Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M306028200 on August 11, 2003

J. Biol. Chem., Vol. 278, Issue 43, 42161-42169, October 24, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/43/42161    most recent
M306028200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jung, K.-M.
Right arrow Articles by Kim, T.-W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jung, K.-M.
Right arrow Articles by Kim, T.-W.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Regulated Intramembrane Proteolysis of the p75 Neurotrophin Receptor Modulates Its Association with the TrkA Receptor*

Kwang-Mook Jung{ddagger}, Serena Tan{ddagger}, Natalie Landman{ddagger}, Kseniya Petrova{ddagger}, Simon Murray§, Renee Lewis{ddagger}, Peter K. Kim{ddagger}, Dae Sup Kim¶, Sung Ho Ryu¶, Moses V. Chao§, and Tae-Wan Kim, Ellison Medical Foundation New Scholar in Aging.{ddagger}||

From the {ddagger}Department of Pathology, Taub Institute for Research on Alzheimer's Disease and the Aging Brain, Center for Neurobiology and Behavior, Columbia University College of Physicians and Surgeons, New York, New York 10032, the §Molecular Neurobiology Program, Skirball Institute, New York University Medical Center, New York, New York 10016, and the Division of Molecular and Life Sciences, Pohang University of Science and Technology, Pohang 790-784, South Korea

Received for publication, June 9, 2003 , and in revised form, July 29, 2003.


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS AND DISCUSSION
 REFERENCES
 
The generation of biologically active proteins by regulated intramembrane proteolysis is a highly conserved mechanism in cell signaling. Presenilin-dependent {gamma}-secretase activity is responsible for the intramembrane proteolysis of selected type I membrane proteins, including {beta}-amyloid precursor protein (APP) and Notch. A small fraction of intracellular domains derived from both APP and Notch translocates to and appears to function in the nucleus, suggesting a generic role for {gamma}-secretase cleavage in nuclear signaling. Here we show that the p75 neurotrophin receptor (p75NTR) undergoes presenilin-dependent intramembrane proteolysis to yield the soluble p75-intracellular domain. The p75NTR is a multifunctional type I membrane protein that promotes neurotrophin-induced neuronal survival and differentiation by forming a heteromeric co-receptor complex with the Trk receptors. Mass spectrometric analysis revealed that {gamma}-secretase-mediated cleavage of p75NTR occurs at a position located in the middle of the transmembrane (TM) domain, which is reminiscent of the amyloid {beta}-peptide 40 (A{beta}40) cleavage of APP and is topologically distinct from the major TM cleavage site of Notch 1. Size exclusion chromatography and co-immunoprecipitation analyses revealed that TrkA forms a molecular complex together with either full-length p75 or membrane-tethered C-terminal fragments. The p75-ICD was not recruited into the TrkA-containing high molecular weight complex, indicating that {gamma}-secretase-mediated removal of the p75 TM domain may perturb the interaction with TrkA. Independent of the possible nuclear function, our studies suggest that {gamma}-secretase-mediated p75NTR proteolysis plays a role in the formation/disassembly of the p75-TrkA receptor complex by regulating the availability of the p75 TM domain that is required for this interaction.


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS AND DISCUSSION
 REFERENCES
 
The p75 neurotrophin receptor (p75NTR)1 is a multifunctional type I membrane protein that promotes neurotrophin-induced neuronal survival and differentiation by regulating the specificity and affinity of the Trk receptors (for review, see Refs. 1-4). Recent studies demonstrate that the p75NTR participates in more diverse biological events including cell death, migration, and axonal elongation. Given a widely postulated role in neuronal cell survival, the p75NTR is also thought to be associated with many neurodegenerative diseases, including Alzheimer's disease (reviewed in Ref. 5). For instance, the p75NTR is a marker for basal forebrain cholinergic neurons that undergo selective and severe degeneration in Alzheimer's disease (6, 7). The precise mechanism as to how the p75NTR transmits diversified signaling in the normal or diseased nervous system, remains elusive.

{gamma}-Secretase is an unusual aspartyl protease that cleaves a growing number of substrates (8-12), including APP, Notch, and ErbB4, within the predicted transmembrane domain (reviewed in Refs. 13-17). Limited homology among the putative cleavage sites of known {gamma}-secretase substrates indicates that the intramembrane cleaving {gamma}-secretase activity is not dependent on a specific amino acid target sequence immediately adjacent to the cleavage site. The presenilins 1 (PS1) or PS2 are required for its activity (18) and appear to be essential catalytic components in the heteromultimeric {gamma}-secretase complex (19-21). {gamma}-Secretase-mediated intramembrane proteolysis recently emerged as a highly conserved mechanism in receptor signaling (13, 14). A small fraction of intracellular domains (ICD) derived from APP, Notch, and ErbB4 translocates and appears to function in the nucleus, suggesting a generic role for {gamma}-secretase cleavage in nuclear signaling (9, 10, 22-25). However, it is unclear whether {gamma}-secretase cleavage plays a role in non-nuclear functions. Although {gamma}-secretase is incapable of processing the full-length form of its substrates, it efficiently cleaves membrane-anchored truncated C-terminal derivatives produced by ectodomain shedding (26).

Early reports showed that the truncated p75 extracellular domain that contains the NGF-binding region is released into the culture medium and biological fluids, indicating that the p75NTR undergoes ectodomain shedding (27-31). We predicted that there may be cell-associated C-terminal proteolytic fragments resulting from ectodomain shedding of the full-length p75 receptor in addition to the corresponding extracellular domain that is released from the cell. Because extracellular cleavage of type I membrane proteins is a pre-requisite for their subsequent {gamma}-secretase-mediated cleavage (26), we set out to examine whether the p75NTR could be subjected to {gamma}-secretase-mediated proteolysis. Here we report that p75NTR is a novel substrate of the presenilin-dependent {gamma}-secretase and that intramembrane proteolysis of the p75NTR may play a role in the formation or disassembly of the neurotrophin receptor complex containing the p75NTR and Trk receptors.


    EXPERIMENTAL PROCEDURES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS AND DISCUSSION
 REFERENCES
 
Plasmids—To generate constructs encoding C-terminal V5/His-tagged p75NTR and Trk receptors, coding sequences from the pCMV constructs (32) coding for the full-length human p75NTR, rat TrkA, rat TrkB, or rat TrkC were amplified by PCR using High Fidelity PCR Master (Roche Applied Science) and subcloned into pEF-V5/His vector using TOPO cloning kit (Invitrogen). To generate constructs encoding truncated p75 lacking the entire ectodomain (p75-{Delta}E14), the following primers were used: a 5' primer consisting of the KpnI restriction site fused to Kozak and start codons followed by the preprotrypsin signal peptide, HA recognition sequence, and the 5' region of p75 consisting of the first extracellular amino acid only (5'-taaggggtaccccaccatgtctgcacttctgatcctagctcttgttggagctgcagttgcttatccatatgatgttccagattatgctaacctcattcctgtctattgc-3'). The 3' primer consisted of the 3' region of p75 inclusive of the endogenous stop codon followed by an EcoRI site (5'-atacggaattcctcacactggggatgtggcagtgg-3'). The expression construct encoding full-length rat p75 with the N-terminal signal peptide followed by the Streptag II and HA epitope tag (St75) was generated by PCR amplification using N-terminal signal peptide and HA-tagged full-length rat p75 as template. The primers used were 5'-St75 (gctactgcagttgctTGGAGCCACCCGCAGTTCGAAAAAggcgcctatccatatgatgttccagattatgctaaggagac) and 3'-St75 (gtcctggcaggagaacacgagtcccgagcc). Capital letters denote the incorporated Strep-tag II (St2) sequence (NH2-WSHPQFEKCOOH). PCR products were digested with PstI and subcloned into PstI-digested N-terminal signal peptide and the HA-tagged full-length rat p75 construct. All constructs were fully verified by DNA sequencing.

Cell Culture—HEK293 and SN56 cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum and penicillin/streptomycin/glutamine (Invitrogen). For stable or transient transfection, Superfect (Qiagen) transfection reagents were used according to the manufacturer's protocol. Stable cell lines were generated by transfecting 293 cells with the indicated plasmids (e.g. St75 or p75V5) and screening individual Zeocin-resistant colonies by Western blot using anti-HA. The p75/TrkA double stable line (St75A1) was generated by co-transfecting 293 cells with Strep75-pcDNA3.1-Zeo(+) and TrkA-pEF6 that has a V5-His tag at the C-terminal of TrkA. Individual Zeocin and blasticidin-resistant colonies were screened by Western blot using anti-HA and anti-V5. Compound E was synthesized and provided by T. Golde, A. Fauq, and C. Ziani-Cherif.

Western Blot Analysis—Cells were lysed using buffer IP (10 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1% Triton X-100, 0.25% Nonidet P-40, 2 mM EDTA) supplemented with the protease inhibitor mixture tablet (Roche Applied Science). Protein quantification, SDS-PAGE (4-20 or 8%), and Western blot analyses were carried out as described previously (10). Primary antibodies were used at the following dilutions: polyclonal anti-p75-ICD (Promega) 1:1000; monoclonal anti-V5 (Invitrogen) 1:5000; and monoclonal HA.11 (Covance) 1:2000.

Affinity Isolation of Secreted p75 Ectodomain—Media from cultured p75 stable cells (St75 or St75A1) were subjected to affinity isolation using Strep-Tactin-Sepharose (IBA, Germany) as recommended by manufacturer. Briefly, the samples were incubated with Strep-Tactin-Sepharose for 2 h at 4 °C, and washed four times with Wash buffer. Affinity binding proteins were eluted with elution buffer. Eluents were concentrated using Speed-vac, resuspended in sample buffer, and subjected to SDS-PAGE and Western blotting.

Purification of p75-ICD and Mass Spectrometry—Active membrane preparation and cell-free generation of the p75-ICD were performed as described (10). Membrane fractions from 60 150-mm dishes of 293 cells stably transfected with p75-pEF6/V5-His were incubated 4 h at 37 °C. After incubation, the soluble p75-ICD was separated by centrifugation of the reaction mixtures at 200,000 x g for 30 min. The supernatants were loaded onto a Q Fast Flow Hitrap column (Amersham Biosciences) pre-equilibrated with 50 mM Tris-HCl, pH 8.0, at a flow rate of 1 ml/min. Bound proteins were eluted with a 20-ml linear gradient of 0.0 to 1.0 M NaCl and column fractions were analyzed by Western blotting using an anti-V5 antibody. Fractions containing p75-ICD were pooled and further purified by using Talon metal affinity beads according to the manufacturer's protocol (Clontech). After analyzing the affinity purified proteins by Western blot analysis and silver staining using SilverQuest stain kit (Invitrogen), eluents were concentrated and separated on 8-12% gradient SDS-PAGE gels. The protein band corresponding to p75-ICD was subjected to in-gel digestion by trypsin and analyzed by MALDI-TOF mass spectrometry as described (33). The list of peptide masses obtained by MALDI-TOF MS was compared with theoretical masses of trypsin-digested p75 fragments.

Immunocytochemistry—Cells were fixed for 20 min at room temperature with 4% paraformaldehyde in PBS, washed 3 times with PBS, and blocked for 4 h at room temperature with 10% normal goat serum (Zymed Laboratories Inc.) in PBS. Cells were subsequently incubated overnight at 4 °C with primary antibodies under the following conditions: polyclonal anti-p75-ICD (Promega, 1:300) in 10% normal goat serum, 0.2% Triton X-100 in PBS; monoclonal anti-V5 antibody (Invitrogen, 1:500) in 4% normal goat serum, 0.2% Tween 20 in PBS. Alexa 568-labeled anti-mouse or Alexa 488-labeled anti-rabbit secondary antibodies (Molecular Probes, 1:1000) were used for detection. Samples were mounted and fluorescence images were captured using an Olympus IX71 inverted fluorescence microscope equipped with Spot-RTTM cooled digital camera (Diagnostic Instruments).

Immunoprecipitation—After 48 h of transfection, cells were lysed with IP buffer (10 mM Tris-HCl, pH 7.0, 150 mM NaCl, and 1% Triton X-100 or Nonidet P-40) supplemented with protease inhibitor mixture. The lysates were centrifuged at 14,000 x g for 10 min and the supernatants were pre-cleared with 50 µl of protein G-Sepharose (Amersham Biosciences) overnight at 4 °C. The pre-cleared supernatants were immunoprecipitated with anti-V5 (1:300, Invitrogen, Carlsbad, CA) and 30 µl of protein G-Sepharose overnight at 4 °C. The immunoprecipitates were washed four times with IP buffer, eluted with SDS sample buffer, and analyzed by Western blotting.

Size Exclusion Chromatography—St75A1 cells were harvested with IP buffer (10 mM Tris-HCl, pH 7.0, 150 mM NaCl, and 1% Nonidet P-40) supplemented with a protease inhibitor mixture (Roche). The lysates were centrifuged at 14,000 x g for 10 min and the supernatants were filtered and fractionated using a Superose 6 gel filtration FPLC column (Amersham Biosciences) that was pre-equilibrated with Nonidet P-40 lysis buffer. Fractions (0.4 ml) were collected and analyzed by Western blotting. The standard protein markers were as follows: blue dextran (2000 kDa), thyroglobulin (669 kDa), ferritin (440 kDa), catalase (232 kDa), and bovine serum albumin (66 kDa).


    RESULTS AND DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS AND DISCUSSION
 REFERENCES
 
Ectodomain shedding of many cell surface receptors has been shown to be promoted by treatment with phorbol esters, such as 12-O-tetradecanoylphorbol-13-acetate (TPA) (34). We first examined whether TPA-induced ectodomain shedding of the full-length p75NTR produces truncated C-terminal fragments that may serve as putative substrate fragments of {gamma}-secretase. Treatment of the p75NTR-transfected 293 cells with TPA resulted in ~30-kDa transgene-derived p75NTR C-terminal fragments (Fig. 1A). However, NGF treatment did not cause any detectable accumulation of these fragments. Cell fractionation studies corroborated that these fragments are tightly associated with the membrane (data not shown). To detect the soluble p75 extracellular domain, 293 cells were stably transfected with expression constructs encoding the p75NTR with an N-terminal affinity tag. Constitutively released p75 ectodomain was detectable in the control medium and greatly increased by TPA treatment (Fig. 1B). Release of the soluble p75 ectodomain was blocked efficiently by TAPI-2, a general metalloprotease inhibitor, indicating that a metalloprotease, such as tumor necrosis factor-{alpha} converting enzyme, is responsible for p75 ectodomain shedding. Antibody raised against the p75-ICD failed to detect these fragments in the medium (data not shown).



View larger version (25K):
[in this window]
[in a new window]
 
FIG. 1.
Ectodomain shedding of the p75NTR in 293 cells. A, TPA-induced ectodomain shedding of the p75NTR yields cell-associated truncated C-terminal fragments (~30 kDa). Stable 293 cells expressing p75NTR (C-terminal V5 tag) were treated with TPA or NGF for 2 h, lysed, and analyzed by Western blotting using anti-V5 antibody (4-20% Tris glycine SDS-PAGE). B, detection of the secreted p75 extracellular domain (~60 kDa). Stable 293 transfectants expressing p75NTR containing the N-terminal Strep-tag II (ST2) and HA tags were treated with TPA or NGF for 2 h in the presence or absence of a metalloprotease inhibitor, TAPI-2. The p75 extracellular domain secreted into the medium (p75-Ex) was isolated by affinity capture using ST2-specific affinity beads and detected by Western blotting using anti-HA antibody.

 

We next tested whether the C-terminal fragments derived from ectodomain shedding are subject to {gamma}-secretase cleavage. It has been shown that synthetic {gamma}-secretase inhibitors enhance accumulation of substrate fragments by inhibiting {gamma}-secretase-mediated turnover (9, 10, 18). Treatment with a {gamma}-secretase inhibitor, compound E (35), further increased the accumulation of the p75 C-terminal fragments that were induced by TPA (Fig. 2A). The levels of full-length p75NTR were not affected by the {gamma}-secretase inhibitor treatment. Overnight treatment of compound E caused a similar accumulation of p75 C-terminal fragments even in the absence of TPA stimulation, suggesting that both ectodomain shedding and subsequent {gamma}-secretase cleavage occur in the cells constitutively (Fig. 2B). Another unrelated {gamma}-secretase inhibitor, L-685,458 (36), gave rise to similar effects (data not shown). However, {gamma}-secretase inhibitor treatment did not confer any detectable effects on C-terminal fragment accumulation in cells transfected with constructs encoding TrkA, TrkB, or TrkC (Fig. 2B).



View larger version (50K):
[in this window]
[in a new window]
 
FIG. 2.
Ectodomain shedding-derived p75 C-terminal fragments are subjected to {gamma}-secretase cleavage yielding unstable p75 intracellular domains (p75-ICD). A, TPA-induced accumulation of the cell-associated p75 C-terminal fragments is potentiated by treatment with a {gamma}-secretase inhibitor, compound E (Cpd.E). 293 cells were transfected with constructs encoding the C-terminal V5/His-tagged forms of p75NTR. 24 h after transfection, cells were incubated with TPA, compound E, or both for 30 min. Detergent lysates were analyzed by Western blotting using anti-V5 antibodies. B, treatment with compound E causes the steady-state accumulation of a truncated C-terminal fragment derived from the p75NTR but not from the Trk family neurotrophin receptors. 293 cells were transfected with the indicated constructs encoding the C-terminal V5/His-tagged forms of p75NTR, TrkA, TrkB, and TrkC and analyzed by V5 Western blotting. C, p75-ICD is stabilized and detected in the presence of a proteasome blocker MG132. Stable 293 cells described in A were incubated with 10 µM MG132 for 8 h in the presence or absence of compound E. Note that the putative p75-ICD band was not detected in the samples from compound E-treated cells. The blot was overexposed to visualize p75-ICD in lane 1. D, effects of various proteasome and calpain inhibitors on the accumulation of p75-ICD. Stable 293 transfectants described in B were treated with the indicated proteasome inhibitors (MG132, lactacystin, ALLN, Clasto-lactacystin {beta}-lactone, proteasome inhibitor I, and epoxomicin) or calpain inhibitors (PDI 150606, calpastatin peptide, and calpeptin), and analyzed by Western blotting using anti-p75ICD antibody. All inhibitors were treated at concentrations of 10 µM for 8 h. E, {gamma}-secretase-dependent formation of p75-ICD from p75-{Delta}E14 constructs. 293 cells transfected with p75-{Delta}E14 constructs were incubated in the presence of MG132 (10 µM) in the presence or absence of compound E (200 nM) for 8 h. Blots were probed with anti-p75ICD antibodies. F, detection of the endogenous p75-ICD in SN56 cells (cholinergic septal neuronal cell line). SN56 cells were incubated for 8 h with MG132 or MG132 plus TPA (100 ng/ml) in conjunction with varying concentrations (0, 25, 50, and 100 nM, respectively) of compound E. The lysates were analyzed by Western blotting using anti-p75-ICD.

 

Although {gamma}-secretase inhibition led to the accumulation of putative substrate fragments of p75, the predicted intracellular domain derived from p75NTR (p75-ICD) was not readily detectable by Western blot analysis, suggesting that the p75-ICD is unstable in the intact cells. We therefore attempted to detect the p75-ICD by inhibiting a proteasomal pathway that has been shown to mediate degradation of Notch intracellular domain (22, 37). Treatment of p75-transfected 293 cells with MG132 caused the accumulation of ~25-kDa fragments (Fig. 2C). MG132-induced accumulation of 25-kDa p75 fragments could be efficiently inhibited by treatment with compound E, indicating that this fragment represents the p75-ICD. Additional proteasome inhibitors, including lactacystin, clasto-lactacystin {beta}-lactone, proteasome inhibitor I, and epoxomicin, all caused the accumulation of the p75-ICD, whereas calpain inhibitors did not exhibit any detectable effects on p75-ICD accumulation (Fig. 2D). The effects of lactacystin, clasto-lactacystin {beta}-lactone, and epoxomicin on the p75-ICD accumulation were saturated at 1 µM concentration (data not shown). These data indicate that {gamma}-secretase-generated p75-ICD is rapidly removed via proteasomal degradation.

To demonstrate a direct {gamma}-secretase-dependent generation of p75-ICD from p75 C-terminal fragments (versus full-length), we expressed a p75-{Delta}E14 construct, which encodes a truncated p75 protein that lacks the entire ectodomain but contains the entire cytoplasmic and transmembrane domains of the p75NTR immediately following the signal sequence (Fig. 2E). Thus, the p75-{Delta}E14 proteins are predicted to undergo constitutive cleavage by {gamma}-secretase in the absence of ectodomain shedding, similar to the previously reported constitutive Notch {Delta}E constructs (22). The p75-ICD was detectable in 293 cells transfected with p75-{Delta}E14 constructs under the condition described in Fig. 1E, indicating that the p75-ICD is constitutively generated directly from the truncated p75-{Delta}E14 proteins.

To demonstrate {gamma}-secretase-mediated cleavage of endogenous p75NTR, we utilized cholinergic SN56 cells (38). As shown in Fig. 2C, the endogenous p75-ICD was stabilized and detected in the presence of MG132 (Fig. 2F). TPA treatment caused the added accumulation of membrane-associated p75 C-terminal fragments and subsequent generation of p75-ICD in SN56 cells (Fig. 2F). Our data show that the p75-ICD is produced endogenously in intact SN56 cells.

We next studied whether functional presenilins are required for {gamma}-secretase cleavage of the p75NTR. For this purpose, we first examined the accumulation of the p75 C-terminal fragments in the stable 293 cells expressing the dominant-negative forms of PS1 and PS2 (10). The dominant-negative mutations in conserved aspartate residues (e.g. PS1-D385 and PS2-D366) abolish the biological activities of PS1 and PS2, including {gamma}-secretase cleavage (39, 40). In cells expressing dominant-negative presenilins, the accumulation of the p75 C-terminal fragments was dramatically elevated as compared with cell lines expressing comparable levels of wild-type forms of PS1 and PS2 (Fig. 3A, lane 4). TPA treatment further increased the accumulation of p75 C-terminal fragments in dominant-negative presenilin cells, indicating that {gamma}-secretase-mediated turnover of the p75 C-terminal fragments requires functional presenilins (Fig. 3A, lane 3). Similar increases in the levels of the p75 C-terminal fragments were also observed in fibroblasts lacking both PS1 and PS2 (data not shown). To directly demonstrate presenilin-dependent generation of p75-ICD, we assayed the generation of p75-ICD from membrane fractions prepared from 293 cells expressing either wild-type or dominant-negative presenilins by incubating at 37 °C in the presence or absence of compound E. The generation of p75-ICD was impaired in the membrane fractions from dominant-negative presenilin cells and by the wild-type cell membrane fractions treated with compound E in Fig. 3B. Our data indicate that presenilin-dependent {gamma}-secretase cleavage is responsible for the generation of p75-ICD and inhibition of this cleavage leads to enhanced accumulation of membrane-associated p75 C-terminal substrate fragments.



View larger version (37K):
[in this window]
[in a new window]
 
FIG. 3.
{gamma}-Secretase cleavage of the p75NTR requires functional presenilins. A, effects of TPA-induced p75 shedding on the C-terminal fragment accumulation in dominant-negative (DN) presenilin-expressing cells. Stable 293 cells co-expressing wild-type (WT) PS1 and PS2 or dominant-negative PS1 and PS2 (DN; D385A-PS1 and D366A-PS2) were transfected with the p75 constructs (with C-terminal V5 tag) and treated with TPA for 8 h. The steady-state accumulation of p75 C-terminal fragments were determined by Western blotting using anti-V5 antibodies. B, inhibition of the {gamma}-secretase cleavage of p75NTR in 293 cells stably expressing dominant-negative forms of the presenilins. Membrane fractions prepared from 293 cells expressing either wild-type or dominant-negative presenilins were incubated for 1 h at 37 °C in the presence or absence of compound E (Cpd.E). Samples were than analyzed by Western blotting using anti-p75-ICD antibody.

 

Because the p75-ICD is unstable in intact cells (Fig. 2), to isolate sufficient amounts of the p75-ICD for determining the major {gamma}-secretase cleavage site, we utilized a cell-free {gamma}-secretase assay system (10) using membrane fractions prepared from stable 293 transfectants overexpressing the p75NTR with C-terminal V5 and His6 (V5/His) affinity tags. Membrane fractions were prepared on a large scale and subjected to in vitro {gamma}-secretase cleavage (Fig. 4A). The p75-ICD fragments containing V5/His tags were subsequently generated in a {gamma}-secretase inhibitor-sensitive manner and a portion of the p75-ICD was recovered in the soluble fraction (Fig. 4B). The ICDs generated from cells and in vitro co-migrated on SDS-PAGE, indicating that the p75-ICD in the soluble fraction is likely to have an identical N-terminal end to the p75-ICD generated in intact cells (Fig. 4C).



View larger version (30K):
[in this window]
[in a new window]
 
FIG. 4.
The major {gamma}-secretase cleavage of the p75NTR occurs at a site located in the middle of the transmembrane domain, resembling cleavage of the A{beta} peptide ending at residue 40. A and B, cell-free generation of the p75-ICD. Membrane fractions were prepared from 293 transfectants expressing constructs encoding the full-length p75NTR with C-terminal V5/His tag. After incubating the membrane fractions at 37 °C for 1 or 2 h, the pellet (A) and supernatants (B) were analyzed by Western blotting using an anti-V5 antibody. The starting material (lysate) is shown in the right lane (A). The supernatants were further subjected to ion exchange and metal-affinity (Talon) chromatographic separations. Fractions positive for the p75NTR were pooled and subjected to further analyses. C, co-migration of the ICDs generated in intact cells and in vitro. The lysates of the 293 cells incubated with lactacystin and/or compound E (Cpd.E) were run in parallel with the soluble and membrane fractions containing the p75-ICD using a 4-20% gradient SDS-PAGE. D, silver staining and anti-V5 Western blots of the partially purified p75-ICD-V5/His. The 25-kDa p75-ICD-V5/His band (designated by arrow) was excised from the silver-stained gel and subjected to in-gel digestion followed by mass spectrometry analysis. E, MALDI-TOF mass spectrometry spectra of the p75-ICD-V5/His. Peptide sequences corresponding to the distal N-terminal ends are indicated as P1 and P2, respectively. Peptide sequences for s1-6 are described in Table I. F, comparison of the amino acid sequences of the cleavage sites within the transmembrane domains (shaded) of p75NTR and APP. The corresponding N-terminal peptide sequences identified by mass spectrometry (E) are indicated by the underline (P1 and P2). The asterisk (*) denotes the novel A{beta}-like transmembrane cleavage site in p75NTR and previously reported {gamma}-secretase cleavage sites of APP that result in production of A{beta}40 ({gamma}40), A{beta}42 ({gamma}42), or AICD ({gamma}49, Notch S3-like) are indicated by arrows.

 


View this table:
[in this window]
[in a new window]
 
TABLE I
Tryptic peptide sequence of the p75-ICD-V5/His detected by MALDI-TOF

 
The p75-ICD-containing soluble fraction was collected and subjected to chromatographic separations using ion exchange and metal-affinity (Talon) resins. Column fractions positive for the p75-ICD were pooled, separated on SDS-PAGE, and silver-stained (Fig. 4D). The silver-stained bands corresponding to the p75-ICD were subjected to in-gel digestion and MALDITOF mass spectrometry analysis (Fig. 4D). Mass spectrometry analysis revealed a major peak of molecular mass of 1855.0, as well as many minor peaks (Fig. 4E). Eight different tryptic peptides derived from the p75-ICD were identified in our MALDI-TOF analysis (Table I). The major peak (P1) and a minor peak (P2) were detected at 1855.0 and 1236.6, which correspond to the peptide sequences of VGLVAYIAFKRWNSCK and VGLVAYIAFKR, respectively (Fig. 4E; Table I). Predicted mass values were 1855.0 for P1 and 1236.7 for P2. Both peptides start at Val-236 of the human p75NTR (Fig. 4, E and F), indicating that the p75-ICD is generated as a result of proteolysis between amino acids Val-235 and Val-236. Interestingly, the major cleavage site of the p75NTR is located immediately after the amino acid sequence AAVV, similar to the A{beta}40 cleavage site that resides immediately following an analogous sequence (GGVV) (Fig. 4E). Our data indicate that the major intramembrane cleavage site of the p75NTR is located in the middle of the transmembrane domain that is reminiscent of the A{beta}40 cleavage of APP and is topologically distinct from the major transmembrane cleavage site of mouse Notch 1 (S3 site) (22) or from the {gamma}49 site of APP (41-43).

One of the most prominent functions of the p75NTR is to serve as a co-receptor for neurotrophins by forming a high affinity heteromeric receptor complex with Trk receptors (44). We noticed that the transmembrane domain and cytoplasmic tail of the p75NTR appear to be the essential structural regions for its interaction with the Trk receptor (45) as well as for forming a high affinity NGF receptor (44). Therefore, we postulated that the extracellular and/or intramembrane cleavage of the p75NTR (and subsequent domain truncations) may directly influence its interaction with Trk receptor.

We first tested whether TrkA co-localizes with truncated p75NTR variants produced by deletion constructs (Fig. 5A). 293 cells were co-transfected with TrkA constructs (with C-terminal V5/His epitope tag) along with constructs encoding vector alone (data not shown), p75 full-length, {Delta}E14 (containing the TM and cytoplasmic domains but not the extracellular domain; Fig. 2E), and p75-ICD (a predicted {gamma}-secretase product). Indirect immunofluorescence microscopy revealed that both full-length p75NTR and truncated {Delta}E14 are distributed in membranous structures and display an overall colocalization with TrkA (Fig. 5A). In contrast, the p75-ICD was distributed ubiquitously in the cell and appears to be concentrated in the nucleus as depicted by 4,6-diamidino-2-phenylindole nuclear staining. The distribution of p75-ICD was clearly different from that of TrkA. Treatment with compound E appeared to redistribute the co-localization patterns (indicated by the area of overlapping fluorescence signal) of TrkA and {Delta}E14 to include the trans-Golgi network/Golgi-like structures as well as the plasma membrane (Fig. 5B).



View larger version (56K):
[in this window]
[in a new window]
 
FIG. 5.
Immunocytochemical localization of TrkA, p75 full-length (FL), C-terminal fragments, and p75-ICD in transfected 293 cells. A, double labeling of 293 cells co-expressing TrkA (red; labeled C-terminal V5 tag), the p75 variants (green; labeled with antibody against intracellular domain of the p75), and 4,6-diamidino-2-phenylindole (DAPI) nuclear staining (blue). Note that p75 full-length and {Delta}E14 co-localize with TrkA, whereas p75-ICD does not. The p75-ICD was detected in both the cytoplasm and the nucleus. B, effects of compound E (Cpd.E) on the TrkA and {Delta}E14 immunoreactivities.

 

We next tested whether TrkA can interact with truncated p75NTR variants expressed by deletion constructs (Fig. 6A). 293 cells were co-transfected with TrkA constructs along with the p75 constructs mentioned above: full-length, {Delta}E14, and p75-ICD. A full-length ErbB4 construct was included as a negative control (10). The lysates were then subjected to co-immunoprecipitation analyses using anti-V5 antibodies under detergent conditions (1% Triton X-100 or 1% Nonidet P-40) previously described for the co-immunoprecipitation between full-length forms of TrkA and p75NTR (45). Both full-length and {Delta}E14 were co-immunoprecipitated by anti-V5 antibody, indicating that TrkA associates with both p75NTR full-length and the predicted metallo-protease generated C-terminal fragments ({Delta}E14) (Fig. 6A). Our data imply that the ectodomain-shedded p75NTR C-terminal fragments may still be complexed with TrkA and are predicted to serve as a high affinity NGF receptor (44). In contrast, the p75-ICD (Fig. 6A) and ErbB4 (Fig. 6B) failed to interact with TrkA, indicating that TrkA interacts with membrane-tethered p75NTR but not with the p75-ICD. These data suggest that {gamma}-secretase cleavage slashes the TM domain that is required for the association of p75NTR with the Trk receptor.



View larger version (36K):
[in this window]
[in a new window]
 
FIG. 6.
p75-ICD fails to form a molecular complex with TrkA. A, co-immunoprecipitation of TrkA (with C-terminal V5/His tag) with full-length (FL) p75NTR and other p75 variants expressed by deletion constructs: {Delta}E14 and p75-ICD. Detergent lysates from 293 cells that were transiently transfected with the indicated constructs were immunoprecipitated with monoclonal anti-V5 antibody and were analyzed by Western blotting using anti-p75-ICD (top panel) or polyclonal anti-V5 antibody (bottom panel). Starting material (Input) is shown in the right panel and the locations of the p75 full-length, C-terminal fragments, and ICD are indicated by arrows. Note that the p75-ICD and TrkA do not interact. B, co-immunoprecipitation was performed as described in A except that the blot was probed with anti-HA antibody to detect HA-tagged ErbB4.

 

To further investigate the molecular interaction between TrkA and cell-generated p75 proteolytic fragments, we next performed size exclusion chromatographic analyses using the detergent lysates prepared from stable 293 cells co-expressing TrkA and full-length p75NTR. To promote the generation and detection of the p75 C-terminal fragments and p75-ICD (derived from the full-length p75NTR), the cells were incubated with TPA and lactacystin in the absence (Fig. 7A) or presence (Fig. 7B) of compound E. The full-length p75NTR and TrkA exhibited virtually identical distribution in size exclusion chromatography fractions and the p75 C-terminal fragments exhibited an overlapping elution profile with TrkA (Fig. 7, A and B). The molecular mass of the high molecular weight complexes harboring TrkA and p75 full-length or C-terminal fragments was estimated as the size ranging between ~300 and 800 kDa. In contrast, p75-ICD migrated as a low molecular weight species, indicating that the p75-ICD is not recruited into the TrkA-bearing high molecular weight complex. In the parallel analyses, treatment with TPA, lactacystin, or compound E alone did not alter the distribution of TrkA and full-length p75NTR in the size exclusion chromatography fractions (data not shown).



View larger version (68K):
[in this window]
[in a new window]
 
FIG. 7.
p75-ICD is not recruited into the TrkA bearing high molecular weight complex. A and B, distribution of the full-length (FL) p75NTR, two major p75 proteolytic derivatives (C-terminal fragments and p75-ICD), and TrkA in size exclusion chromatography. Stable 293 transfectants co-expressing full-length p75NTR and TrkA were incubated with TPA and lactacystin for 8 h in the absence (A) or presence of compound E (B). Detergent lysates were fractionated by size exclusion chromatography and the p75NTR and TrkA were detected by Western blotting with either anti-V5 (TrkA) or anti-p75ICD. The locations of different p75 species are indicated by the arrows. Note that p75-ICD is virtually absent in the sample from {gamma}-secretase inhibitor (compound E)-treated cells (*). Numbers above the lanes indicate collected fractions and arrowheads indicate the native molecular masses of known protein standards.

 

We showed herein that p75NTR is the only {gamma}-secretase substrate identified so far that undergoes intramembrane proteolysis at the site precisely corresponding to the A{beta}40 cleavage. Although it is still possible that the minor {gamma}-secretase cleavage(s) might occur in alternate site(s) that were not detected in our MALDI-TOF analysis, our studies indicate that the single cleavage in the middle of the TM domain was sufficient to cause the release of the p75-ICD, without a need for additional cleavage near the cytoplasmic side of the membrane, such as {gamma}49 or Notch S3 cleavage (Fig. 4). Given a widely postulated role for neurotrophin receptors in cholinergic neuronal survival, our studies further raise the possibility that, like APP, altered proteolytic processing of p75NTR may contribute to the selective dysfunction and/or degeneration of p75-expressing neurons in Alzheimer's disease (e.g. basal forebrain cholinergic neurons) (6, 7). Moreover, it is conceivable that therapeutic reagents based on general inhibition of {gamma}-secretase activity may potentially affect p75 signaling and p75-associated cholinergic neuronal survival and differentiation.

The intracellular domains derived from APP and Notch appear to function commonly as nuclear signaling proteins. It remains to be determined whether the p75-ICD would also function as a nuclear transcriptional modulator like Notch and APP. Our data suggest that the main role of the {gamma}-secretase is to remove the p75 TM domain that is an essential domain for molecular interaction with the Trk receptor (Fig. 8). {gamma}-Secretase-mediated conversion of p75NTR from membrane-tethered p75 fragments to p75-ICD may occur while the p75 is bound to TrkA. Alternatively, p75 ectodomain shedding may occur without Trk receptors and additional cleavage by {gamma}-secretase would remove the membrane-tethered p75 fragments, thereby precluding interaction with Trk (Fig. 8). Independent of the possible nuclear function, our studies suggest that {gamma}-secretase-mediated p75NTR proteolysis plays a role in the formation/disassembly of this receptor complex by regulating the availability of the TM domain that is required for interaction with the Trk receptors.



View larger version (21K):
[in this window]
[in a new window]
 
FIG. 8.
Schematic model for the role of intramembrane proteolysis of the p75NTR in modulating the formation/disassembly of the heteromeric TrkA receptor complex. The p75NTR undergoes two sequential proteolytic cleavages (e.g. ectodomain shedding and {gamma}-secretase cleavage). TrkA may form heteromeric complexes, which are predicted to serve as high affinity NGF receptors, with either full-length (FL) or ectodomain-shedded C-terminal fragments. The role of the {gamma}-secretase-mediated intramembrane cleavage is to remove the transmembrane domain of the p75NTR, which is required for interaction with the TrkA receptor, thereby either precluding any potential interaction or causing their dissociation by cleaving the p75 TM domain while p75 is still bound to the TrkA receptor.

 


    FOOTNOTES
 
* This work was supported in part by Grants CA056490 [GenBank] (to M. V. C.) and NS43467 (to T.-W. K.) from the National Institutes of Health. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

|| To whom correspondence should be addressed: Dept. of Pathology, Columbia University, P&S 14-442, New York, NY 10032. Tel.: 212-305-5786; Fax: 212-342-1839; E-mail: twk16{at}columbia.edu.

1 The abbreviations used are: p75NTR, p75 neurotrophin receptor; APP, {beta}-amyloid precursor protein; A{beta}, amyloid {beta}-peptide; TM, transmembrane; ICD, intracellular domain; PS, presenilins; NGF, nerve growth factor; HA, hemagglutinin; PBS, phosphate-buffered saline;

MALDI-TOF, matrix-assisted laser desorption ionization time-of-flight; TPA, 12-O-tetradecanoylphorbol-13-acetate. Back


    ACKNOWLEDGMENTS
 
We thank B. Wainer for SN56 cells and B. L. Hempstead for helpful comments.



    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS AND DISCUSSION
 REFERENCES
 

  1. Chao, M. V. (2003) Nat. Rev. Neurosci. 4, 299-309[CrossRef][Medline] [Order article via Infotrieve]
  2. Huang, E. J., and Reichardt, L. F. (2001) Annu. Rev. Neurosci. 24, 677-736[CrossRef][Medline] [Order article via Infotrieve]
  3. Hempstead, B. L. (2002) Curr. Opin. Neurobiol. 12, 260-267[CrossRef][Medline] [Order article via Infotrieve]
  4. Dechant, G., and Barde, Y.-A. (2002) Nat. Neurosci. 5, 1131-1136[CrossRef][Medline] [Order article via Infotrieve]
  5. Sofroniew, M. V., Howe, C. L., and Mobley, W. C. (2001) Annu. Rev. Neurosci. 24, 1217-1281[CrossRef][Medline] [Order article via Infotrieve]
  6. Coyle, J. T., Price, D. L., and DeLong, M. R. (1983) Science 219, 1184-1190[Abstract/Free Full Text]
  7. Auld, D. S., Kornecook, T. J., Bastianetto, S., and Quirion, R. (2002) Prog. Neurobiol. 68, 209-245[CrossRef][Medline] [Order article via Infotrieve]
  8. De Strooper, B., Annaert, W., Cupers, P., Saftig, P., Craessaerts, K., Mumm, J. S., Schroeter, E. H., Schrijvers, V., Wolfe, M. S., Ray, W. J., Goate, A., and Kopan, R. (1999) Nature 398, 518-522[CrossRef][Medline] [Order article via Infotrieve]
  9. Ni, C.-Y., Murphy, M. P., Golde, T. E., and Carpenter, G. (2001) Science 294, 2179-2181[Abstract/Free Full Text]
  10. Lee, H.-J., Jung, K.-M., Huang, Y. Z., Bennett, L. B., Lee, J. S., Mei, L., and Kim, T.-W. (2002) J. Biol. Chem. 277, 6318-6323[Abstract/Free Full Text]
  11. Marambaud, P., Shioi, J., Serban, G., Georgakopoulos, A., Sarner, S., Nagy, V., Baki, L., Wen, P., Efthimiopoulos, S., Shao, Z., Wisniewski, T., and Robakis, N. K. (2002) EMBO J. 21, 1948-1956[CrossRef][Medline] [Order article via Infotrieve]
  12. Kim, D. Y., Ingano, L. A., and Kovacs, D. M. (2002) J. Biol. Chem. 277, 49976-49981[Abstract/Free Full Text]
  13. Ebinu, J. O., and Yankner, B. A. (2002) Neuron 34, 499-502[CrossRef][Medline] [Order article via Infotrieve]
  14. Fortini, M. E. (2002) Nat. Rev. Mol. Cell. Biol. 3, 673-684[CrossRef][Medline] [Order article via Infotrieve]
  15. Strooper, B. D., and Annaert, W. (2001) Nat. Cell Biol. 3, E221-E225[CrossRef][Medline] [Order article via Infotrieve]
  16. Haass, C., and Steiner, H. (2002) Trends Cell Biol. 12, 556-562[CrossRef][Medline] [Order article via Infotrieve]
  17. Selkoe, D., and Kopan, R. (2003) Annu. Rev. Neurosci. 26, 565-597[CrossRef][Medline] [Order article via Infotrieve]
  18. De Strooper, B., Saftig, P., Craessaerts, K., Vanderstichele, H., Guhde, G., Annaert, W., Von Figura, K., and Van Leuven, F. (1998) Nature 391, 387-390[CrossRef][Medline] [Order article via Infotrieve]
  19. Edbauer, D., Winkler, E., Regula, J. T., Pesold, B., Steiner, H., and Haass, C. (2003) Nat. Cell Biol. 5, 486-488[CrossRef][Medline] [Order article via Infotrieve]
  20. Kimberly, W. T., LaVoie, M. J., Ostaszewski, B. L., Ye, W., Wolfe, M. S., and Selkoe, D. J. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 6382-6387[Abstract/Free Full Text]
  21. Takasugi, N., Tomita, T., Hayashi, I., Tsuruoka, M., Niimura, M., Takahashi, Y., Thinakaran, G., and Iwatsubo, T. (2003) Nature 422, 438-441[CrossRef][Medline] [Order article via Infotrieve]
  22. Schroeter, E. H., Kisslinger, J. A., and Kopan, R. (1998) Nature 393, 382-386[CrossRef][Medline] [Order article via Infotrieve]
  23. Cao, X., and Sudhof, T. C. (2001) Science 293, 115-120[Abstract/Free Full Text]
  24. Baek, S. H., Ohgi, K. A., Rose, D. W., Koo, E. H., Glass, C. K., and Rosenfeld, M. G. (2002) Cell 110, 55-67[CrossRef][Medline] [Order article via Infotrieve]
  25. Scheinfeld, M. H., Ghersi, E., Laky, K., Fowlkes, B. J., and D'Adamio, L. (2002) J. Biol. Chem. 277, 44195-44201[Abstract/Free Full Text]
  26. Struhl, G., and Adachi, A. (2000) Mol. Cell 6, 625-636[CrossRef][Medline] [Order article via Infotrieve]
  27. DiStefano, P. S., and Johnson, E. M., Jr. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 270-274[Abstract/Free Full Text]
  28. Zupan, A. A., Osborne, P. A., Smith, C. E., Siegel, N. R., Leimgruber, R. M., and Johnson, E. M., Jr. (1989) J. Biol. Chem. 264, 11714-11720[Abstract/Free Full Text]
  29. Barker, P. A., Miller, F. D., Large, T. H., and Murphy, R. A. (1991) J. Biol. Chem. 266, 19113-19119[Abstract/Free Full Text]
  30. Zupan, A. A., and Johnson, E. M., Jr. (1991) J. Biol. Chem. 266, 15384-15390[Abstract/Free Full Text]
  31. DiStefano, P. S., Chelsea, D. M., Schick, C. M., and McKelvy, J. F. (1993) J. Neurosci. 13, 2405-2414[Abstract]
  32. Perez, P., Coll, P. M., Hempstead, B. L., Martin-Zanca, D., and Chao, M. V. (1995) Mol. Cell. Neurosci. 6, 97-105[CrossRef][Medline] [Order article via Infotrieve]
  33. Park, J. B., Kim, J. H., Kim, Y., Ha, S. H., Yoo, J. S., Du, G., Frohman, M. A., Suh, P. G., and Ryu, S. H. (2000) J. Biol. Chem. 275, 21295-21301[Abstract/Free Full Text]
  34. Schlondorff, J., and Blobel, C. P. (1999) J. Cell Sci. 112, 3603-3617[Abstract]
  35. Seiffert, D., Bradley, J. D., Rominger, C. M., Rominger, D. H., Yang, F., Meredith, J. E., Jr., Wang, Q., Roach, A. H., Thompson, L. A., Spitz, S. M., Higaki, J. N., Prakash, S. R., Combs, A. P., Copeland, R. A., Arneric, S. P., Hartig, P. R., Robertson, D. W., Cordell, B., Stern, A. M., Olson, R. E., and Zaczek, R. (2000) J. Biol. Chem. 275, 34086-34091[Abstract/Free Full Text]
  36. Shearman, M. S., Beher, D., Clarke, E. E., Lewis, H. D., Harrison, T., Hunt, P., Nadin, A., Smith, A. L., Stevenson, G., and Castro, J. L. (2000) Biochemistry 39, 8698-8704[CrossRef][Medline] [Order article via Infotrieve]
  37. Oberg, C., Li, J., Pauley, A., Wolf, E., Gurney, M., and Lendahl, U. (2001) J. Biol. Chem. 276, 35847-35853[Abstract/Free Full Text]
  38. Blusztajn, J. K., Venturini, A., Jackson, D. A., Lee, H. J., and Wainer, B. H. (1992) J. Neurosci. 12, 793-799[Abstract]
  39. Wolfe, M. S., Xia, W., Ostaszewski, B. L., Diehl, T. S., Kimberly, W. T., and Selkoe, D. J. (1999) Nature 398, 513-517[CrossRef][Medline] [Order article via Infotrieve]
  40. Steiner, H., Duff, K., Capell, A., Romig, H., Grim, M. G., Lincoln, S., Hardy, J., Yu, X., Picciano, M., Fechteler, K., Citron, M., Kopan, R., Pesold, B., Keck, S., Baader, M., Tomita, T., Iwatsubo, T., Baumeister, R., and Haass, C. (1999) J. Biol. Chem. 274, 28669-28673[Abstract/Free Full Text]
  41. Gu, Y., Misonou, H., Sato, T., Dohmae, N., Takio, K., and Ihara, Y. (2001) J. Biol. Chem. 276, 35235-35238[Abstract/Free Full Text]
  42. Sastre, M., Steiner, H., Fuchs, K., Capell, A., Multhaup, G., Condron, M. M., Teplow, D. B., and Haass, C. (2001) EMBO Rep. 2, 835-841[CrossRef][Medline] [Order article via Infotrieve]
  43. Weidemann, A., Eggert, S., Reinhard, F. B., Vogel, M., Paliga, K., Baier, G., Masters, C. L., Beyreuther, K., and Evin, G. (2002) Biochemistry 41, 2825-2835[CrossRef][Medline] [Order article via Infotrieve]
  44. Esposito, D., Patel, P., Stephens, R. M., Perez, P., Chao, M. V., Kaplan, D. R., and Hempstead, B. L. (2001) J. Biol. Chem. 276, 32687-32695[Abstract/Free Full Text]
  45. Bibel, M., Hoppe, E., and Barde, Y. A. (1999) EMBO J. 18, 616-622[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
B. M. Elzinga, C. Twomey, J. C. Powell, F. Harte, and J. V. McCarthy
Interleukin-1 Receptor Type 1 Is a Substrate for {gamma}-Secretase-dependent Regulated Intramembrane Proteolysis
J. Biol. Chem., January 16, 2009; 284(3): 1394 - 1409.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
M. Volosin, C. Trotter, A. Cragnolini, R. S. Kenchappa, M. Light, B. L. Hempstead, B. D. Carter, and W. J. Friedman
Induction of Proneurotrophins and Activation of p75NTR-Mediated Apoptosis via Neurotrophin Receptor-Interacting Factor in Hippocampal Neurons after Seizures
J. Neurosci., September 24, 2008; 28(39): 9870 - 9879.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
A. Sotthibundhu, A. M. Sykes, B. Fox, C. K. Underwood, W. Thangnipon, and E. J. Coulson
{beta}-Amyloid1-42 Induces Neuronal Death through the p75 Neurotrophin Receptor
J. Neurosci., April 9, 2008; 28(15): 3941 - 3946.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Urra, C. A. Escudero, P. Ramos, F. Lisbona, E. Allende, P. Covarrubias, J. I. Parraguez, N. Zampieri, M. V. Chao, W. Annaert, et al.
TrkA Receptor Activation by Nerve Growth Factor Induces Shedding of the p75 Neurotrophin Receptor Followed by Endosomal {gamma}-Secretase-mediated Release of the p75 Intracellular Domain
J. Biol. Chem., March 9, 2007; 282(10): 7606 - 7615.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C.-X. Liu, S. Ranganathan, S. Robinson, and D. K. Strickland
{gamma}-Secretase-mediated Release of the Low Density Lipoprotein Receptor-related Protein 1B Intracellular Domain Suppresses Anchorage-independent Growth of Neuroglioma Cells
J. Biol. Chem., March 9, 2007; 282(10): 7504 - 7511.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
Z. Ahmed, G. Mazibrada, R. J. Seabright, R. G. Dent, M. Berry, and A. Logan
TACE-induced cleavage of NgR and p75NTR in dorsal root ganglion cultures disinhibits outgrowth and promotes branching of neurites in the presence of inhibitory CNS myelin
FASEB J, September 1, 2006; 20(11): 1939 - 1941.
[Abstract] [Full Text] [PDF]


Home page
BrainHome page
Z. Ahmed, E. L. Suggate, E. R. Brown, R. G. Dent, S. J. Armstrong, L. B. Barrett, M. Berry, and A. Logan
Schwann cell-derived factor-induced modulation of the NgR/p75NTR/EGFR axis disinhibits axon growth through CNS myelin in vivo and in vitro
Brain, June 1, 2006; 129(6): 1517 - 1533.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
M. Zhang, A. Haapasalo, D. Y. Kim, L. A. M. Ingano, W. H. Pettingell, and D. M. Kovacs
Presenilin/{gamma}-secretase activity regulates protein clearance from the endocytic recycling compartment
FASEB J, June 1, 2006; 20(8): 1176 - 1178.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
H. B. Kordasiewicz, R. M. Thompson, H. B. Clark, and C. M. Gomez
C-termini of P/Q-type Ca2+ channel {alpha}1A subunits translocate to nuclei and promote polyglutamine-mediated toxicity
Hum. Mol. Genet., May 15, 2006; 15(10): 1587 - 1599.
[Abstract] [Full Text] [PDF]


Home page
BrainHome page
A. Logan, Z. Ahmed, A. Baird, A. M. Gonzalez, and M. Berry
Neurotrophic factor synergy is required for neuronal survival and disinhibited axon regeneration after CNS injury
Brain, February 1, 2006; 129(2): 490 - 502.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
K.-M. Jung, R. Mangieri, C. Stapleton, J. Kim, D. Fegley, M. Wallace, K. Mackie, and D. Piomelli
Stimulation of Endocannabinoid Formation in Brain Slice Cultures through Activation of Group I Metabotropic Glutamate Receptors
Mol. Pharmacol., November 1, 2005; 68(5): 1196 - 1202.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. W. Cowan, X. Wang, R. Guan, K. He, J. Jiang, G. Baumann, R. A. Black, M. S. Wolfe, and S. J. Frank
Growth Hormone Receptor Is a Target for Presenilin-dependent {gamma}-Secretase Cleavage
J. Biol. Chem., May 13, 2005; 280(19): 19331 - 19342.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Zampieri, C.-F. Xu, T. A. Neubert, and M. V. Chao
Cleavage of p75 Neurotrophin Receptor by {alpha}-Secretase and {gamma}-Secretase Requires Specific Receptor Domains
J. Biol. Chem., April 15, 2005; 280(15): 14563 - 14571.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
J. M. Frade
Nuclear Translocation of the p75 Neurotrophin Receptor Cytoplasmic Domain in Response to Neurotrophin Binding
J. Neurosci., February 9, 2005; 25(6): 1407 - 1411.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
M. Hartmann, T. Brigadski, K. S. Erdmann, B. Holtmann, M. Sendtner, F. Narz, and V. Lessmann
Truncated TrkB receptor-induced outgrowth of dendritic filopodia involves the p75 neurotrophin receptor
J. Cell Sci., November 15, 2004; 117(24): 5803 - 5814.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
J. Milano, J. McKay, C. Dagenais, L. Foster-Brown, F. Pognan, R. Gadient, R. T. Jacobs, A. Zacco, B. Greenberg, and P. J. Ciaccio
Modulation of Notch Processing by {gamma}-Secretase Inhibitors Causes Intestinal Goblet Cell Metaplasia and Induction of Genes Known to Specify Gut Secretory Lineage Differentiation
Toxicol. Sci., November 1, 2004; 82(1): 341 - 358.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Araki, N. Miyagi, N. Kato, T. Yoshida, S. Wada, M. Nishimura, H. Komano, T. Yamamoto, B. De Strooper, K. Yamamoto, et al.
Coordinated Metabolism of Alcadein and Amyloid {beta}-Protein Precursor Regulates FE65-dependent Gene Transactivation
J. Biol. Chem., June 4, 2004; 279(23): 24343 - 24354.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
C. E. Paul, E. Vereker, K. M. Dickson, and P. A. Barker
A Pro-Apoptotic Fragment of the p75 Neurotrophin Receptor Is Expressed in p75NTRExonIV Null Mice
J. Neurosci., February 25, 2004; 24(8): 1917 - 1923.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. Weskamp, J. Schlondorff, L. Lum, J. D. Becherer, T.-W. Kim, P. Saftig, D. Hartmann, G. Murphy, and C. P. Blobel
Evidence for a Critical Role of the Tumor Necrosis Factor {alpha} Convertase (TACE) in Ectodomain Shedding of the p75 Neurotrophin Receptor (p75NTR)
J. Biol. Chem., February 6, 2004; 279(6): 4241 - 4249.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K.-i. Kuwako, H. Taniura, and K. Yoshikawa
Necdin-related MAGE Proteins Differentially Interact with the E2F1 Transcription Factor and the p75 Neurotrophin Receptor
J. Biol. Chem., January 16, 2004; 279(3): 1703 - 1712.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/43/42161    most recent
M306028200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jung, K.-M.
Right arrow Articles by Kim, T.-W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jung, K.-M.
Right arrow Articles by Kim, T.-W.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement