Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M304372200 on July 14, 2003

J. Biol. Chem., Vol. 278, Issue 42, 40933-40942, October 17, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/42/40933    most recent
M304372200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Haumaitre, C.
Right arrow Articles by Cereghini, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Haumaitre, C.
Right arrow Articles by Cereghini, S.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Functions of HNF1 Family Members in Differentiation of the Visceral Endoderm Cell Lineage*

Cécile Haumaitre {ddagger} §, Michaël Reber {ddagger}  and Silvia Cereghini ||

From the Unité 423 INSERM, Hôpital Necker-Enfants Malades, 149 Rue de Sèvres, 75015 Paris, France

Received for publication, April 28, 2003 , and in revised form, July 2, 2003.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
The two members of the hepatocyte nuclear factor 1 (HNF1) transcription factor family, HNF1 and variant HNF1 (vHNF1), show a strong homology in their atypical POU-homeodomain and dimerization domain but differ in their transactivation domains. Moreover, two vHNF1 isoforms generated by alternative splicing are present in all tissues expressing this gene. vHnf1-deficient mouse embryos die soon after implantation due to defective visceral endoderm formation, an extraembryonic tissue essential for development and survival of the embryo proper. In contrast, invalidation of Hnf1, which is expressed at later developmental stages than vHnf1, does not lead to embryonic lethality or developmental defects. To examine the specific or potential equivalent functions of vHNF1 isoforms and HNF1 during the process of visceral endoderm differentiation, we stably reexpressed these factors in vHnf1-deficient embryonic stem cells. Analysis of these embryonic stem cells upon differentiation into embryoid bodies shows that vHNF1 isoforms exhibit specific behaviors depending on particular target genes and cooperate in the establishment of a functional visceral endoderm. Furthermore, forced expression of HNF1 in vHnf1-deficient embryonic stem cells fully restores the formation of a mature visceral endoderm with the correct expression profile of early and late markers of this lineage. Thus, in this context, HNF1 functionally replaces both vHNF1 isoforms, suggesting that the different developmental functions of these transcription factors are mainly due to the acquisition of novel expression patterns.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Duplication of developmental control genes is thought to be an evolutionary mechanism for the generation of novel functions allowing for increased diversity in complex organisms. Acquisition of new functions principally involves the evolution of cis-regulatory sequences, although coding sequences have also evolved, albeit at significantly lower levels (1). The genes encoding the transcription factors hepatocyte nuclear factor 1 (HNF1{alpha} and Tcf-1) and variant HNF1 (vHNF1, HNF-1{beta}, and Tcf-2) have arisen by duplication of an ancestral gene at the onset of vertebrate evolution. They belong to a distinct subclass of the homeobox transcription factor family characterized by a highly conserved N-terminal DNA binding domain and a more divergent C-terminal transactivation domain. The DNA binding domain is composed of three conserved regions: the N-terminal dimerization domain, an atypical POU-specific (POUs)1 domain and a divergent POU homeodomain (POUH), containing a loop of 21 amino acids between helices 2 and 3. The POUs and POUH domains are required for sequence specificity and DNA recognition (2). Recent three-dimensional structure analysis indicates that the POUs domain interacts with the atypical insertion of the homeodomain to create a stable interface, further distinguishing HNF1/vHNF1 from other flexible POU-homeodomain factors (3). Because of these particular structural features, HNF1 and vHNF1 bind DNA as dimers or heterodimers and display indistinguishable DNA-binding sequence specificity (4–7). HNF1 is however a more powerful activator than vHNF1, implying that these two factors display distinct regulatory properties in vivo (4, 8).

vHNF1 and HNF1 are co-expressed in the yolk sac endoderm and in developing liver, kidney, and pancreas, although with different spatio-temporal patterns (9–13). Transcription of the vHnf1 gene precedes that of HNF1 starting from the earliest stages of differentiation of these organs. HNF1 appears later, during the maturation stages. Notably, vHnf1 is uniquely expressed in the primitive and visceral endoderm from embryonic day 4.5 to 7.5 and in the liver, pancreatic, and ureteric buds at embryonic days 9.5–11 (12). HNF1 appears in the visceral endoderm of the yolk sac around embryonic day 8.5 and in the liver and pancreatic buds at embryonic day 10.5, after specification of these organs from the gut endoderm (11, 14). In addition, vHnf1 is expressed in the forming neural tube, the lungs, and the genital tract, where HNF1 is absent (12, 13, 15).

Consistent with these embryonic expression patterns, vHnf1-deficient mouse embryos die shortly after implantation due to defective visceral endoderm (VE) formation (12, 16). The VE is an extraembryonic tissue, source of nutrients and multiple signals essential for normal development of the pregastrulating mouse embryo. In addition to its nutritional and histotrophic role, the VE participates in other embryonic developmental processes including early anterior neural patterning (17), cavitation of the ectoderm (18), and specification of hematopoietic and endothelial cell fates (19). vHnf1 homozygous mutant embryos lack a distinct extraembryonic VE and as a consequence the ectodermal cells are severely disorganized. In contrast, HNF1 is not required for normal development, although Hnf1-deficient mice die during postnatal life because of hepatic, pancreatic and renal dysfunction (20–22).

The sequential expression of vHNF1 and HNF1 in diverse tissues, along with their structural similarities, raise the question of whether the distinct function of these factors is defined by their different spatiotemporal expression patterns or by their intrinsic biochemical activities. An additional level of complexity in elucidating the precise function of these factors comes from the existence of different isoforms generated by either constitutive or regulated alternative splicing. Whereas in mice, transcription of the Hnf1 gene generates only one major transcript, two isoforms of vHNF1 designated vHNF1-A and -B, resulting from alternative exon usage, are always present, albeit at different levels, in all tissues where vHnf1 is expressed (8, 11, 23). These two isoforms, which differ in the insertion of 26 amino acids between the POUs domain and the homeodomain, retain compatible dimerization domains and essentially identical DNA binding and transactivation domains. This pattern of alternative splicing is conserved through evolution from rodents to humans. It remains unclear why these two structurally highly similar proteins are co-expressed and whether they display distinct or complementary functions in vivo.

In the present study, we have examined whether vHNF1-A, vHNF1-B, and HNF1 have similar or distinct functions during the process of VE specification upon differentiation of embryonic stem (ES) cells into embryoid bodies (EB). The EBs derived from ES cells homozygous deleted for vHnf1 display a specific block in the formation of a surrounding layer of VE and lack the expression of early and late VE markers, whereas other differentiation programs do not appear to be affected (12). We therefore took advantage of our homozygous vHnf1-deficient ES cells, which are deleted of the two vHNF1 spliced isoforms and in which activation of HNF1 is impaired upon differentiation, to stably reexpress vHNF1-A, vHNF1-B, or HNF1. Using this model system, we show here that vHNF1-A and vHNF1-B isoforms exhibit similar and complementary functions in the VE specification, whereas HNF1 alone can substitute for the function of both vHNF1 isoforms in this process. On the basis of recent studies (24) and the results presented here, we also propose an integrative model of the regulatory network that governs the establishment and maturation of the VE.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Plasmid Constructs—The 2.3-kb rat HNF1 cDNA, the 1.6 kb rat vHNF1-A, and mouse vHNF1-B cDNAs were cloned in the pCB6 vector (25) containing the cytomegalovirus promoter and the polyadenylation site of the bovine growth hormone at the BglII site. All the reporter plasmids contain the bacterial gene encoding chloramphenicol acetyltransferase (CAT). palb-CAT –386/+4 (26) is a construct containing a promoter derived from the rat albumin promoter driving the CAT reporter gene. pHAF-CAT contains the –1023 to +33 bp region of the mouse Afp promoter (27). pHNF4{alpha}-CAT contains the –572 to +25 region of the mouse Hnf4{alpha} promoter (28) and was generated by PCR using mouse genomic DNA and the primers forward (TTCAGCTGGAGCAACCAAGAGATATC) and reverse (TCCCTTCTCTGCCTTCCTCTC). The PCR product was cloned in pGEM-Teasy (Promega), verified by sequencing, and subsequently subcloned into the pBLCAT6 (29). The HNF1 binding sites within these plasmids and their localization within the original promoters of the genes tested are as follows: for the AFP reporter, two sites at –131 and –67, respectively (30); for the HNF4{alpha} reporter, a site at –98 (28, 31); and for the albumin reporter, a site at –60 (32). HNF1, vHNF1-A, and vHNF1-B cDNAs were cloned in the {beta}-actin-puro expression vector at the BamHI site (33).

Cell Culture, Transfections, and ES Cell Electroporation—Human epithelial cervical tumor cells (C33) and human embryonic kidney cells (HEK 293) were grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum. Transient transfections were carried out by the calcium phosphate co-precipitation procedure as described by Power and Cereghini (34). Cells were transfected with increasing amounts of expression vectors (1–200 ng), 2 µg of the reporter plasmid containing the promoter of interest driving the CAT reporter gene, and 0.6 µg of pRSV-{beta}-galactosidase as an internal control for transfection. Total amount of expression vector was equalized with the pCB6 plasmid. {beta}-Galactosidase activity was measured by the standard colorimetric method, and CAT assays were performed as described by Seed and Sheen (35). Each measurement was repeated at least four times with different plasmid preparations.

ES cells were cultured and differentiated as described by Barbacci et al. (12). 10 µg of HNF1-{beta}actin-puro vector or vHNF1-{beta}actin-puro vector were linearized after digestion with SfiI restriction enzyme and electroporated into 1 x 107 vHnf1–/– ES cells (clone 9), resuspended in 800 µl of Dulbecco's modified Eagle's medium without fetal calf serum at 180 V and 1050 microfarads. Transfected ES cells were grown 5 days in Dulbecco's modified Eagle's medium containing 2 µg/ml puromycin, and roughly 30 puromycin-resistant clones for each electroporation were picked for amplification.

Protein Extracts and Gel Mobility Shift Assays—Gel retardation assays were performed as described by Cereghini (32). The probes used encompassed the HNF1 binding site of the albumin promoter (proximal element probe) (32) and that of the Hnf4{alpha} promoter (4FP1 probe) (31).

RNA and Protein Analysis—Screening of the ES clones was carried out by both gel retardation assay and RT-PCR. vHNF1 and HNF1 ES clones were differentiated into EBs as previously described (12). Total RNA and nuclear protein extractions from ES cells and EBs, gel retardation assay, and first strand cDNA synthesis were performed as described by Cereghini (11). 2 µl of the reverse transcriptase reaction were amplified in a 25-µl PCR reaction. The number of cycles for amplification of each PCR product was determined to be in the linear phase of amplification. PCR products were electrophoresed on 1.8% agarose gel, transferred to nylon membrane (NX; Amersham Biosciences), and hybridized with the corresponding internal probes. RNA levels were normalized by the expression of GAPDH.

The forward (f) and reverse (r) primer sequences, chosen in different exons, were as follows: rat/mouse HNF1 f, AGCACCCTTGCCAGCCTC; rat HNF1 f, GATGGCTCTGAGGTGTCT; mouse HNF1 r, GACACCTCAGAGCCATCC; mouse vHNF1 f, TGGTGTCCAAGCTCACGTC; mouse vHNF1 r, CAGTCGGAGGACACCTGCTC; HNF3{gamma} f, ATGCTGGGCTCAGTGAAGAT; HNF3{gamma} r, CAAGCTTGGGAAGGTGGGC; HNF4{alpha}1 f, ACCCAGCCTACACCACC; HNF4{alpha}1 r, CTTCCTTCTTCATGCCAGCCC; HNF6 f, AACTCCCAGCAAGGACTTCC; HNF6 r, TGCCCTGAATTACTTCCATGGC; HEX f, GTGTACGAGCCCACGCCG; HEX r, TCACTGAGCTGCAACATCTTG; Nodal f, GGAGTTTCATCCTACCAACC; Nodal r, CTGCCATGCCACGGTCGC; IHH f, ACGTGCATTGCTCTGTCAAG; IHH r, CTGGAAAGCTCTCAGCCGGAFP; AFP f, GGATAGCTTCCACGTTAGATTCC, AFP r, TGTTGCCTGGAGGTTTCGGGATCC; albumin f, TGAACTGGCTGACTGCTGTG; albumin r, CATCCTTGGCCTCAGCATAG; {alpha}AT-1 f, TGCAATCAGCCTATACCGGGA; {alpha}AT-1 r, TCAACTGCAGCTCACTGTCTG; TTR f, AGTCCTGGATGCTGTCCGAG; TTR r, TTCCTGAGCTGCTAACACGG; GAPDH f, TCCAGTATGACTCCACTCAC, GAPDH r, ACCTTGCCCACAGCCTGG.

AFP Staining and Histological Analysis—EBs were fixed for 2 min at room temperature in 3% phosphate-buffered saline (PBS)-formalde-hyde and permeabilized for 15 min in cold methanol. After three washings in PBS, EBs were incubated for 30 min in blocking solution (PBS containing 10% fetal calf serum and 1% bovine serum albumin). The primary antibody rabbit anti-AFP (ICN) was incubated at 4 °C overnight at a dilution of 1:400 in PBS containing 1% fetal calf serum, 1% bovine serum albumin, and 0.05% Tween 20. After three washings in PBS, EBs were incubated for 1 h at room temperature with the secondary antibody rabbit-fluorescein isothiocyanate (Eurobio) used at a dilution of 1:100. Finally, EBs were washed in PBS, mounted with a fluorescence-protecting medium (Vectashield, Vector Laboratories Inc.), and analyzed by confocal microscopy. Thin sections were performed as described by Barbacci et al. (12).


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
New Components of the Visceral Endoderm Regulatory Network Controlled by vHNF1—Differentiation of ES cells into EBs results in the generation of derivatives of the three embryonic germ layers in a process that is reminiscent of early embryogenesis. Around day 4–5, cells at the periphery of the EBs differentiate into primitive endoderm, which subsequently gives rise to visceral and parietal endoderm by day 7. This is followed by processes recapitulating proamniotic cavity formation and the development of a variety of early embryonic cell lineages. Thus, this system is particularly useful to analyze mechanisms of early lineage determination, including the process of VE formation, as well as to investigate the impact of a targeted deletion of a given gene (36). Using this model, we have shown that vHNF1 is required for the activation of several members of the HNF family including HNF1, HNF3{gamma}, and HNF4{alpha}1 as well as a set of genes encoding serum proteins, controlled either by vHNF1, HNF4{alpha}1, or both (12).

In this study, we have examined additional potential target genes of vHNF1 to obtain a more comprehensive picture of this regulatory network. RNA was isolated from the wild-type (HM1), the vHnf1+/– (clone 143), and the vHnf1–/– mutant (clone 9) ES cells differentiated into EBs at specific stages, corresponding to critical steps of VE formation and maturation. The vHnf1–/– clone 9 was derived from the vHnf1+/– clone 143. The vHnf1+/– clone 143 displayed no phenotypic differences compared with the parental HM1 ES cell line, with respect to VE differentiation (12) (see also Fig. 1).



View larger version (61K):
[in this window]
[in a new window]
  		FIG. 1.
Expression of transcription factors and regulatory molecules in EBs. Semiquantitative RT-PCR analysis of the indicated markers was performed at different stages of differentiation of vHnf1+/+ (HM1), vHnf1+/– (clone 143), and vHnf1–/– (clones 6, 7, and 9) ES cells. RNA levels were normalized by the expression of GAPDH.

 

We focused on the one-cut homeodomain transcription factor HNF6, a member of the HNF family not yet analyzed. HNF6 has recently been reported to participate in the differentiation of various tissues derived from endoderm, including the biliary tract and endocrine cells of the pancreas (37, 38). Interestingly, the expression of Hnf6, which is induced, as Hnf1, only at late stages of differentiation, is strongly decreased in the vHnf1–/– EBs as compared with vHnf1+/– or wild-type EBs. The absence of Hnf6 in adult hepatocytes of Hnf1 homozygous mutant mice (39), coupled with this finding, strongly suggest that either vHNF1 or HNF1 directly controls the expression of Hnf6 through an as yet unidentified binding site. In contrast, the expression level of the homeobox transcription factor Hex, first expressed in VE (40), and a key regulator of liver (41), did not differ between vHnf1–/– and wild-type EBs. The same result was observed for the expression of nodal, a secreted protein present in the embryonic ectoderm and in the VE and involved in the specification of the primitive streak (42, 43).

We subsequently analyzed other regulatory secreted molecules shown to be involved in early functions of VE. We first examined Indian Hedgehog (Ihh), since it is expressed in the VE of gastrulating mouse embryos (44) and has recently been shown to be involved in VE differentiation and in formation of cavities in differentiated ES cells (45). Remarkably, the expression of Ihh, expressed in the VE in ES cell-derived EBs and displaying kinetics strikingly similar to vHnf1 (45) (Fig. 1), was strongly decreased in the vHnf1–/– EBs at all stages of differentiation studied. In contrast, the expression of Sonic Hedgehog (Shh), which is induced at later stages of differentiation, was only partially reduced in vHnf1–/– EBs at day 19 (Fig. 1), whereas Desert Hedgehog (Dhh) was very weakly expressed at all stages of differentiation in both vHnf1–/– and vHnf1+/– EBs (data not shown). In addition, the expression of different components of the Hedgehog signaling pathway, including Patched (Ptc1 and Ptc2), Smoothened (Smo), and Gli (Gli1, Gli2, and Gli3), was not affected in vHnf1-deficient EBs (data not shown). Similarly, we did not observe any variation in the expression levels of bone morphogenetic proteins 2 and 4 (BMP-2 and BMP-4), expressed in the VE and ectoderm, respectively, and implicated in cavity formation in embryonal carcinoma EBs (18). Thus, in this context, the decreased expression of Ihh in our vHnf1–/– EBs could explain, at least in part, the impaired cavity formation.

Finally, as for several other serum proteins such as alphafetoprotein (AFP), albumin, alpha-antitrypsin ({alpha}AT-1), transferrin, and apolipoprotein-B (12), the expression of the transthyretin (Ttr), aldolase B (Aldo B), and pyruvate kinase was absent or severely reduced in vHnf1–/– EBs (Fig. 1; data not shown).

These data highlight new components implicated in the regulatory network governed by vHNF1 that specifies the VE: the transcription factor HNF6 and the regulatory molecule IHH, as well as their targets, which are markers of a functional VE. This information will be useful to study the role of vHNF1 isoforms and HNF1 in the differentiation of this cell lineage as described below.

Context-dependent Transcriptional Regulation by vHNF1-A and vHNF1-B Isoforms—Transient transfection studies using the albumin promoter as well as a chimeric {beta}-fibrinogen promoter have previously shown that vHNF1-A is a more potent activator than vHNF1-B (8). But whether these two isoforms behave differently with respect to other promoters is presently unknown. We therefore reexamined this question in the context of different genes involved in the VE differentiation. We have chosen for this analysis promoters of both early and late markers of this cell lineage, all known targets of vHNF1 and HNF1: the proximal Hnf4{alpha} promoter (28, 31), the Afp promoter (30), and the albumin promoter (32), each of which contains either one or two functional HNF1 binding sites (see "Experimental Procedures"). Human embryonic kidney HEK 293 cells, which do not express HNF1 or vHNF1 proteins, were transiently transfected with increasing amounts of the pCB6 plasmid (25) containing vHNF1-A, vHNF1-B, and HNF1 cDNAs.

In agreement with previous observations (4), HNF1 activated the transcription of the reporter CAT gene at significantly higher levels than the vHNF1 isoforms for the three promoters tested. Indeed, HNF1 activated Hnf4{alpha} and Afp promoters 2-fold higher than vHNF1 isoforms, whereas it activated the albumin promoter 10-fold higher than vHNF1-A (data not shown).

As shown in Fig. 2A, vHNF1-A and vHNF1-B isoforms transactivated the Hnf4{alpha} promoter to similar levels, with a maximal stimulation of 3.9-fold (±0.36). An intermediate situation was observed with the Afp promoter. In this case, at lower concentrations of expression vector, vHNF1-B was a better activator than vHNF1-A (7.5 ± 0.98-fold versus 3.9 ± 0.21-fold), whereas at saturated concentrations both isoforms reached equivalent activation levels (16 ± 2.44-fold) (Fig. 2B). Finally, vHNF1 isoforms showed an opposite behavior on the albumin promoter; vHNF1-A exhibited more than 2-fold higher stimulation than vHNF1-B at saturated concentrations (19 ± 1.70- and 8 ± 1.20-fold, respectively) (Fig. 2C). Furthermore, when both vHNF1-A and vHNF1-B isoforms were co-expressed with the different reporter constructs, CAT activity corresponded to the average of the induction elicited by each isoform alone, indicating that, at least in transient expression conditions, vHNF1 isoforms do not function synergistically (Fig. 2). The same results were obtained when transient transfections were carried out in the human epithelial cell line C33, suggesting that the different activities of vHNF1 isoforms do not depend on a particular cellular environment.



View larger version (14K):
[in this window]
[in a new window]
  		FIG. 2.
Transactivation potential of vHNF1-A and vHNF1-B isoforms. HEK 293 cells were transiently transfected with 2 µg of a reporter CAT construct containing regulatory sequences from the indicated genes and various amounts of the pCB6-vHNF1-A and pCB6-vHNF1-B constructs. The reporter constructs used contained the following: for HNF4{alpha} (A), the mouse proximal promoter (–572/+25); for AFP (B), the mouse promoter (–1023/+33); for albumin (C), the rat promoter (–386/+4). CAT activity was normalized to transfection efficiency by measuring the {beta}-galactosidase activity obtained with a cotransfected RSV-{beta}-galactosidase construct. It is expressed in -fold activation, and the values plotted are the means of at least four independent experiments.

 

We further defined that the differences observed in the transcriptional properties of vHNF1-A and vHNF1-B were not due to similar differences in their binding affinities. Thus, gel shift assays using extracts from mammalian cells overproducing either vHNF1-A or vHNF1-B proteins indicated that both isoforms exhibited equivalent DNA binding affinities for their specific target sites present in either the albumin or the Hnf4{alpha}1 promoter (data not shown).

These results demonstrate that although vHNF1-A and vHNF1-B isoforms display similar DNA binding activities, they show different transactivation properties depending on the promoter involved and presumably sequences flanking the target binding sites.

Distinct and Overlapping Functions of vHNF1 Isoforms in VE Differentiation—The context-dependent transcriptional regulation exhibited by vHNF1-A and vHNF1-B suggests that the induction of particular target genes by these isoforms would ultimately depend upon the entire regulatory region of each gene in the appropriate chromosomal structure. To obtain insight into the role of the vHNF1 isoforms in vivo and to study their involvement in VE differentiation, we analyzed their function in a chromosomal context by stable expression into vHnf1-deficient ES cells.

Constructs containing the human {beta}-actin promoter and a puromycin selection cassette were used to direct the expression of vHNF1-A and vHNF1-B cDNA in the vHnf1–/– ES cells. We generated ES clones expressing either vHNF1-A (A clones) or vHNF1-B (B clones) or co-expressing both isoforms (AB clones). The heterozygous mutant vHnf1+/– clone 143 and the homozygous mutant vHnf1–/– clone 9 were used as positive and negative controls, respectively. Transgene expression was examined by both protein and RNA analysis. We screened our clones based on the expression level of these proteins assayed by gel retardation assay to directly identify clones that express the functional protein at the highest level (Fig. 3A). Unexpectedly, all of our clones expressed vHNF1 proteins at significantly lower levels than those present in vHnf1+/– or wild-type EBs. This was particularly relevant for A clones, since only a few of them from several independent electroporation experiments expressed the vHNF1-A isoform at a significant level. Surprisingly, parallel analysis of mRNA levels by semiquantitative RT-PCR showed that all clones characterized by gel shift assays (Fig. 3A) expressed vHNF1 transcripts at significantly higher levels than either vHnf1–/– or wild-type EBs (data not shown; Fig. 3B). This discrepancy between vHNF1 transcript and protein levels in our clones could be due to the lack of 5' or 3' noncoding regions and/or the absence of introns in the vHNF1 transgenes. Indeed, these sequences have recently been reported to regulate the translational efficiency of the resultant RNA without altering the steady state mRNA levels (for reviews, see Refs. 46 and 47).



View larger version (41K):
[in this window]
[in a new window]
  		FIG. 3.
vHNF1 expression in selected A, B, and AB clones. A, the expression level of vHNF1 proteins was detected by gel retardation assay. The quality of the extracts was evaluated by using a probe containing the binding site of the ubiquitous transcription factor NFY. Each lane contained the same amount of nuclear proteins prepared from the indicated EBs at 19 days of differentiation. The arrow shows the specific vHNF1 complex as evidenced by the supershift caused by the use of a specific vHNF1 antibody. B, levels of vHNF1-A and vHNF1-B transcripts were detected by RT-PCR. RNA levels were normalized by the expression of GAPDH.

 

We subsequently differentiated the selected A, B, and AB clones into EBs together with the vHnf1+/– and vHnf1–/– ES cells. As previously reported (12), the vHnf1-deficient EBs failed to form an external VE layer after 5–7 days of differentiation and at later stages exhibited only few and small abortive cavities instead of cysts (see also Fig. 4, A and B). The EBs derived from A14, B19, and AB37 ES clones developed normally, and thin sections showed an organized outer layer with apical vacuoles and microvilli characteristic of VE cells (Fig. 4, E–G). In contrast to the B19 and AB37 clones, the formation of a characteristic VE epithelium in the A14 clone was restricted to small regions of the EBs, and formation of cavities was rarely observed. Moreover, all transgenic clones displayed fewer cystic structures than the wild-type or heterozygous EBs even at later stages of differentiation, suggesting an incomplete restoration of the wild-type phenotype. Immunohistochemical analysis using the specific VE marker {alpha}-fetoprotein (AFP) confirmed the presence of a mature VE layer. The A14, B19, and AB37 EBs all expressed AFP, which was correctly localized in the surrounding layer of the EBs (Fig. 4, compare D with H–J). In agreement with the thin section analysis, the expression of AFP in the A14 EBs was restricted to a discrete outer region of the EBs rather than a complete VE layer.



View larger version (90K):
[in this window]
[in a new window]
  		FIG. 4.
Morphology and structure of selected A, B, and AB clones. Toluidine blue-stained 1-µm sections (A, B, E, F, and G) and immunostaining of the early VE marker AFP (C, D, H, I, and J) after 20 days differentiation of vHnf1+/– (clone 143), vHnf1–/– (clone 9), and the selected clones A14, B19, and AB 37. Scale bar, 50 µm. The arrows indicate apical vacuoles characteristic of a VE epithelium.

 

We further characterized these clones, examining the expression of a panel of VE markers that were down-regulated in vHnf1-deficient EBs (12) (Fig. 1), using semiquantitative RT-PCR. As shown in Fig. 5A, the expression of the early VE markers Hnf4{alpha}1, Ihh, and Afp was delayed, and after 19 days of differentiation, their levels of expression did not reach that of the vHnf1+/– control. Indeed, the reexpression levels of these markers seemed to be correlated with the amount of vHNF1-A and vHNF1-B protein in the corresponding clone (compare Fig. 3A and 5A). Interestingly, the large differences in the levels of Afp expression between the A14 and B19 clones at 19 days of differentiation indicated that the vHNF1-B isoform appeared to be more efficient than vHNF1-A in inducing this marker (Fig. 5A). This result is in accordance with our transient expression analyses (see Fig. 2B). The expression of the late markers Hnf1, Hnf3{gamma}, Hnf6, albumin, and Ttr was totally restored in all clones after 27 days of differentiation (Fig. 5B). We noticed, however, that the late marker {alpha}At-1 was the only one expressed at a very low level. Since the promoter of this gene contains functional sites for both HNF4{alpha} and HNF1 (48), it is possible that the amount of vHNF1-A, vHNF1-B, and/or HNF4{alpha} proteins in our clones did not reach the required threshold to induce normal levels of this marker. Remarkably, and in close agreement with the results of transient transfection experiments, expression of albumin was only restored by the vHNF1-A isoform (compare Fig. 2C and Fig. 5B).



View larger version (42K):
[in this window]
[in a new window]
  		FIG. 5.
Expression of the entire set of early and late VE markers in selected A, B, and AB clones. The expression of early and late VE markers is partially restored upon stable expression of vHNF1-A, vHNF1-B, and vHNF1-A+ vHNF1-B in vHnf1-deficient EBs. Semiquantitative RT-PCR analysis of the indicated markers was performed at different stages of differentiation of vHnf1+/– (clone 143), vHnf1–/– (clone 9), and the selected clones A, B, and AB. RNA levels were normalized by the expression of GAPDH.

 

These results show that the reexpression of early and late VE markers was globally delayed in our clones that stably express vHNF1-A and/or vHNF1-B isoforms. This can be attributed, at least in part, to the lower levels of the corresponding proteins. It remains possible that a specific ratio of vHNF1-A and vHNF1-B proteins, not reached in the AB clones, is required to correctly induce all of the VE markers. Although each isoform appeared to have by itself the capacity to activate most of the VE markers, our results demonstrate two functional differences. The vHNF1-B isoform seems to be more efficient to activate the expression of Afp, whereas vHNF1-A is clearly a more potent activator of the albumin gene.

Complete Rescue of vHnf1 Deficiency by HNF1 in ES Cell-derived Embryoid Bodies—The potential functional equivalence between vHNF1 and HNF1 was addressed by reexpressing rat HNF1 in our vHnf1–/– ES cells, using the {beta}-actin-puro vector described above. Several ES clones expressed the rat HNF1 cDNA at similarly high levels, and three of them were selected for further analyses (Tg HNF1.2, Tg HNF1.4, and Tg HNF1.5) (see below) (Fig. 7). All clones also produced high levels of HNF1 protein able to bind DNA as confirmed by gel retardation assay (data not shown). These high levels of HNF1 protein contrasted with the weak levels of vHNF1 isoforms observed in all clones isolated under identical conditions.



View larger version (55K):
[in this window]
[in a new window]
  		FIG. 7.
Expression of the entire set of early and late VE markers in vHNF1–/–:Tg HNF1 clones. The expression of early and late VE markers is totally restored upon stable expression of HNF1 in vHnf1-deficient EBs. Semiquantitative RT-PCR analysis of the indicated markers was performed at different stages of differentiation of vHnf1+/– (clone 143), vHnf1–/– (clone 9), and vHNF1:TgHNF1 clones. RNA levels were normalized by the expression of GAPDH.

 

Thin section analysis of vHnf1–/–::Tg HNF1 EBs revealed the presence of a well organized outer layer, composed of epithelial cells containing apical vacuoles and numerous microvilli characteristic of VE, as observed in wild-type EBs (Fig. 6, A and B). Moreover, the underlying ectodermal cells formed a well organized layer of columnar cells surrounding the cavities. At later stages, the vHnf1–/–::Tg HNF1 EBs formed large cysts (data not shown). The presence of a fully differentiated VE in vHnf1–/–::Tg HNF1 EBs was further confirmed by immunohistochemical analysis; AFP is expressed, as expected, in the external VE layer (Fig. 6, C and D).



View larger version (78K):
[in this window]
[in a new window]
  		FIG. 6.
Morphology and structure of vHNF1–/–::TgHNF1 clones. Toluidine blue-stained 1-µm sections (A and B) and immunostaining of the early VE marker AFP (C and D)in vHnf1+/– (clone 143) and vHNF1::TgHNF1.5 clone. Scale bar, 100 µm (A and B) and 200 µm (C and D).

 

RNA analysis indicated that the different early and late VE markers, normally absent in vHnf1–/– EBs (12) (Fig. 1), were also reexpressed in the different transgene HNF1 ES clones upon differentiation (Fig. 7). Thus, the temporal expression profile was fully restored in all of the vHNF1–/–::Tg HNF1 EBs. Furthermore, the expression level of the entire set of genes examined during differentiation was similar to that of wild-type EBs, with the exception of albumin, whose expression was significantly higher in vHnf1–/–::Tg HNF1 EBs than in wild-type EBs. Interestingly, the use of specific mouse and rat primers allowing detection of the expression of the endogenous mouse or the rat HNF1 transgene, respectively, showed that the expression of the mouse endogenous Hnf1 gene is induced by the HNF1 transgene. This suggests a positive regulatory loop that results in HNF1 autoactivation.

These results demonstrate that forced expression of HNF1 in vHnf1–/– ES cells can rescue the vHnf1 deficiency in ES cell-derived EBs by inducing the formation of a morphologically differentiated VE layer.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
vHNF1 and HNF1 display structural similarities and an indistinguishable DNA binding sequence specificity. Despite a highly conserved DNA binding domain, both proteins exhibit weak conservation in the transactivation domain, suggesting that they may have acquired distinct functions during evolution. As a first step to investigate whether the completely different phenotypes observed in mice lacking HNF1 and vHNF1 proteins are due to different spatial and temporal expression patterns or to specific biochemical properties, we have analyzed the functional role of vHNF1 isoforms and of HNF1 during the process of VE formation.

Cooperation of vHNF1 Isoforms in the Establishment of the Mature VE—The two spliced isoforms of vHNF1 are identical in their primary structure except for the presence of a 26-amino acid insertion between the POUs and the POUH domains in vHNF1-A. Interestingly, this alternative exon is absent in HNF1. We show here that the two vHNF1 isoforms do not act synergistically but display distinct activation potential, depending on the context of the promoter. Since this differential target gene activation is not due to differential binding, sequences flanking the target binding site may influence the response to vHNF1 isoforms at a particular promoter. It is possible that this insertion modifies the conformation of the protein, and therefore modulates protein-protein interactions with other DNA-bound transcription factors or components of the basal transcriptional machinery.

The specific action of vHNF1-A and vHNF1-B during VE differentiation was examined by stable expression of each isoform into vHnf1-deficient ES cells, which are deleted for these two spliced transcripts. Our results show a delayed induction of the VE markers in both vHNF1-A and vHNF1-B ES-derived EBs as compared with vHnf1+/– or wild-type EBs. The apparent correlation between protein levels and the fully differentiated phenotype suggests that the lower expression of either vHNF1-A or vHNF1-B or both, rather than different biochemical properties of these isoforms, is responsible for the partial rescue. Despite this, our results clearly demonstrate that each isoform has by itself the capacity to activate most of the VE markers, albeit at different levels. For example, and in close correlation with the transient transfection analysis, B clones expressed Afp at a higher levels than clones A, whereas albumin is exclusively expressed in A clones, despite the fact that only weak levels of vHNF1-A were present.

Alternative splicing appears to be a general mechanism for generating multiple isoforms of transcriptional regulators and potentially modulating the developmental function of a transcription factor in a tissue-specific manner. We show here that, rather than having very distinct properties, vHNF1-A and vHNF1-B isoforms appear to cooperate in the establishment of a mature VE. Thus, the apparent requirement of two alternatively spliced isoforms of vHNF1 and their retention through evolution may be dictated by the fact that, in addition to the shared roles, they complement each other. Given the importance of the VE for normal development, this requirement may reflect the evolution of a mechanism designed to maintain high levels of expression of key regulatory molecules and important serum proteins.

Functional Equivalence of vHNF1 Isoforms and HNF1 in the Differentiation of the VE Lineage—Forced expression of HNF1 protein in the vHnf1–/– ES cells restores the wild-type phenotype, including the formation of an outer layer of fully differentiated VE and the temporal expression profile of the entire set of early and late VE markers.

As reported for other duplicated genes encoding transcription factors (49–51), the vHNF1/HNF1 functions appear to derive from a common ancestor in early vertebrates, preserved throughout evolution, whereas the regulatory elements controlling their transcription and translation have been modified, leading to neofunctionalization. Nevertheless, it is plausible that vHNF1 and HNF1 exhibit functional differences at later stages of development. In fact, patients carrying heterozygous mutations in these genes display different phenotypes. Although both proteins are present in {beta}-cells of the pancreas, heterozygous mutations of the human vHnf1 lead to type 5 maturity onset diabetes of the young, and heterozygous mutations in Hnf1 lead to type 3 (52). This indicates that, unlike results shown here in EBs, neither vHNF1 nor HNF1 can compensate for the loss of the other. The dimeric nature of the HNF1 family proteins further suggests that some functions might exclusively be mediated by heterodimers vHNF1/HNF1, thus increasing diversity in function. The generation of mouse models in which the vHnf1 coding region is replaced by Hnf1 and vice versa may allow us to determine whether these genes act through the same targets or operate either through different or sequential developmental pathways.

Model of the Regulatory Network Involved in the VE Specification—Primitive endoderm is formed as a monolayer of cells on the surface of the inner cell mass, between 3.5 and 4 days of development, whereas the remaining inner cell mass cells become the epiblast. As the blastocyst begins to implant, primitive endoderm differentiates into parietal and visceral endoderm. Previous studies and those presented here suggest that the specification of VE from primitive endoderm involves a complex regulatory network, in which vHNF1 and GATA-6 cooperate for the activation of a cascade of transcription factors and regulatory molecules that ultimately define the expression pattern characteristic of the mature VE (Fig. 8) (12, 24, 53–55). Recent studies have shown that GATA-6 overexpression in ES cells is sufficient to induce a differentiation program toward extraembryonic primitive endoderm (24). Our results clearly show that high levels of HNF1 in ES cells are unable to change their pluripotential fate. However, the low levels of vHNF1 proteins in our ES clones do not formally exclude the possibility that ectopic expression of vHNF1 in ES cells would be able, as GATA-6, to restrict their fate to the primitive endoderm lineage. Further studies, including inducible vHNF1 expression in ES, are required to answer this question.



View larger version (39K):
[in this window]
[in a new window]
  		FIG. 8.
Proposed model for VE differentiation. The diagram illustrates the transcriptional regulation of genes required for early stages of differentiation (vHnf1 and Gata-6) and maturation (Hnf4{alpha}1) of VE. Note that initial induction of HNF4{alpha} appears to be mediated by direct transactivation by vHNF{alpha}1 isoforms and Gata-6 (this study) (53) through a synergistic mechanism (55). Note also that Hnf1 is positively autoregulated (Fig. 7), whereas vHnf1 is negatively autoregulated (C. Haumaitre, M. Reber, and S. Cereghini, unpublished observations). Transcription factors and regulatory molecules are positioned in the diagram in accordance with their chronological induction during VE differentiation. The arrows indicate either direct or indirect transcriptional control (12, 53, 56).

 

As previously reported (12) and as shown here, vHNF1 acts upstream of several transcription factors of the HNF family, including HNF4{alpha}1, HNF1, HNF3{gamma}, and HNF6. In addition, vHNF1 appears to regulate, directly or indirectly, the expression of Ihh, a secreted regulatory signaling molecule of the hedgehog family. Among all of these regulatory factors, gene inactivation and ES differentiation studies have clearly established that Hnf4{alpha}, a vHNF1 target gene, is required, as Gata-6, for the complete maturation of the VE but not for its specification (53, 56). Unexpectedly, vHnf1-deficient EBs lack specifically the expression of HNF4{alpha}1, but not that of HNF4{alpha}7 (12), two isoforms of the Hnf4{alpha} gene that are transcribed from alternative promoters containing both functional HNF1 binding sites (57, 58). Finally, it is also worth noting that, in sharp contrast to the results of forced expression of HNF1, overexpression of HNF4{alpha}1 or IHH in our vHnf1–/– EBs did not rescue (not even partially) the wild-type phenotype.2 These observations reinforce the notion that a complex regulatory network rather than a linear vHNF1 -> HNF4{alpha}1 transcriptional cascade is involved in the differentiation of the VE. Interestingly, a hierarchical network, with cross-regulatory and autoregulatory feedback loops among members of the HNF family, appears to participate also in the differentiation and maintenance of other cell lineages, such as biliary (37) and pancreatic cells (57, 58).

Altogether, our results suggest that vHNF1 proteins and subsequently HNF1 cooperate in the establishment of the mature VE. Once the final transcription factor network is established from several interacting pathways, the expression of the serum proteins characteristic of the mature VE appears to be regulated by a subtle coordination between vHNF1 isoforms, GATA-6, HNF1, and HNF4{alpha}1. This, together with the previous observation of a sequential expression of vHNF1 and HNF1 during development of liver, pancreas, and kidney, further suggest that a similar hierarchical relationship relates vHNF1 and HNF1 also in these tissues.


   FOOTNOTES
 
* This work was supported by Association pour la Recherche contre le Cancer (ARC) Contract 5824 and INSERM. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

{ddagger} These authors contributed equally to this work. Back

§ Recipient of a Ph.D. student fellowship from the Ministère de la Recherche et de la Technologie. Present address: Biologie du Développement, UMR 7622, CNRS, Université Pierre et Marie Curie, 9 Quai St. Bernard, 75005 Paris, France. Back

A fellow from ARC. Present address: Molecular Neurobiology Laboratory, The Salk Institute, La Jolla, CA 92037. Back

|| To whom correspondence should be addressed: Biologie du Développement, UMR 7622, CNRS, Université Pierre et Marie Curie, 9 Quai St Bernard, B{beta}timent C porte 718 case 24, 75252 Paris Cedex, France. Tel.: 33-1-44-27-34-48; Fax: 33-1-44-27-34-45; E-mail: cereghini{at}necker.fr.

1 The abbreviations used are: POUs, POU-specific domain; POUH, POU homeodomain; VE, visceral endoderm; ES, embryonic stem; EB, embryoid bodies; CAT, chloramphenicol acetyltransferase; HEK, human embryonic kidney; RSV, Rous sarcoma virus; GAPDH, glyceralde-hyde phosphate dehydrogenase; PBS, phosphate-buffered saline; RT, reverse transcriptase. Back

2 M. Reber and S. Monso, unpublished results. Back


   ACKNOWLEDGMENTS
 
We are grateful to M. Boyle, M. Weiss, and M. Zakin for advice and critical reading of the manuscript. We thank S. Monso and M. Pacaud for participation at the start of this work and M. Sich and Y. Goureau for advice in toluidine thin sections and confocal microscopy, respectively.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Force, A., Lynch, M., Pickett, F. B., Amores, A., Yan, Y. L., and Postlethwait, J. (1999) Genetics 151, 1531–1545[Abstract/Free Full Text]
  2. Tomei, L., Cortese, R., and De Francesco, R. (1992) EMBO J. 11, 4119–4129[Medline] [Order article via Infotrieve]
  3. Chi, Y., Frantz, J., Hansen, L., Dhe-Paganon, S., and Shoelson, S. (2002) Mol. Cell Biol. 10, 1129–1137
  4. Rey-Campos, J., Chouard, T., Yaniv, M., and Cereghini, S. (1991) EMBO J. 10, 1445–1457[Medline] [Order article via Infotrieve]
  5. De Simone, V., De Magistris, L., Lazzaro, D., Gerstner, J., Monaci, P., Nicosia, A., and Cortese, R. (1991) EMBO J. 10, 1435–1443[Medline] [Order article via Infotrieve]
  6. Bach, I., Mattei, M. G., Cereghini, S., and Yaniv, M. (1991) Nucleic Acids Res. 19, 3553–3559[Abstract/Free Full Text]
  7. Cereghini, S. (1996) FASEB J. 10, 267–282[Abstract]
  8. Ringeisen, F., Rey-Campos, J., and Yaniv, M. (1993) J. Biol. Chem. 268, 25706–25711[Abstract/Free Full Text]
  9. Lazzaro, D., De Simone, V., De Magistris, L., Lehtonen, E., and Cortese, R. (1992) Development 114, 469–479[Abstract]
  10. Ott, M. O., Rey-Campos, J., Cereghini, S., and Yaniv, M. (1991) Mech. Dev. 36, 47–58[CrossRef][Medline] [Order article via Infotrieve]
  11. Cereghini, S., Ott, M. O., Power, S., and Maury, M. (1992) Development 116, 783–797[Abstract]
  12. Barbacci, E., Reber, M., Ott, M., Breillat, C., Huetz, F., and Cereghini, S. (1999) Development 126, 4795–4805[Abstract]
  13. Coffinier, C., Barra, J., Babinet, C., and Yaniv, M. (1999) Mech. Dev. 89, 211–213[CrossRef][Medline] [Order article via Infotrieve]
  14. Nammo, T., Yamagata, K., Hamaoka, R., Zhu, Q., Akiyama, T., Gonzalez, F., Miyagawa, J., and Matsuzawa, Y. (2002) Diabetologia 45, 1142–1153[CrossRef][Medline] [Order article via Infotrieve]
  15. Reber, M., and Cereghini, S. (2001) Mech. Dev. 100, 75–78[CrossRef][Medline] [Order article via Infotrieve]
  16. Coffinier, C., Thepot, D., Babinet, C., Yaniv, M., and Barra, J. (1999) Development 126, 4785–4794[Abstract]
  17. Beddington, R. S., and Robertson, E. J. (1998) Trends Genet. 14, 277–284[CrossRef][Medline] [Order article via Infotrieve]
  18. Coucouvanis, E., and Martin, G. R. (1999) Development 126, 535–546[Abstract]
  19. Belaoussoff, M., Farrington, S. M., and Baron, M. H. (1998) Development 125, 5009–5018[Abstract]
  20. Pontoglio, M., Barra, J., Hadchouel, M., Doyen, A., Kress, C., Bach, J. P., Babinet, C., and Yaniv, M. (1996) Cell 84, 575–585[CrossRef][Medline] [Order article via Infotrieve]
  21. Lee, Y. H., Sauer, B., and Gonzalez, F. J. (1998) Mol. Cell Biol. 18, 3059–3068[Abstract/Free Full Text]
  22. Pontoglio, M., Sreenan, S., Roe, M., Pugh, W., Ostrega, D., Doyen, A., Pick, A. J., Baldwin, A., Velho, G., Froguel, P., Levisetti, M., Bonner-Weir, S., Bell, G. I., Yaniv, M., and Polonsky, K. S. (1998) J. Clin. Invest. 101, 2215–2222[Medline] [Order article via Infotrieve]
  23. Bach, I., and Yaniv, M. (1993) EMBO J. 12, 4229–4242[Medline] [Order article via Infotrieve]
  24. Fujikura, J., Yamato, E., Yonemura, S., Hosoda, K., Masui, S., Nakao, K., Miyazaki Ji, J., and Niwa, H. (2002) Genes Dev. 16, 784–789[Abstract/Free Full Text]
  25. Brewer, C. B. (1994) Methods Cell Biol. 43, 233–244[Medline] [Order article via Infotrieve]
  26. Ott, M. O., Sperling, L., Herbomel, P., Yaniv, M., and Weiss, M. C. (1984) EMBO J. 3, 2505–2510[Medline] [Order article via Infotrieve]
  27. Molne, M., Houart, C., Szpirer, J., and Szpirer, C. (1989) Nucleic Acids Res. 17, 3447–3457[Abstract/Free Full Text]
  28. Taraviras, S., Monaghan, A. P., Schutz, G., and Kelsey, G. (1994) Mech. Dev. 48, 67–79[CrossRef][Medline] [Order article via Infotrieve]
  29. Boshart, M., Kluppel, M., Schmidt, A., Schutz, G., and Luckow, B. (1992) Gene (Amst.) 110, 129–130[CrossRef][Medline] [Order article via Infotrieve]
  30. Feuerman, M., Godbout, R., Ingram, R., and Tilghman, S. (1989) Mol. Cell Biol. 9, 4204–4212[Abstract/Free Full Text]
  31. Zhong, W., Mirkovitch, J., and Darnell, J. E., Jr. (1994) Mol. Cell Biol. 14, 7276–7284[Abstract/Free Full Text]
  32. Cereghini, S., Blumenfeld, M., and Yaniv, M. (1988) Genes Dev. 2, 957–974[Abstract/Free Full Text]
  33. Cheng, A. M., Saxton, T. M., Sakai, R., Kulkarni, S., Mbamalu, G., Vogel, W., Tortorice, C. G., Cardiff, R. D., Cross, J. C., Muller, W. J., and Pawson, T. (1998) Cell 95, 793–803[CrossRef][Medline] [Order article via Infotrieve]
  34. Power, S. C., and Cereghini, S. (1996) Mol. Cell Biol. 16, 778–791[Abstract]
  35. Seed, B., and Sheen, J. (1988) Gene (Amst.) 67, 271–277[CrossRef][Medline] [Order article via Infotrieve]
  36. Rodda, S., Kavanagh, S., Rathjen, J., and Rathjen, P. (2002) Int. J. Dev. Biol. 46, 449–458[Medline] [Order article via Infotrieve]
  37. Clotman, F., Lannoy, V. J., Reber, M., Cereghini, S., Cassiman, D., Jacquemin, P., Roskams, T., Rousseau, G., and Lemaigre, F. (2002) Development 129, 1819–1828[Medline] [Order article via Infotrieve]
  38. Jacquemin, P., Durviaux, S. M., Jensen, J., Godfraind, C., Gradwohl, G., Guillemot, F., Madsen, O. D., Carmeliet, P., Dewerchin, M., Collen, D., Rousseau, G. G., and Lemaigre, F. P. (2000) Mol. Cell Biol. 20, 4445–4454[Abstract/Free Full Text]
  39. Shih, D. Q., Screenan, S., Munoz, K. N., Philipson, L., Pontoglio, M., Yaniv, M., Polonsky, K. S., and Stoffel, M. (2001) Diabetes 50, 2472–2480[Abstract/Free Full Text]
  40. Thomas, P. Q., Brown, A., and Beddington, R. S. (1998) Development 125, 85–94[Abstract]
  41. Martinez Barbera, J. P., Clements, M., Thomas, P., Rodriguez, T., Meloy, D., Kioussis, D., and Beddington, R. S. (2000) Development 127, 2433–2445[Abstract]
  42. Zhou, X., Sasaki, H., Lowe, L., Hogan, B. L., and Kuehn, M. R. (1993) Nature 361, 543–547[CrossRef][Medline] [Order article via Infotrieve]
  43. Conlon, F. L., Lyons, K. M., Takaesu, N., Barth, K. S., Kispert, A., Herrmann, B., and Robertson, E. J. (1994) Development 120, 1919–1928[Abstract]
  44. Farrington, S. M., Belaoussoff, M., and Baron, M. H. (1997) Mech. Dev. 62, 197–211[CrossRef][Medline] [Order article via Infotrieve]
  45. Maye, P., Becker, S., Kasameyer, E., Byrd, N., and Grabel, L. (2000) Mech. Dev. 94, 117–132[CrossRef][Medline] [Order article via Infotrieve]
  46. Le Hir, H., Nott, A., and Moore, M. J. (2003) Trends Biochem. Sci. 28, 215–220[CrossRef][Medline] [Order article via Infotrieve]
  47. Wilkie, G. S., Dickson, K. S., and Gray, N. K. (2003) Trends Biochem. Sci. 28, 182–188[CrossRef][Medline] [Order article via Infotrieve]
  48. De Simone, V., and Cortese, R. (1989) Nucleic Acids Res. 17, 9407–9415[Abstract/Free Full Text]
  49. Acampora, D., Postiglione, M. P., Avantaggiato, V., Di Bonito, M., and Simeone, A. (2000) Int. J. Dev. Biol. 44, 669–677[Medline] [Order article via Infotrieve]
  50. Hanks, M., Wurst, W., Anson-Cartwright, L., and Auerbach, A. B. (1995) Science 269, 679–682[Abstract/Free Full Text]
  51. Bouchard, M., Pfeffer, P., and Busslinger, M. (2000) Development 127, 3703–3713[Abstract]
  52. Ryffel, G. U. (2001) J. Mol. Endocrinol. 27, 11–29[Abstract]
  53. Morrisey, E. E., Tang, Z., Sigrist, K., Lu, M. M., Jiang, F., Ip, H. S., and Parmacek, M. S. (1998) Genes Dev. 12, 3579–3590[Abstract/Free Full Text]
  54. Koutsourakis, M., Langeveld, A., Patient, R., Beddington, R., and Grosveld, F. (1999) Development 126, 723–732[Abstract]
  55. Hatzis, P., and Talianidis, I. (2001) Mol. Cell Biol. 21, 7320–7330[Abstract/Free Full Text]
  56. Duncan, S. A., Nagy, A., and Chan, W. (1997) Development 124, 279–287[Abstract]
  57. Thomas, H., Jaschkowitz, K., Bulman, M., Frayling, T. M., Mitchell, S. M., Roosen, S., Lingott-Frieg, A., Tack, C. J., Ellard, S., Ryffel, G. U., and Hattersley, A. T. (2001) Hum. Mol. Genet 10, 2089–2097[Abstract/Free Full Text]
  58. Boj, S. F., Parrizas, M., Maestro, M. A., and Ferrer, J. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 14481–14486[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Mol. Cell. Biol.Home page
J.-M. Servitja, M. Pignatelli, M. A. Maestro, C. Cardalda, S. F. Boj, J. Lozano, E. Blanco, A. Lafuente, M. I. McCarthy, L. Sumoy, et al.
Hnf1{alpha} (MODY3) Controls Tissue-Specific Transcriptional Programs and Exerts Opposed Effects on Cell Growth in Pancreatic Islets and Liver
Mol. Cell. Biol., June 1, 2009; 29(11): 2945 - 2959.
[Abstract] [Full Text] [PDF]

Home page
 Genes Dev.Home page
I. Kyrmizi, P. Hatzis, N. Katrakili, F. Tronche, F. J. Gonzalez, and I. Talianidis
Plasticity and expanding complexity of the hepatic transcription factor network during liver development.
Genes & Dev., August 15, 2006; 20(16): 2293 - 2305.
[Abstract] [Full Text] [PDF]

Home page
 DevelopmentHome page
A. Jouneau, Q. Zhou, A. Camus, V. Brochard, L. Maulny, J. Collignon, and J.-P. Renard
Developmental abnormalities of NT mouse embryos appear early after implantation.
Development, April 1, 2006; 133(8): 1597 - 1607.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
C. Haumaitre, E. Barbacci, M. Jenny, M. O. Ott, G. Gradwohl, and S. Cereghini
Lack of TCF2/vHNF1 in mice leads to pancreas agenesis
PNAS, February 1, 2005; 102(5): 1490 - 1495.
[Abstract] [Full Text] [PDF]

Home page
 Hum Mol GenetHome page
E. Barbacci, A. Chalkiadaki, C. Masdeu, C. Haumaitre, L. Lokmane, C. Loirat, S. Cloarec, I. Talianidis, C. Bellanne-Chantelot, and S. Cereghini
HNF1{beta}/TCF2 mutations impair transactivation potential through altered co-regulator recruitment
Hum. Mol. Genet., December 15, 2004; 13(24): 3139 - 3149.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
L. Wang, C. Coffinier, M. K. Thomas, L. Gresh, G. Eddu, T. Manor, L. L. Levitsky, M. Yaniv, and D. B. Rhoads
Selective Deletion of the Hnf1{beta} (MODY5) Gene in {beta}-Cells Leads to Altered Gene Expression and Defective Insulin Release
Endocrinology, August 1, 2004; 145(8): 3941 - 3949.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/42/40933    most recent
M304372200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Haumaitre, C.
Right arrow Articles by Cereghini, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Haumaitre, C.
Right arrow Articles by Cereghini, S.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement