JBC INTERFERin siRNA transfection reagent

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M302177200 on July 18, 2003

J. Biol. Chem., Vol. 278, Issue 43, 42515-42523, October 24, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/43/42515    most recent
M302177200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Suetsugu, S.
Right arrow Articles by Takenawa, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Suetsugu, S.
Right arrow Articles by Takenawa, T.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Translocation of N-WASP by Nuclear Localization and Export Signals into the Nucleus Modulates Expression of HSP90*

Shiro Suetsugu and Tadaomi Takenawa{ddagger}

From the Department of Biochemistry, Institute of Medical Science, University of Tokyo, and Core Research for Evolutional Science and Technology, Japan Science and Technology Corporation, 4-6-1 Shirokane-dai, Minato-ku, Tokyo 108-8639, Japan

Received for publication, March 3, 2003 , and in revised form, July 8, 2003.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS AND DISCUSSION
 REFERENCES
 
N-WASP regulates the actin cytoskeleton through activation of the Arp2/3 complex. N-WASP localizes at the cell periphery, where it controls actin polymerization downstream of signal molecules such as adapter proteins, Cdc42, Src family kinases, and phosphoinositides. N-WASP also localizes in the nucleus; however, the role of N-WASP in the nucleus is unclear. Here, we show that localization of N-WASP is controlled through phosphorylation by Src family kinases in which phosphorylated N-WASP is exported from the nucleus in a nuclear export signal (NES) and leptomycin B-dependent manner. N-WASP had nuclear localization signal (NLS) at its basic region and NES close to the phosphorylation site by Src family kinases, indicating that phosphorylation controls the accessibility to the NES through conformational changes. Increased levels of unphosphorylated N-WASP in the nucleus suppressed expression of HSP90 and transcription from a heat shock element (HSE). N-WASP bound heat shock transcription factor (HSTF) and enhanced the HSTF association with HSE. In addition, nuclear N-WASP was present in the protein complex that associates with HSE, suggesting that N-WASP participates in suppression of HSP90 transcription. Increased levels of unphosphorylated N-WASP also decreased the activities of Src family kinases in cells but not in experiments in vitro with pure N-WASP and Fyn. Because HSP90 is essential for the activities of Src family kinases, these results suggest that localization of N-WASP modulates Src kinase activity by regulating HSP90 expression.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS AND DISCUSSION
 REFERENCES
 
The Wiskott-Aldrich syndrome protein (WASP)1 family of proteins includes two WASP proteins, WASP, which is restricted to the hematopoietic cells, and ubiquitous neural Wiskott-Aldrich syndrome Invitrogenrotein (N-WASP) (1, 2) and three WASP family verprolin-homologous proteins (WAVEs) (3, 4), which transmit signals for de novo actin nucleation mediated by Arp2/3 complex at the cell periphery (5, 6). These proteins participate in actin reorganization processes involving formation of filopodia and lamellipodia (7, 8). Interestingly, N-WASP and WASP are also localized in the nucleus (2). WASP-interacting protein (WIP) recruits nuclear N-WASP to cytoplasm to induce filopodium formation (9).

The VCA (verprolin-homology, cofilin-homology, and acidic) domain of N-WASP and WASP not only associates with actin and Arp2/3 complex but also with the middle region of N-WASP or WASP, by intramolecular interactions. It has been postulated that the association between the VCA region and the middle region of N-WASP yields an autoinhibited structure (10-13). Upon association with Cdc42 and/or phosphoinositides or phosphorylation of N-WASP by Src family kinases, the autoinhibition of N-WASP is released. However, the relation between N-WASP conformation and localization is not clear.

Src family kinases have roles in controlling the actin cytoskeleton, but they also promote proliferation of cells. Therefore, mutations that activate Src family kinases induce transformation of cells. The activity of Src family kinases is controlled in a variety of ways, including phosphorylation, dephosphorylation (14, 15), and ubiquitin-dependent protein degradation by proteasomes (16-18).

Molecular chaperones, such as HSP90, also play the important roles in proper activation of Src family kinases. Loss of HSP90 activity due to a specific inhibitor of HSP90, geldanamycin, results in the loss of Src family kinase activity. Src and HSP90 form a complex that promotes transformation of cells (19, 20).

In the present study, we investigated the role of N-WASP in the nucleus. Localization of N-WASP is affected by its phosphorylation by Src family kinases (21). Phosphorylated N-WASP tends to localize in the cytoplasm, whereas unphosphorylated N-WASP localizes predominantly in the nucleus. Comparison of the amounts of transcripts from cells expressing an N-WASP mutant lacking a phosphorylation site and those from cells expressing a phosphorylation-mimic mutant of N-WASP revealed that N-WASP is involved in transcription of HSP90. Analysis of several cell lines expressing mutant N-WASP and transcription from a heat shock element (HSE) suggest that N-WASP is a negative regulator of HSP90 expression. This effect of N-WASP appears to be inhibited when N-WASP is phosphorylated and exported from the nucleus.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
 REFERENCES
 
Cell Culture—COS-7 cells were cultured as described previously (22). Transfection was done with LipofectAMINE 2000 (Invitrogen) according to the manufacture's instructions. Localization of N-WASP was analyzed by GFP fluorescence or indirect immunofluorescence with anti-N-WASP antibody. Heat shock was performed at 44°C for 30 min followed by the recovery of cells at 37°C for 90 min. Tet-off HEK293 cells were purchased from Clontech. The stably transfected HEK293 cell lines were established according to the manufacturer's instruction. Doxycycline (1 µg/ml) was used as an alternative to tetracycline to suppress transgene expression.

DNA Microarray—HEK293 cells were transfected with GFP-Y253F N-WASP or GFP-Y253E N-WASP. About 10 µg of plasmid was introduced by electroporation (Bio-Rad). Transfected cells were harvested, and mRNA was purified with the RNeasy kit (Qiagen) followed by the Quickprep micro mRNA purification kit (Amersham Biosciences). After checking the quality of mRNA by electrophoresis, Cy3- and Cy5-labeled cDNA probes were generated with a Fluorescence Labeling core kit (Takara). The qualities of these probes for hybridization on microarrays were confirmed with Test Array (Takara). The probes were then hybridized on IntelliGene Human CHIP 1K Set I version 1.0 (Takara). Microarray signals were acquired with Scan Array Lite (Packard BioChip Technologies). Signals were calibrated to housekeeping genes spotted on the chip (see "DNA Microassay Analysis of Cells Expressing Y253F N-WASP or Y253E N-WASP"). Spots with signal intensities more than twice the level of the standard deviation of background signal were selected for further analysis (23). Statistical significance of expressional changes was determined by using Student's t test of signal intensities against standard genes (p < 0.05).

Luciferase Assay—The sequence from the promoter region of HSP89alpha (HSP90alpha) with heat shock element (HSE) and TATA box was cloned into pGL-basic vector (Promega). The sequence is as follows: ggttcttccggaagttggggaggcttctggaaaaagcgccgcgcgctgggcgggcccgtggctatataaggcaggcgcgggggtggcgcg. After co-transfection of plasmids for N-WASP expression and HSE reporter plasmids at a ratio of 3:1, cells were harvested, and the luciferase activity was determined with a Luciferase Assay kit (Stratagene). The luciferase activity was normalized to the total amount of protein determined by Bradford assay (Bio-Rad).

Proteins—Full-length or truncated (1-204 amino acids) human heat-shock transcription factor/heat-shock factor 1 (HSTF1) was subcloned into pGEX (Amersham Biosciences). GST fusion proteins were expressed in Escherichia coli BL21 (Stratagene), purified, and the GST tag was removed as described previously (22). Fyn and N-WASP were obtained as described previously (21).

Gel-mobility Shift Assay—Nuclear fractions for gel shift assays was prepared as described previously (24). The sequence of the probe was the same as that used in luciferase reporter plasmid.

Kinase Assay—In vitro kinase assay with purified Fyn, N-WASP, and/or poly-Glu:Tyr 4:1 substrate (Sigma) was performed as follows. Proteins were purified as described previously (21). Fyn (final 0.1 µg/µl) and N-WASP (final 1 µg/µl) was mixed with poly-Glu:Tyr (4:1) (Sigma) (final 0.4 µg/µl) in kinase buffer containing 20 mM Hepes (pH 7.2), 10 mM MgCl2, 3 mM MnCl2, 150 mM KCl, and 5 mM ATP with 20 µCi/ml [{gamma}-32P]ATP. The mixture was incubated for 10 min at 30°C. Addition of SDS-PAGE sample buffer followed by boiling stopped the reaction. Phosphorylation was monitored by SDS-PAGE and autoradiography.

For kinase assays with Fyn immunoprecipitated from COS-7 cells, wild-type Fyn and GFP-tagged wild-type N-WASP, Y253F N-WASP, or Y253E N-WASP were co-transfected and cultured in medium containing serum for 1 day. Cells were then serum-starved for overnight and harvested into buffer containing 40 mM Hepes (pH 7.2), 150 mM NaCl, 5 mM EDTA, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, 0.5% Triton X-100, 0.1 mg/ml aprotinin, and 0.1 mg/ml leupeptin. After immunoprecipitation with anti-Fyn monoclonal antibody (generous gift of Drs. Tezuka and Yamamoto, University of Tokyo), the kinase reaction was performed with 0.2 µg/µl poly-Glu:Tyr in the kinase buffer. The mixture was incubated for 10 min at 30°C. Addition of SDS-PAGE sample buffer followed by boiling stopped the reaction. Phosphorylation was monitored by SDS-PAGE and autoradiography.

Focus Assay—NIH-3T3 cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% calf serum (Invitrogen). Cells (1.8 x 105) were seeded into a 6-cm dish. After overnight culture, cells were transfected with 1 µg of plasmid expressing constitutively active (CA) Y531F Fyn or dominant negative (DN) K299M Fyn and 2 µg of plasmid expressing GFP-tagged wild-type N-WASP, Y253F N-WASP, or Y253E N-WASP. The following day, the cells were divided into four 6-cm dishes. Cells were then cultured for 2 weeks. Culture medium was replaced every 3 days. Focus formation was analyzed by Giemsa staining (Sigma).


   RESULTS AND DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS AND DISCUSSION
REFERENCES
 
Localization of N-WASP Is Determined by Its Phosphorylation Status—We previously reported that phosphorylation of N-WASP by Src family kinases releases the autoinhibited structure and activates the Arp2/3 complex (21). We made phosphorylation site mutants of N-WASP. In Y253F N-WASP, the tyrosine of the phosphorylation site is replaced with phenylalanine and cannot be phosphorylated. In contrast, Y253E N-WASP has a positively charged glutamic acid instead of tyrosine, mimicking phosphorylation. We examined localization of these N-WASP mutants and of wild-type N-WASP in COS-7 cells with GFP. Wild-type N-WASP was localized in the cytoplasm and in nucleus during serum starvation (Fig. 1, A and B). Both Y253F and Y253E N-WASP localized in the nucleus and the cytoplasm; however, the localization patterns were different. Y253F N-WASP was preferentially localized in the nucleus (Fig. 1, A and B), whereas Y253E N-WASP was preferentially localized in the cytoplasm (Fig. 1, A and B).



