Plow Thrombospondins, Their Polymorphisms, and Cardiovascular Disease Arterioscler. Thromb. Vasc. Biol., September 1, 2007; 27(9): 1886 - 1894. [Abstract] [Full Text] [PDF]

				V.-M. Leppanen, H. Tossavainen, P. Permi, L. Lehtio, G. Ronnholm, A. Goldman, I. Kilpelainen, and T. Pihlajamaa Crystal Structure of the N-terminal NC4 Domain of Collagen IX, a Zinc Binding Member of the Laminin-Neurexin-Sex Hormone Binding Globulin (LNS) Domain Family J. Biol. Chem., August 10, 2007; 282(32): 23219 - 23230. [Abstract] [Full Text] [PDF]

				J. S. Isenberg, Y. Jia, J. Fukuyama, C. H. Switzer, D. A. Wink, and D. D. Roberts Thrombospondin-1 Inhibits Nitric Oxide Signaling via CD36 by Inhibiting Myristic Acid Uptake J. Biol. Chem., May 25, 2007; 282(21): 15404 - 15415. [Abstract] [Full Text] [PDF]

				I. Staniszewska, S. Zaveri, L. D. Valle, I. Oliva, V. L. Rothman, S. E. Croul, D. D. Roberts, D. F. Mosher, G. P. Tuszynski, and C. Marcinkiewicz Interaction of {alpha}9{beta}1 Integrin With Thrombospondin-1 Promotes Angiogenesis Circ. Res., May 11, 2007; 100(9): 1308 - 1316. [Abstract] [Full Text] [PDF]

				A. Krispin, Y. Bledi, M. Atallah, U. Trahtemberg, I. Verbovetski, E. Nahari, O. Zelig, M. Linial, and D. Mevorach Apoptotic cell thrombospondin-1 and heparin-binding domain lead to dendritic-cell phagocytic and tolerizing states Blood, November 15, 2006; 108(10): 3580 - 3589. [Abstract] [Full Text] [PDF]

				S. A. Kuznetsova, A. J. Day, D. J. Mahoney, M. S. Rugg, D. F. Mosher, and D. D. Roberts The N-terminal Module of Thrombospondin-1 Interacts with the Link Domain of TSG-6 and Enhances Its Covalent Association with the Heavy Chains of Inter-{alpha}-trypsin Inhibitor J. Biol. Chem., September 2, 2005; 280(35): 30899 - 30908. [Abstract] [Full Text] [PDF]

				H. Baba, Y. Yonemitsu, T. Nakano, M. Onimaru, M. Miyazaki, Y. Ikeda, S. Sumiyoshi, Y. Ueda, M. Hasegawa, I. Yoshino, et al. Cytoplasmic Expression and Extracellular Deposition of an Antiangiogenic Factor, Pigment Epithelium-Derived Factor, in Human Atherosclerotic Plaques Arterioscler. Thromb. Vasc. Biol., September 1, 2005; 25(9): 1938 - 1944. [Abstract] [Full Text] [PDF]

				S.-J. Leu, N. Chen, C.-C. Chen, V. Todorovic, T. Bai, V. Juric, Y. Liu, G. Yan, S. C.-T. Lam, and L. F. Lau Targeted Mutagenesis of the Angiogenic Protein CCN1 (CYR61): SELECTIVE INACTIVATION OF INTEGRIN {alpha}6{beta}1-HEPARAN SULFATE PROTEOGLYCAN CORECEPTOR-MEDIATED CELLULAR FUNCTIONS J. Biol. Chem., October 15, 2004; 279(42): 44177 - 44187. [Abstract] [Full Text] [PDF]

				M. J. Calzada, D. S. Annis, B. Zeng, C. Marcinkiewicz, B. Banas, J. Lawler, D. F. Mosher, and D. D. Roberts Identification of Novel {beta}1 Integrin Binding Sites in the Type 1 and Type 2 Repeats of Thrombospondin-1 J. Biol. Chem., October 1, 2004; 279(40): 41734 - 41743. [Abstract] [Full Text] [PDF]

				M. J. Calzada, L. Zhou, J. M. Sipes, J. Zhang, H. C. Krutzsch, M. L. Iruela-Arispe, D. S. Annis, D. F. Mosher, and D. D. Roberts {alpha}4{beta}1 Integrin Mediates Selective Endothelial Cell Responses to Thrombospondins 1 and 2 In Vitro and Modulates Angiogenesis In Vivo Circ. Res., March 5, 2004; 94(4): 462 - 470. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 278/42/40679    most recent M302014200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Calzada, M. J. Articles by Roberts, D. D. Search for Related Content PubMed PubMed Citation Articles by Calzada, M. J. Articles by Roberts, D. D. Social Bookmarking                      What's this?