View larger version (33K):
[in this window]
[in a new window]
  		FIG. 1.
Localization of N-WASP. A, localization of N-WASP and its mutants. Upper, GFP-tagged N-WASP (wild-type, Y253F, or Y253E) was expressed ectopically in COS-7 cells. Localization was examined by GFP fluorescence. Lower, the {Delta}basic, {Delta}proline-rich region ({Delta}pro), or {Delta}IQ mutant of N-WASP was expressed ectopically in COS-7 cells, and its localization was examined with anti-N-WASP antibody. The images are highlighted to show ectopic expression of N-WASP. B, quantification of localization of N-WASP. Localization of GFP-tagged N-WASP was monitored with GFP fluorescence. Cells with GFP signals predominantly in the nucleus or in the cytoplasm are classified as cells with nuclear or cytoplasmic localization of GFP-N-WASP, respectively. Cells with roughly equal amounts of N-WASP localized in cytoplasm and in nucleus are classified as roughly equally localized cells. C, localization of N-WASP in the presence of CA or DN Fyn. CA Fyn or DN Fyn was expressed ectopically in COS-7 cells. Localization of endogenous N-WASP was examined by immunofluorescence with anti-N-WASP antibody. N-WASP signals are shown in the left column. In the middle column, the merged images show phalloidin, N-WASP, and ectopically expressed Fyn. The staining color of each protein in the merged images is indicated in the label. Quantification of localization of N-WASP is shown as in B in the right column. D, localization of Y253F N-WASP in the presence of CA Fyn. GFP-tagged Y253F N-WASP was expressed ectopically with or without CA Fyn in COS-7 cells. Localization of Y253F N-WASP was examined and quantified as in C by GFP fluorescence.

 

We then investigated localization of endogenous N-WASP in the presence of constitutively active (CA) or dominant-negative (DN; kinase-negative) Fyn. Expression of CA Fyn decreased the amount of N-WASP in the nucleus, whereas DN Fyn had no effect on localization of N-WASP (Fig. 1C). To confirm the phosphorylation-dependent localization of N-WASP, we examined the localization of Y253F N-WASP in the presence of CA Fyn. Y253F N-WASP preferentially localized in the nucleus even in the presence of CA Fyn (Fig. 1D). These results indicate that the phosphorylation of N-WASP influences localization of N-WASP.

N-WASP Is Exported from the Nucleus in a Leptomycin B-dependent Manner—Localization of proteins in the nucleus is actively regulated by nuclear localization signal (NLS) or nuclear export signal (NES) sequences present in the protein itself. NLS is a basic amino acid sequence that is also in N-WASP. The IQ motif was originally found as calmodulin binding site. But its role in N-WASP function remains unclear. The IQ motif is composed of basic amino acids. Besides IQ motif, N-WASP has another basic amino acid cluster, the basic region (2, 25). Deletion of the IQ motif (amino acids 126-145) or both IQ motif and basic region (amino acids 126-194) results in localization of N-WASP predominantly in cytoplasm. These cytoplasmic localizations of N-WASP mutants were observed in 93% of {Delta}IQ mutant-expressing cells and 95% of {Delta}basic mutant-expressing cells, indicating that the IQ motif and the basic region are the NLS for N-WASP (Figs. 1A and 2A). In contrast, deletion of the proline-rich region did not affect the nuclear localization of N-WASP.



View larger version (22K):
[in this window]
[in a new window]
  		FIG. 2.
Nuclear localization or export signal in N-WASP. A, amino acid sequence of N-terminal region of N-WASP. The nuclear localization signal (NLS) is identical to the previously assigned IQ motif (2). The tandem leucines just behind the CRIB motif comprise the nuclear export signal (NES). The substituted leucines in the LA mutant are shown with an asterisk. B, NES- and leptomycin B-dependent localization of N-WASP in the nucleus. Upper panels, localization of GFP-tagged Y253E N-WASP (GFP-N-WASP E253) or GFP-tagged Y253E N-WASP with substitution of leucine with alanine at NES (GFP-N-WASP E253 LA). Lower panels, localization of GFP-N-WASP E253 in cells treated with leptomycin B (LMB, 5 ng/ml) for 30 or 120 min. Localization of GFP-tagged Y253E N-WASP was observed by GFP fluorescence. C, quantification of localization of N-WASP in the presence or absence of LMB. Localization of GFP-tagged N-WASP was monitored with GFP fluorescence as in Fig. 1B.

 

An NES-like sequence with several leucines is also present in N-WASP around the phosphorylation site of N-WASP (Fig. 2A) (26). To examine the mechanism underlying the cytoplasmic localization of N-WASP, we treated cells expressing a GFP fusion Y253E N-WASP with leptomycin B (LMB), which specifically blocks export of proteins with NES from the nucleus within minutes (27). LMB treatment of cells resulted in increased Y253E N-WASP levels in the nucleus within 30 min. After 120 min treatment of LMB, cytoplasmic localization of Y253E N-WASP was drastically decreased (Fig. 2, B and C), indicating that N-WASP is exported actively from the nucleus by an NES-dependent mechanism to the cytoplasm when phosphorylated.

To examine the NES of N-WASP, we substituted leucines (Leu-222, Leu-225, Leu-229, and Leu-232) in the putative NES sequence with alanine (Fig. 2A). The resulting mutant N-WASP with Y253E mutation and NES mutation (Y253E LA N-WASP) predominantly localized in the nucleus, whereas Y253E N-WASP preferentially localized in the cytoplasm (Fig. 2, B and C). Therefore, Y253E N-WASP is transported into the nucleus by an NLS-dependent mechanism and is also exported in an NES-dependent manner. Phosphorylation of N-WASP probably releases the autoinhibitory interaction and exposes the NES sequence, resulting in export of N-WASP from the nucleus.

DNA Microarray Analysis of Cells Expressing Y253F N-WASP or Y253E N-WASP—We then examined changes in gene expression that accompany changes in nuclear N-WASP level by DNA microarray. To compensate for the effect of increased levels of N-WASP due to ectopic expression, we compared the cells expressing Y253F N-WASP, which was localized preferentially in the nucleus, and cells expressing Y253E N-WASP, which was localized preferentially in the cytoplasm. Weak signals with intensities similar to that of the background were excluded from further analysis. We analyzed ~180 genes that gave signal intensities more than twice the level of the standard deviation of background signal (Fig. 3 and Table I). The ratios of control gene expression were 0.94 ± 0.07 for {beta}-actin, 1.09 ± 0.15 for ATP synthetase, 0.90 ± 0.03 for glyceraldehyde-3-phosphate dehydrogenase, 0.89 ± 0.02 for {alpha}-tubulin, and 0.88 ± 0.03 for ribosomal protein S5. Expression of most genes appeared to be elevated in cells with Y253E, but these differences were not statistically significant (p > 0.05 by t test) (Fig. 3). Some genes showed statistically higher expression in cells expressing Y253E N-WASP than in cells expressing Y253F N-WASP (p < 0.05). Genes with elevated expression included HSP90 with a ratio of 1.9 ± 0.3, activated leukocyte cell adhesion molecule with 2.6 ± 0.3, ATP-binding cassette, sub-family E with 2.2 ± 0.2, heterogeneous nuclear ribonucleoprotein U with 2.6 ± 0.02, human clone 23722 mRNA sequence with 1.9 ± 0.03, and protein-tyrosine phosphatase type IVA with 2.0 ± 0.1 (Table I).



View larger version (17K):
[in this window]
[in a new window]
  		FIG. 3.
DNA microarray analyses of transcripts from cells expressing Y253F and Y253E N-WASP. A, cross-plots of the intensities of signals on DNA microarray. Comparison of mRNA levels between HEK293 cells expressing Y253F and Y253E N-WASP is shown. B, histogram of the ratio of transcripts from cells expressing Y253E over Y253F N-WASP. The mean of two independent experiments is shown.

 

View this table:
[in this window]
[in a new window]
  		TABLE I
List of genes analyzed on DNA microarray

Signals were calibrated to housekeeping genes (highlighted in green) spotted on the chip. Spots with signal intensities more than twice the level of the standard deviation of background signal were listed here. Statistical significance of expressional changes were determined by Student's t test of signal intensities against standard genes (p < 0.05). The genes with statistically significant changes are highlighted in yellow.

 

HSP90 Levels in Cell Lines Expressing Ectopic N-WASP—We then focused on the relation between expression of HSP90 and localization of N-WASP. We established HEK293 cell lines that stably expressed GFP Y253F N-WASP or GFP Y253E N-WASP. We also established a control cell line that expressed GFP. The amount of ectopic N-WASP in these cell lines was ~5-fold higher than that of endogenous N-WASP in Western blotting (data not shown). In these cell lines, localization of the mutant N-WASPs was similar with that in cells with transient expression (data not shown). We compared the HSP90 content of each cell line by Western blotting with tublin as standard. As shown in Fig. 4A, HSP90 levels were decreased in cells expressing Y253F N-WASP. HSP90 levels in cells expressing Y253E N-WASP were similar with those of control cells. Therefore, nuclear localization of N-WASP seems to reduce amount of HSP90 protein.



View larger version (23K):
[in this window]
[in a new window]
  		FIG. 4.
Increased nuclear N-WASP decreases expression of HSP90. A, determination of HSP90 levels in cell lines stably expressing Y253F or Y253E N-WASP by Western blotting. The ratio of the HSP90 signal to the tubulin signal of each stable cell line is plotted. B and C, HSP90 mRNA and protein levels in cell lines with inducible expression of Y253F or Y253E N-WASP as determined by Northern blotting (B) and Western blotting (C), respectively. D, effect of N-WASP expression on transcription from the heat shock element (HSE). HSE reporter plasmid was co-transfected with plasmid for expression of N-WASP or Fyn. Luciferase activity reflecting transcription from the HSE was monitored. a, effect of amount of N-WASP. N-WASP was ectopically expressed under CMV (cytomegalovirus), EF (elongation factor), and SR{alpha} promoters. b, effect of CA or DN Fyn. c, effect of Y253F and Y253E mutations of N-WASP. E, amounts of N-WASP expressed under CMV, EF, and SR{alpha} promoters. F and G, -fold increase of HSP90 and HSP70 in cells expressing wild type or mutant N-WASP upon heat shock for 30 min (F) or EGF treatment for 2 h (G). The amounts of HSP90 and HSP70 in cells were examined by Western blotting. Western blotting with anti-actin antibody was also performed as control. The -fold increases of the ratio of HSP90 or HSP70 signals to actin signals are shown.

 

To confirm that HSP90 levels are influenced by Y253F N-WASP, which is localized in the nucleus, a cell line with inducible expression of Y253F N-WASP or Y253E N-WASP was established. In this cell line, levels of HSP90 and HSP90 mRNA were decreased when Y253F N-WASP was expressed. We next analyzed the effect of Y253E N-WASP, which preferentially localized in the cytoplasm. When Y253E N-WASP was expressed, the levels of HSP90 increased. Therefore, localization of N-WASP to the nucleus decreases expression of HSP90 (Fig. 4, B and C).

N-WASP Suppresses Transcription from Heat Shock Element—Expression of HSP90 is controlled at least in part by heat shock transcription factors/heat shock factors (HSTFs/HSFs) that bind to a heat shock element (HSE) in the promoter region of HSP90 or other HSPs. HSEs and HSTFs control transcription of HSPs under normal and under stress conditions (28). We examined whether the amounts of N-WASP in the nucleus affect transcription from the HSE of HSP90 with a luciferase assay (Fig. 4, D and E).

Fractionation of nuclei revealed that increase in total amount of wild-type N-WASP resulted in increase in amount of nuclear N-WASP (data not shown). The transcription from the HSE was decreased when levels of N-WASP were increased by ectopic expression. We then examined transcription from HSE at several levels of N-WASP expression (Fig. 4, D (panel a) and E). In HEK293 cells, cytomegalovirus (CMV) promoter is more efficient in protein expression than elongation factor (EF) promoter. EF promoter is more efficient than SR{alpha} promoter. The increase in N-WASP paralleled the decrease in transcription from HSE, suggesting that N-WASP suppresses transcription from the HSE (Fig. 4, D (panel a) and E).

In the present study, transcription from HSE was also affected by Fyn. Expression of DN Fyn decreased the transcription from the HSE. In contrast, transcription from the HSE was enhanced by expression of CA Fyn. Therefore, Src family kinase might be required for transcription from the HSE through control of N-WASP localization (Fig. 4D, panel b).

We next examined the difference in wild-type, Y253F, and Y253E N-WASP in suppression of HSE transcription. Because these ectopically expressed N-WASP were expressed under CMV promoter, the amount of ectopically expressed N-WASP was ~20-fold higher than that of endogenous N-WASP (Fig. 4E). Therefore, the increase in nuclear N-WASP was observed even in the Y253E N-WASP-expressing cells, because a small population of Y253E N-WASP was localized in the nucleus (Fig. 2). Increase in cytoplasmic N-WASP did not bring out nuclear HSTF1, indicating that localization of HSTFs were independent of N-WASP (data not shown). Accordingly, the suppression of HSE transcription was observed in wild-type-, Y253F-, and Y253E N-WASP-expressing cells. However, consistent with the difference in preference in localization, the suppression was weaker in cells expressing Y253E N-WASP than that in cells expressing wild-type or Y253F N-WASP-expressing cells (Fig. 4D, panel c).

We next examined the increase of HSP90 and HSP70 upon heat shock was suppressed by increase in nuclear N-WASP. Heat shock drives the transcription form HSE to increase the amount of HSPs. As shown in Fig. 4F, the increase of HSP90 as well as HSP70 upon heat shock was suppressed in cells with ectopic N-WASP expression. The suppression of increase in HSPs was strongest in cells with Y253F N-WASP expression, confirming that nuclear N-WASP is the suppressor of HSE transcription (Fig. 4F).

We next examined whether EGF treatment of cells induces HSP expression, because EGF activates Src family kinases. Treatment of cells with EGF for 2 h resulted in the increase in HSP90 and HSP70 (Fig. 4G). This increase in HSP90 and HSP70 upon EGF was suppressed by N-WASP expression. Like heat shock responses, the induction of HSP expression was most effectively suppressed by Y253F N-WASP expression than by wild-type N-WASP expression, confirming the role of nuclear N-WASP in suppression of transcription from HSE.

N-WASP Binds to Heat Shock Transcription Factor and Forms a Complex on the HSE—We examined the physical association between HSTF1 and N-WASP. In a pull-down assay, full-length HSTF1 associated with several domains of N-WASP, including the VCA domain, WH1 domain, and region between the IQ and CRIB motifs. The VCA domain appears to be the highest affinity region. In the VCA domain, the V region bound to HSTF1 (Fig. 5A). HSTF1 did not associate with the proline-rich region of N-WASP (data not shown).



View larger version (25K):
[in this window]
[in a new window]
  		FIG. 5.
Association of HSTF1 with N-WASP. A, association of HSTF1 with N-WASP. Left, GST fusion proteins of N-WASP fragments (WH1, CRIB, or VCA) were immobilized on glutathione-Sepharose beads. After incubation with full-length HSTF1, bound proteins were analyzed by Western blotting. HSTF1 associates strongly with V domain and weakly with WH1 and CRIB domain of N-WASP. Right, GST fusion proteins of HSTF1 (full-length or amino acids 1-204) were immobilized on glutathione-Sepharose beads. After incubation with full-length HSTF1, bound protein was analyzed by Western blotting. N-WASP associates with the DNA binding domain of HSTF1. B, enhanced association of HSTF1 with HSE in the presence of N-WASP. The indicated concentrations of N-WASP and/or GST-HSTF1 were incubated with 0.01 µM 32P-labeled HSE DNA fragment. No association of GST alone with HSE was observed (data not shown). Associations between HSE and the proteins were analyzed by electrophoresis and autoradiography. Non-labeled HSE fragment was added as competitor at 1 µM. C, presence of N-WASP in the protein complex that binds to HSE. The nuclear fraction was incubated with anti-N-WASP antibody or non-immune IgG as negative control. These mixtures were then incubated with 32P-labeled HSE DNA fragment, and bound proteins in the nuclear fraction were analyzed as in C. D, association of N-WASP and HSTF1 in vivo. HEK 293 cells were transfected with FLAG-tagged Y253F or Y253E N-WASP. FLAG-tagged N-WASP was then immunoprecipitated and association with HSTF1 was examined by Western blotting.

 

We examined the effect of an N-WASP with a deletion of V region ({Delta}V N-WASP) on transcription from the HSE. Although the V region was the major HSTF-binding site in N-WASP, {Delta}V N-WASP suppressed transcription from the HSE similar to wild-type N-WASP (data not shown). It is possible that weak binding of N-WASP to HSTF through other sites suppressed transcription.

Full-length N-WASP also associated with full-length HSTF1 in a pull-down assay. The region of HSTF1 responsible for N-WASP binding was the N-terminal DNA binding region (Fig. 5B).

We then examined whether the binding of HSTF1 to the HSE was influenced by N-WASP. N-WASP had a weak affinity for HSE in mobility-shift assays. Binding of HSTF1 to the HSE was further increased in the presence of N-WASP. Binding of HSTF1 and N-WASP to HSE was competed out by non-labeled competitor, indicating that the N-WASP·HSTF1 complex associates specifically with HSE (Fig. 5B).

In the nucleus, the protein complex that bound the HSE is known to contain HSTF1 (29). We found the protein complex contained N-WASP (Fig. 5C). In mobility-shift assays with nuclear extracts and HSE, a band shift was observed when anti-N-WASP antibody was added. This shift did not occur with non-immune antibody. These results indicate that N-WASP forms a complex on HSE that negatively regulates HSP90 expression.

To confirm the association between N-WASP and HSTF1 in cells, we immunoprecipitated FLAG-tagged Y253F or Y253E N-WASP and examined the association with HSTF1. As shown in Fig. 5D, Y253F N-WASP associated with HSTF1 more effectively than Y253E N-WASP did. This difference in the affinity seems to be consistent with the difference in the preference in nuclear localization, because localization of HSTF1 was not affected by N-WASP localization (data not shown).

N-WASP Indirectly Modulates Kinase Activity of Fyn—The activities of Src family kinases require HSP90. Thus, reduced phosphorylation of N-WASP might further decrease levels of HSP90, resulting in decreased activities of Src family kinases. Therefore, we examined the activity of Fyn in cells expressing wild-type N-WASP, Y253F N-WASP, or Y253E N-WASP. After immunoprecipitation of Fyn from cells, Fyn activity was examined with an in vitro kinase assay. Activity of Fyn was decreased in cells expressing Y253F N-WASP but not wild type or Y253E N-WASP (Fig. 6A).



View larger version (41K):
[in this window]
[in a new window]
  		FIG. 6.
Indirect effect of N-WASP on Fyn activity. A, localization of N-WASP in the nucleus decreases Fyn kinase activity. COS-7 cells were transfected with wild-type Fyn and GFP-tagged wild-type, Y253F, or Y253E N-WASP. Upper, after immunoprecipitation with anti-Fyn antibody, the amount of precipitated Fyn was analyzed by Western blotting. Lower, the kinase activity of the immunoprecipitated Fyn was analyzed with polyglutamine-tyrosine as substrate. B, N-WASP has no direct effect on Fyn kinase activity. Kinase activity of purified Fyn was examined in the presence or absence of N-WASP with polyglutamine-tyrosine as substrate. Upper, the amount of proteins used was examined by CBB staining. Middle, the phosphorylation of WT N-WASP, not of Y253F or Y253E N-WASP, by Fyn was confirmed by the autoradiography. Lower, the kinase activity of the Fyn was analyzed with polyglutamine-tyrosine as substrate. C, decreased formation of foci by cells expressing CA Fyn due to increased nuclear N-WASP. Transformation and focus formation by NIH-3T3 cells expressing CA Fyn were suppressed by co-expression of Y253F N-WASP but not wild-type or Y253E N-WASP. The cells were Giemsa-stained after 2 weeks of culture. D, amount of HSP90 in NIH-3T3 cells. Amount of HSP90 in NIH-3T3 cells expressing CA Fyn and Y253F, or Y253E N-WASP was examined by Western blotting after overnight culture followed by transfection. Amount of HSP90 in cells was examined by Western blotting. The ratio of HSP90 signals to actin signals are shown.

 

The decrease in Fyn activity is not due to a physical interaction between Y253F N-WASP with Fyn, because incubation of purified Fyn with purified Y253F N-WASP as well as wild-type and Y253E N-WASP did not affect the kinase activity of Fyn. Therefore, Y253F N-WASP appears to decrease Fyn activity by decreasing HSP90 levels (Fig. 6B).

N-WASP Phosphorylation Site Mutant Suppresses Transformation by Constitutively Active Fyn—To confirm the suppression of kinase activity of Fyn by Y253F N-WASP expression in vivo, we performed a focus assay for Fyn-mediated transformation of cells. When NIH-3T3 cells expressed CA Fyn, they transformed after 2 weeks culture as assayed by focus formation. In contrast, expression of DN Fyn did not induce focus formation.

Focus formation induced by CA Fyn was not affected by co-expression with wild-type N-WASP or Y253E N-WASP. In contrast, co-expression with Y253F N-WASP suppressed focus formation induced by CA Fyn (Fig. 6C), indicating the Y253F N-WASP indirectly reduces the kinase activity of Fyn. Actually, in NIH-3T3 cells, expression of Y253F N-WASP decreased the amount of HSP90, whereas expression of wild-type or Y253E N-WASP did not (Fig. 6D).

Therefore, N-WASP seems to regulate the activities of Src family kinases indirectly through regulation of HSP90 levels. When Src kinases are activated, N-WASP is phosphorylated and exported from the nucleus, which results in an increase in levels of HSP90. HSP90 holds Src family kinase activity. When Src family kinases are inactive, N-WASP is imported into the nucleus, which decreases HSP90 levels and further decreases the activity of Src family kinases. This feedback regulation by N-WASP might modulate the activities of Src family kinases.

Although N-WASP modulates transcription from the HSE, possibly through binding to HSTF, transcription of many other genes was affected by levels of nuclear N-WASP. Nuclear N-WASP might modulate general transcriptional activity by controlling nuclear factors such as actin-related proteins like SWI/SNF complex (30, 31), in a similar manner that N-WASP in the cytoplasm controls the actin cytoskeleton through Arp2/3 complex.


   FOOTNOTES
 
* This work was supported by grants-in-aid from the Ministry of Education, Culture, Sports, and Technology of Japan and from the Japan Science and Technology Corporation. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

{ddagger} To whom correspondence should be addressed. Tel.: 81-3-5449-5510; Fax: 81-3-5449-5417; E-mail: takenawa{at}ims.u-tokyo.ac.jp.

1 The abbreviations used are: WASP, Wiskott-Aldrich syndrome protein; N-WASP, neural WASP; HSP90, heat shock protein 90; HSE, heat shock element; HSTF/HSF, heat shock transcription factor/heat shock factor; Arp2/3, actin-related protein 2/3; GST, glutathione S-transferase; GFP, green fluorescent protein; VCA, verprolin-homology, cofilin-homology, and acidic domain; CA, constitutively active; DN, dominant negative; LMB, leptomycin B; NLS, nuclear localization signal; NES, nuclear export signal; CMV, cytomegalovirus; EF, elongation factor; EGF, epidermal growth factor; IQ motif, calmodulin binding motif; CRIB, Cdc42/Rac interactive binding. Back


   ACKNOWLEDGMENTS
 
We thank Drs. Hiroaki Miki, Tohru Tezuka, and Tadashi Yamamoto (Institute of Medical Science, University of Tokyo) for technical support and helpful discussions.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS AND DISCUSSION
 REFERENCES
 

  1. Derry, J. M., Ochs, H. D., and Francke, U. (1994) Cell 78, 635-644[CrossRef][Medline] [Order article via Infotrieve]
  2. Miki, H., Miura, K., and Takenawa, T. (1996) EMBO J. 15, 5326-5335[Medline] [Order article via Infotrieve]
  3. Miki, H., Suetsugu, S., and Takenawa, T. (1998) EMBO J. 17, 6932-6941[CrossRef][Medline] [Order article via Infotrieve]
  4. Suetsugu, S., Miki, H., and Takenawa, T. (1999) Biochem. Biophys. Res. Commun. 260, 296-302[CrossRef][Medline] [Order article via Infotrieve]
  5. Rohatgi, R., Ma, L., Miki, H., Lopez, M., Kirchhausen, T., Takenawa, T., and Kirschner, M. W. (1999) Cell 97, 221-231[CrossRef][Medline] [Order article via Infotrieve]
  6. Machesky, L. M., Mullins, R. D., Higgs, H. N., Kaiser, D. A., Blanchoin, L., May, R. C., Hall, M. E., and Pollard, T. D. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 3739-3744[Abstract/Free Full Text]
  7. Suetsugu, S., Miki, H., and Takenawa, T. (2002) Cell Motil. Cytoskeleton 51, 113-122[CrossRef][Medline] [Order article via Infotrieve]
  8. Takenawa, T., and Miki, H. (2001) J. Cell Sci. 114, 1801-1809[Abstract]
  9. Vetterkind, S., Miki, H., Takenawa, T., Klawitz, I., Scheidtmann, K. H., and Preuss, U. (2002) J. Biol. Chem. 277, 87-95[Abstract/Free Full Text]
  10. Miki, H., Sasaki, T., Takai, Y., and Takenawa, T. (1998) Nature 391, 93-96[CrossRef][Medline] [Order article via Infotrieve]
  11. Rohatgi, R., Ho, H. Y., and Kirschner, M. W. (2000) J. Cell Biol. 150, 1299-1310[Abstract/Free Full Text]
  12. Prehoda, K. E., Scott, J. A., Mullins, D. R., and Lim, W. A. (2000) Science 290, 801-806[Abstract/Free Full Text]
  13. Higgs, H. N., and Pollard, T. D. (2000) J. Cell Biol. 150, 1311-1320[Abstract/Free Full Text]
  14. Brown, M. T., and Cooper, J. A. (1996) Biochim. Biophys. Acta 1287, 121-149[Medline] [Order article via Infotrieve]
  15. Thomas, S. M., and Brugge, J. S. (1997) Annu. Rev. Cell Dev. Biol. 13, 513-609[CrossRef][Medline] [Order article via Infotrieve]
  16. Harris, K. F., Shoji, I., Cooper, E. M., Kumar, S., Oda, H., and Howley, P. M. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 13738-13743[Abstract/Free Full Text]
  17. Oda, H., Kumar, S., and Howley, P. M. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 9557-9562[Abstract/Free Full Text]
  18. Hakak, Y., and Martin, G. S. (1999) Curr. Biol. 9, 1039-1042[CrossRef][Medline] [Order article via Infotrieve]
  19. Uehara, Y., Hori, M., Takeuchi, T., and Umezawa, H. (1986) Mol. Cell Biol. 6, 2198-2206[Abstract/Free Full Text]
  20. Whitesell, L., Mimnaugh, E. G., De Costa, B., Myers, C. E., and Neckers, L. M. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 8324-8328[Abstract/Free Full Text]
  21. Suetsugu, S., Hattori, M., Miki, H., Tezuka, T., Yamamoto, T., Mikoshiba, K., and Takenawa, T. (2002) Dev. Cell 3, 645-658[CrossRef][Medline] [Order article via Infotrieve]
  22. Suetsugu, S., Miki, H., and Takenawa, T. (1998) EMBO J. 17, 6516-6526[CrossRef][Medline] [Order article via Infotrieve]
  23. Phimister, B. (1999) Nat. Genet. 22, 318[CrossRef][Medline] [Order article via Infotrieve]
  24. Fukami, K., Takenaka, K., Nagano, K., and Takenawa, T. (2000) Eur. J. Biochem. 267, 28-36[Medline] [Order article via Infotrieve]
  25. Suetsugu, S., Miki, H., Yamaguchi, H., Obinata, T., and Takenawa, T. (2001) J. Cell Sci. 114, 4533-4542[Medline] [Order article via Infotrieve]
  26. Wen, W., Meinkoth, J. L., Tsien, R. Y., and Taylor, S. S. (1995) Cell 82, 463-473[CrossRef][Medline] [Order article via Infotrieve]
  27. Wolff, B., Sanglier, J. J., and Wang, Y. (1997) Chem. Biol. 4, 139-147[CrossRef][Medline] [Order article via Infotrieve]
  28. Nakai, A., and Ishikawa, T. (2001) EMBO J. 20, 2885-2895[CrossRef][Medline] [Order article via Infotrieve]
  29. Xiao, H., and Lis, J. T. (1988) Science 239, 1139-1142[Abstract/Free Full Text]
  30. Peterson, C. L., Zhao, Y., and Chait, B. T. (1998) J. Biol. Chem. 273, 23641-23644[Abstract/Free Full Text]
  31. Cairns, B. R., Erdjument-Bromage, H., Tempst, P., Winston, F., and Kornberg, R. D. (1998) Mol. Cell 2, 639-651[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Cell Sci.Home page
Y. Wang, N. Kakinuma, Y. Zhu, and R. Kiyama
Nucleo-cytoplasmic shuttling of human Kank protein accompanies intracellular translocation of {beta}-catenin
J. Cell Sci., October 1, 2006; 119(19): 4002 - 4010.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
E. Torres and M. K. Rosen
Protein-tyrosine Kinase and GTPase Signals Cooperate to Phosphorylate and Activate Wiskott-Aldrich Syndrome Protein (WASP)/Neuronal WASP
J. Biol. Chem., February 10, 2006; 281(6): 3513 - 3520.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. J. Shapiro, Y.-Y. Chen, and V. S. Shapiro
The Carboxyl-terminal Segment of the Adaptor Protein ALX Directs Its Nuclear Export during T Cell Activation
J. Biol. Chem., November 18, 2005; 280(46): 38242 - 38246.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
D. E. Saslowsky, U. Warek, and B. S. J. Winkel
Nuclear Localization of Flavonoid Enzymes in Arabidopsis
J. Biol. Chem., June 24, 2005; 280(25): 23735 - 23740.
[Abstract] [Full Text] [PDF]

Home page
 J. Cell Biol.Home page
G. Bompard and E. Caron
Regulation of WASP/WAVE proteins: making a long story short
J. Cell Biol., September 27, 2004; 166(7): 957 - 962.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. Kanzaki, M. Furukawa, W. Raab, and J. E. Pessin
Phosphatidylinositol 4,5-Bisphosphate Regulates Adipocyte Actin Dynamics and GLUT4 Vesicle Recycling
J. Biol. Chem., July 16, 2004; 279(29): 30622 - 30633.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
A. Echarri, M. J. Lai, M. R. Robinson, and A. M. Pendergast
Abl Interactor 1 (Abi-1) Wave-Binding and SNARE Domains Regulate Its Nucleocytoplasmic Shuttling, Lamellipodium Localization, and Wave-1 Levels
Mol. Cell. Biol., June 1, 2004; 24(11): 4979 - 4993.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
M. E. Ward, J. Y. Wu, and Y. Rao
From the Cover: Visualization of spatially and temporally regulated N-WASP activity during cytoskeletal reorganization in living cells
PNAS, January 27, 2004; 101(4): 970 - 974.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/43/42515    most recent
M302177200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Suetsugu, S.
Right arrow Articles by Takenawa, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Suetsugu, S.
Right arrow Articles by Takenawa, T.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH