JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M307318200 on August 19, 2003

J. Biol. Chem., Vol. 278, Issue 44, 43654-43662, October 31, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/44/43654    most recent
M307318200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wen, R.
Right arrow Articles by Wang, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wen, R.
Right arrow Articles by Wang, D.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Phospholipase C{gamma}2 Provides Survival Signals via Bcl2 and A1 in Different Subpopulations of B Cells*

Renren Wen{ddagger}, Yuhong Chen{ddagger}§, Liquan Xue¶, James Schuman{ddagger}, Shoua Yang{ddagger}, Stephan W. Morris¶, and Demin Wang{ddagger}§||**

From the {ddagger}Blood Research Institute, the Blood Center of Southeastern Wisconsin, Milwaukee, Wisconsin 53226, the Department of Pathology, St Jude Children's Research Hospital, Memphis, Tennessee 38105, the §Model Animal Research Center, the Institute of Molecular Medicine, Nanjing University, Nanjing, Peoples Republic of China, and the ||Department of Microbiology and Molecular Genetics, Medical College of Wisconsin, Milwaukee, Wisconsin 53226

Received for publication, July 8, 2003


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
PLC{gamma}2 plays a critical role in B cell receptor (BCR) signaling and its targeted deletion results in defective B cell development and function. Here, we show that PLC{gamma}2 deficiency specifically blocks B cell maturation at the transitional type 2 (T2) to follicular (FO) B cell transition and the PLC{gamma}2 pathway regulates survival of B cells. BCR-induced apoptosis is dramatically enhanced in all subsets of splenic PLC{gamma}2-deficient B cells, especially in T2 and FO B cell subpopulations. We also find that all splenic PLC{gamma}2-deficient B cell subpopulations express abnormally low levels of Bcl-2 protein. In addition, PLC{gamma}2 deficiency disrupts BCR-mediated induction of A1 expression. Enforced expression of Bcl-2 prevents BCR-induced apoptosis in all splenic PLC{gamma}2-deficient B cell subpopulations and partially restores the numbers of PLC{gamma}2-deficient FO B cells. In contrast to Bcl-2, enforced expression of A1 preferentially prevents BCR-induced apoptosis in PLC{gamma}2-deficient FO B cells and partially restores the numbers of these B cells. Therefore, the PLC{gamma}2 pathway provides a survival signal via regulation of Bcl-2 in all splenic B cell subpopulations and via additional induction of A1 in mature FO B cells.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Immature B cells from the bone marrow emerge into the spleen as transitional B cells of type 1 (T1).1 T1 B cells develop into transitional B cells of type 2 (T2). Ultimately, T2 B cells give rise to two subsets of long lived mature B cells, called follicular (FO) B cells and marginal zone (MZ) B cells (1, 2). Signals from the BCR are required for the maturation of newly formed immature B cells in the spleen (3–7) and disruption of BCR function leads to a severe block in the generation of peripheral B cells (1, 8, 9). In addition, the BCR provides a survival signal to maintain the long lived mature B cells in the periphery, with inducible ablation of BCR expression in mice leading to rapid loss of mature B cells (10). In addition to providing a survival signal, the BCR can also initiate apoptosis. In immature B cells, binding of self-antigens to surface IgM induces cell apoptosis, thus enabling negative selection to remove self-reactive cells (11–14). Ultimately, BCR-bearing immature B cells that survive the negative selection process emerge into the periphery and continue the maturation process in the spleen. Moreover, hypercross-linking of the BCR triggers apoptosis in mature B cells to down-regulate the immune response and maintain homeostasis (15–17). Therefore, highly regulated B cell apoptosis plays a critical role in B cell development, in the depletion of self-reactive cells, in the down-regulation of immune responses, and in maintenance of the long lived mature B cells.

The intracellular pathways from the BCR that regulate B cell survival and apoptosis are not fully understood. The BCR is associated with the immunoreceptor tyrosine-based activation motif (ITAM)-containing transmembrane molecules, Ig{alpha} and Ig{beta}, to transduce signals (18). Three distinct types of cytoplasmic protein tyrosine kinases, Src kinases (Lyn, Blk, and Fyn), Btk, and Syk, are involved in BCR signaling (18). In addition, the adapter protein, B cell linker protein (BLNK), and phosphoinositide 3-kinase (PI3K) are included in the signaling cascade. Tyrosine-phosphorylated BLNK and membrane phospholipids modified by PI3K are essential for recruiting down-stream signaling molecules, including PLC{gamma} (18). The importance of these signaling molecules in BCR signaling has been illustrated by gene-targeted disruption studies. Lyn-deficient mice have an impairment in late B cell development (19, 20). Syk-deficient mice have a blockade in early B cell development at the pro-B to pre-B cell transition (21, 22). In contrast, Btk-(23, 24) or BLNK-deficient mice (25, 26) have severely impaired late B cell development but no impairment at the pro-B to pre-B transition. Importantly, deficiencies of these molecules all result in increased BCR-induced apoptosis (27–29). Nevertheless, the mechanism by which the BCR regulates B cell apoptosis via these molecules is not clear.

The initial signaling cascade activated by the BCR ultimately leads to activation of several pathways, including that of phospholipase C{gamma} (PLC{gamma}). PLC{gamma} has two isoforms, {gamma}1 and {gamma}2. In B cells, PLC{gamma}2 is the predominant PLC{gamma} isoform, and it is activated by BCR engagement (30, 31). Upon activation, PLC{gamma}2 hydrolyzes PIP2 to generate diacylglycerol (DAG) and inositol phosphates including inositol 1,4,5-trisphosphate (IP3) (32). DAG activates protein kinase C (PKC) and IP3 mediates calcium mobilization from internal calcium stores. The elevated intracellular Ca2+ concentration leads to activation of the phosphatase, calcineurin (32). The important physiological role of PLC{gamma}2 has been elucidated by our recent studies of PLC{gamma}2-deficient mice (33). Disruption of the PLC{gamma}2 gene leads to a number of defects in signaling through the BCR (33). The mutant mice have profoundly impaired late B cell development at the immature to mature B cell transition and disrupted B cell function, resulting in xid-like immunodeficiency. However, the mechanism by which the PLC{gamma}2 pathway could regulate the B cell development is unknown. We show here that the PLC{gamma}2 pathway provides essential signals for the T2 to FO B cell transition and regulates cell survival. PLC{gamma}2 regulates cell survival of different splenic subpopulations via distinct anti-apoptotic molecules, Bcl-2 and A1.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Flow Cytometry—Spleen and bone marrow cells were made into single cell suspensions in PBS supplemented with 2% bovine serum albumin. The cells were then stained with a mixture of mAbs conjugated to fluorescein isothiocyanate (FITC), phycoerythrin (PE), Cychrome, or biotin. The stained cells were analyzed in a BD Biosciences FACScan in three-color mode using CellQuestTM software. FITC-conjugated anti-IgD, FITC-conjugated CD21, PE-conjugated anti-CD43, PE-conjugated, or Cy-chrome-conjugated anti-B220, and biotin-conjugated CD23 were all purchased from Pharmingen, San Diego, CA. Both FITC- and PE-conjugated anti-IgM antibodies were purchased from Southern Biotechnology, Birmingham, AL.

Total Splenic B Cell Purification—Single cell suspensions of splenocytes from wild-type or mutant mice were treated with Gey's solution to lyse red blood cells and were stained with PE-conjugated anti-B220 antibodies. B220 positive B cells were purified by FACS sorting. The resulting purified B cells were suspended in medium consisting of RPMI 1640, 0.1 mM non-essential amino acids, 1 mM sodium pyruvate, 5 x 10-5 M 2-mercaptoethnol, 100 units/ml penicillin, 100 µg/ml streptomycin, 2 mM glutamine (all from Invitrogen), and 10% heat-inactivated fetal bovine serum (HyClone).

FACS Analyses of Bcl-2 Expression—FACS analysis of Bcl-2 expression was performed as described previously (34). Briefly, single cell suspensions of splenocytes were prepared and stained with FITC-conjugated anti-IgM antibody and Cychrome-conjugated anti-IgD antibody (BD PharMingen) at 4 °C for 30 min. Then, the cells were washed with PBS and fixed on ice for 15 min in 1% paraformaldehyde (Ted Pella, Inc.). Afterward, the cells were washed once with PBS and incubated with a hamster anti-Bcl-2 antibody (15021A; BD PharMingen) in PBS-5% bovine serum albumin-0.05% saponin (Sigma). The cells were washed twice, followed by incubation with PE-conjugated anti-hamster (Southern Biotechnology Inc.) on ice for 30 min. Then, the cells were washed and analyzed by FACScan (BD PharMingen). Bcl-2-null spleens have demonstrated the specificity of the anti-Bcl-2 antibody (34). Isotype-matched control antibodies, purified hamster IgG (BD PharMingen) served as negative controls.

Western Blotting—For immunoblots of Bcl-2, purified B cells (5 x 106) were stimulated with anti-IgM antibody (10 µg/ml) for 2, 6, and 10 h. Cells were collected, washed once in PBS, and cell pellets were snap frozen in liquid nitrogen. Frozen pellets were lysed on ice in RIPA buffer-containing protease inhibitors (phenylmethylsulfonyl fluoride, pepstatin, aprotinin, leupeptin). Cell lysates were clarified by centrifugation and immediately boiled for 5 min in SDS sample buffer. 40 µg of whole cell extracts were used to perform immunoblots. Antibodies used included anti-mouse Bcl-2 (15021, BD PharMingen) and anti-actin (Roche Applied Science).

FACS Analysis of Apoptosis (TUNEL)—The total splenic B cells or subsets of splenic B cells, purified by FACS sorting, were stimulated with anti-IgM at 10 µg/ml. At different time points, cells were collected for TUNEL-based apoptosis analysis. Collected cells were fixed, permeabilized, and labeled according to the manufacturer's instructions (In Situ Cell Death Detection kit, Roche Applied Science). After washing, the cells were analyzed by FACScan.

Semiquantitative RT-PCR Analysis—Purified total splenic B cells (5 x 106) were stimulated with anti-IgM antibody (10 µg/ml) for 2, 6, and 10 h. Total RNA was prepared from cells by RNAzol B (Tel-Test, Inc) and first-strand cDNA was synthesized from total RNA with the Gene Amp RT-PCR kit (PerkinElmer Life Sciences). Semiquantitative RT-PCR analysis was performed to analyze A1 and actin gene expression using the following primers: A1, forward TGCCAGGGAAGATGGCTGAG and reverse TCCGTAGTGTTACTTGAGGAG; actin, forward ACTCCTATGTGGGTGACGAG and reverse CAGGTCCAGACGCAGGATGGC. Actin was used as a RNA level control.

Retroviral Transduction and Bone Marrow Transplantation—The human Bcl-2 gene or rat PLC{gamma}2 gene were cloned into a bicistronic retrovirus MSCV-IRES-GFP (MSCV-I-GFP) vector (35). The expression of the cloned gene and GFP is under control of the murine stem cell promoter (MSCV). GFP serves as a marker for the identification of retrovirally transduced cells. Conditioned media containing high titer, amphotropic retrovirus particles were derived by cotransfection of 293T cells with the retrovirus vector expressing the cloned gene and GFP and a helper plasmid, pEQPAM3, containing the required gag, pol, and env retroviral genes driven by a Moloney leukemia virus LTR. These media were filtered and used to transduce ecotropic packaging cells GP+E86 with 6 µg/ml polybrene (Sigma) a total of six times over 3 days. The highest expressing GFP cells were sorted under sterile conditions and subsequently expanded as virus-producing cells.

Murine bone marrow cells were transduced by retrovirus as follows: PLC{gamma}2-deficient mice (8–12 weeks old) were injected intraperitoneally with 150 mg/kg of 5-fluorouracil 48 h before bone marrow harvest. Bone marrow was isolated from both hind limbs and pre-stimulated with 20 ng/ml murine IL3, 50 ng/ml human IL6 and 50 ng/ml rat stem cell factor (SCF) for 48 h. Cells were then co-cultured on irradiated ecotropic producer cells (GP+E86) in the presence of IL3, IL6, SCF and polybrene (6 µg/ml). After 48 h, 2 to 5 x 106 nucleated bone marrow cells were injected via tail vein injection into sublethally irradiated recipient JAK3-deficient mice (900 rads). Four weeks later, the development of B cells was analyzed through FACS and functions of B cells from the peripheral blood and spleen in bone marrow transplanted mice were examined.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
PLC{gamma}2 Deficiency Specifically Blocks B Cell Maturation at the T2 to FO B Cell Transition—One of the most prominent defects in PLC{gamma}2-deficient B cells is failure in the development of the most mature B cell population (B220+IgMlow) (33). In this report, we more precisely defined the stage at which B cell maturation was blocked by PLC{gamma}2 deficiency. Splenocytes can be stained with anti-IgM, anti-CD21, and anti-CD23 and separated into CD23+ and CD23- cells to define the different B cell subsets of newly formed immature B cells (36). CD23+ cells include CD21highIgMhigh T2 B cells and CD21intIgMlow mature FO B cells. CD23- B cells include CD21lowIgMhigh T1 B cells and CD21highIgMhigh MZ B cells. PLC{gamma}2-deficient mice had dramatically decreased FO B cells (CD23+CD21intIgMlow) and slightly increased T2 B cells (CD23+CD21highIgMhigh) in both percentages and absolute numbers relative to wild-type mice (Fig. 1A and Table I). In contrast, PLC{gamma}2-deficient and wild-type mice had comparable percentages and numbers of T1 (CD23-CD21lowIgMhigh) and MZ (CD23-CD21highIgMhigh) B cells (Fig. 1A and Table I). Based on expression of IgD and IgM, splenocytes can be separated into IgMhighIgD- (T1), IgMhigh IgDhigh (T2), and IgMlowIgDhigh (FO) B cells (1). Splenocytes derived from PLC{gamma}2-deficient mice had significant reduction of IgMlowIgDhigh FO mature B cells relative to those derived from wild-type mice (Fig. 1B), consistent with the CD21/CD23/IgM-staining results (Fig. 1A). Therefore, PLC{gamma}2 deficiency specifically blocks B cell maturation at the T2 to FO B cell transition.



View larger version (41K):
[in this window]
[in a new window]
  		FIG. 1.
Dramatic reduction of mature FO B cells in PLC{gamma}2-deficient mice. A, splenocytes from wild-type (+/+) and PLC{gamma}2-deficient (-/-) mice were stained with antibodies to IgM, CD21, and CD23, and separated into CD23+ and CD23- cells. CD23+ cells include CD21highIgMhigh T2 B cells and CD21intIgMlow mature FO B cells. CD23- B cells include CD21lowIgMhigh T1 B cells and CD21highIgMhigh MZ B cells. T1, T2, FO, and MZ B cell populations are indicated, and the numbers indicate the percentage of the gated cells within lymphoid cells. The figure shown is representative of six independent analyses. B, splenocytes from wild-type (+/+) and PLC{gamma}2-deficient (-/-) mice were stained with antibodies to IgM and IgD and separated into IgMhighIgD- T1 B cells, IgMhigh IgDhigh T2, and IgMlowIgDhigh FO mature B cells. T1, T2, FO, and MZ B cell populations are indicated, and the numbers indicate the percentage of the gated cells within lymphoid cells. The figure shown is representative of twelve independent analyses.

 

View this table:
[in this window]
[in a new window]
  		TABLE I
T1, T2, FO, and MZ B cells in wild-type and PLC{gamma}2-deficient mice The B cell subsets were determined by staining with antibodies to IgM, D21, and CD23. The numbers of each subset B cells and their percentages in gated live lymphocytes were determined for each mouse, and the mean value and S.D. were calculated (n = 6).

 

BCR-mediated Apoptosis Is Dramatically Increased at All Stages, Especially at T2 and FO Stages, of PLC{gamma}2-deficient B Cells—Apoptosis plays an essential role in B cell development (7). Ligation of the BCR induces apoptosis in B cells, leading to elimination of self-reactive B cells during B cell development and of antigen-responsive B cells after induction of an immune response (11–14). To determine the effect of PLC{gamma}2 deficiency on BCR-induced apoptosis, purified splenic B cells derived from wild-type or PLC{gamma}2-deficient mice were stimulated with anti-IgM, and subsequently analyzed for apoptosis by TUNEL assay. As expected, anti-IgM induced apoptosis in wild-type B cells (30% at 24 h) (14, 37); however, in PLC{gamma}2-deficient B cells, BCR-induced apoptosis was dramatically enhanced (65% at 24 h) (Fig. 2A). Nonetheless, the enhanced BCR-induced apoptosis could be due to increased proportion of T2 B cells to mature FO B cells in the PLC{gamma}2-deficient splenic B cell population. To exclude this possibility, we further examined BCR-induced apoptosis in FACS-sorted subsets of PLC{gamma}2-deficient B cells. Although both wild-type and PLC{gamma}2-deficient T1 B cells were prone to BCR-induced apoptosis, PLC{gamma}2-deficient T1 B cells died faster (Fig. 2B). In addition, BCR-induced apoptosis was dramatically enhanced in PLC{gamma}2-deficient T2 (79% at 24 h) and FO (50% at 24 h) B cells relative to wild-type T2 (28% at 24 h) and FO (20% at 24 h) B cells (Fig. 2B). Thus, PLC{gamma}2 plays an important role in preventing BCR-mediated apoptosis at all stages, especially at the T2 and FO stages, of B cell maturation.



View larger version (33K):
[in this window]
[in a new window]
  		FIG. 2.
BCR-induced apoptosis in wild-type and PLC{gamma}2-deficient B cells. A, purified splenic B cells from wild-type (+/+) and PLC{gamma}2-deficient (-/-) mice were stimulated with anti-IgM. At the indicated time points, the degree of apoptosis was determined by TUNEL assays with the In Situ Cell Death Detection kit. B, splenic B cells from wild-type (+/+) and PLC{gamma}2-deficient (-/-) mice were sorted into T1, T2, and FO subsets based on IgM/IgD expression, and subsequently stimulated with anti-IgM. At the indicated time points, the degree of apoptosis was determined by TUNEL assays. The figure shown is representative of three independent analyses.

 

PLC{gamma}2-deficient B Cells Express Low Levels of Bcl-2 Protein—Bcl-2 family members play essential roles in maintaining cell survival during B cell development. Bcl-2-deficient mice have decreased mature B cells and B cell precursors due to enhanced apoptosis (38, 39). The ability of Bcl-2 molecule to support cell survival is largely dependent on its level of expression. Therefore, Bcl-2 expression was compared in wild-type and PLC{gamma}2-deficient T1 (IgMhighIgD-), T2 (IgMhighIgDhigh), and FO (IgMlowIgDhigh) B cells by intracellular staining with Bcl-2-specific antibodies. As shown in Fig. 3A, the level of Bcl-2 protein was significantly decreased in all three PLC{gamma}2-deficient splenic subpopulations relative to their wild-type counterparts whereas Bcl-2 levels were similar in both wild-type and PLC{gamma}2-deficient IgM-IgD- lymphocytes (mainly T lymphocytes) (Fig. 3A). To confirm this observation and to test whether the expression of Bcl-2 family members is dependent upon PLC{gamma}2 activation, we assessed the level of Bcl-2 protein in wild-type and PLC{gamma}2-deficient B cells before and after BCR engagement by Western blot analysis. The level of Bcl-2 protein was obviously decreased in PLC{gamma}2-deficient B cells compared with wild-type B cells without BCR engagement (Fig. 3B), consistent with the intracellular-staining results (Fig. 3A). Strikingly, the level of Bcl-2 protein was further dramatically decreased following BCR engagement in PLC{gamma}2-deficient B cells relative to wild-type B cells (Fig. 3B). Therefore, PLC{gamma}2 deficiency leads to a reduction of Bcl-2 expression during B cell maturation.



View larger version (22K):
[in this window]
[in a new window]
  		FIG. 3.
Expression of Bcl-2 in wild-type and PLC{gamma}2-deficient B cells. A, expression of Bcl-2 in splenic subpopulations of wild-type and PLC{gamma}2-deficient B cells. Splenocytes from wild-type and PLC{gamma}2-deficient mice were stained with antibodies to IgM and IgD. Then, the cells were fixed, permeabilized, stained with antibodies to Bcl-2, and separated into IgMhighIgD- (T1) B cells, IgMhighIgDhigh (T2) B cells, IgMlowIgDhigh (FO) B cells, and IgM-IgD- non-B cells. Histograms depict the labeling intensity of the three subpopulations of wild-type or PLC{gamma}2-deficient splenic B cells stained with an isotype-matched control antibody (broken black line for wild-type; broken green line for PLC{gamma}2-deficient cells), or anti-Bcl-2 antibody (solid black line for wild-type; solid green line for PLC{gamma}2-deficient cells). The figure shown is representative of three independent analyses. B, protein levels of Bcl-2 in wild-type and PLC{gamma}2-deficient B cells after BCR ligation. Purified wild-type (+/+) and PLC{gamma}2-deficient (-/-) splenic B cells were stimulated with anti-IgM for 0, 2, 6, and 10 h. Direct Western was performed on cell lysates with anti-Bcl-2 ({alpha}-Bcl-2) or anti-actin ({alpha}-Actin) antibodies.

 

PLC{gamma}2-deficient B Cells Fail to Induce A1 Expression Following BCR Ligation—The severely impaired B cell maturation of PLC{gamma}2-deficient B cells and the relatively normal B cell maturation in Bcl-2-deficient B cells (38, 39) suggest that, in addition to maintaining Bcl-2 protein levels, PLC{gamma}2 may regulate another anti-apoptotic molecule during B cell development. To identify additional downstream targets of PLC{gamma}2 that regulate B cell apoptosis, we employed the non-biased DNA microarray-based expression profiling approach. Total RNA was isolated from wild-type and PLC{gamma}2-deficient splenic B cells before and 1 h after anti-IgM stimulation. Affymetrix GeneChip Murine 19K arrays containing greater than 19,000 clustered murine EST transcripts were used to determine relative transcript levels in each of the RNA preparations. Each gene was represented in the array by 16 perfectly matched probes and 16 mismatched control probes that contain a single central-base mismatch. The average of the differences (perfect match minus mismatch) for each probe family was calculated to determine RNA abundance. A1, a prosurvival member of the Bcl-2 family (40), was identified among a number of genes that were induced upon BCR ligation in wild-type, but not PLC{gamma}2-deficient, B cells. Normally, A1 is rapidly induced following BCR engagement in T2 and FO mature B cells (41). Failure of PLC{gamma}2-deficient B cells to induce A1 expression following BCR ligation was confirmed by RT-PCR analysis (Fig. 4A). Therefore, induction of A1 expression following BCR engagement is dramatically impaired in PLC{gamma}2-deficient relative to wild-type B cells.



View larger version (31K):
[in this window]
[in a new window]
  		FIG. 4.
The BCR-mediated induction of A1 and activation of NF-{kappa}B in wild-type and PLC{gamma}2-deficient B cells. A, induction of A1. Purified wild-type (+/+) and PLC{gamma}2-deficient (-/-) splenic B cells were stimulated with anti-IgM for 0, 2, 6, and 10 h. Cells were collected and total RNA was prepared. Semiquantitative RT-PCR analysis was performed to examine mRNA levels of A1. Actin was used as RNA level control. B, activation of NF-{kappa}B. Nuclear extracts were prepared from purified wild-type (+/+) and PLC{gamma}2-deficient (-/-) B cells unstimulated (-) or stimulated with {alpha}-IgM ({alpha}IgM). Gel mobility shift assays were performed using radiolabled probes containing NF-kB binding sequences. Supershift was performed with {alpha}-p50 antibody ({alpha}IgM + {alpha}p50) or normal rabbit serum ({alpha}IgM + NRS). Cold unlabled probes were used as competitors ({alpha}IgM + comp). C, nuclear translocation of c-Rel. Purified wild-type (+/+) and PLC{gamma}2-deficient (-/-) B cells were stimulated with {alpha}-IgM for 0, 0.5, 1, 2, and 9 h. Direct Western was performed on nuclear extracts with {alpha}-c-Rel or {alpha}-actin.

 

Previous studies have demonstrated that BCR-mediated induction of A1 is regulated by NF-{kappa}B transcription factors (42). Thus, the mechanism by which the PLC{gamma}2 pathway induces A1 expression is quite possibly via NF-{kappa}B transcription factors. Therefore, we examined activation of NF-{kappa}B in wild-type and PLC{gamma}2-deficient B cells after BCR ligation. Anti-IgM stimulation dramatically induced NF-{kappa}B complex formation over background in wild-type B cells, whereas it failed to increase NF-{kappa}B complex formation in PLC{gamma}2-deficient B cells, which had comparable levels of NF-{kappa}B complex before and after anti-IgM stimulation (Fig. 4B). A supershift with anti-p50 antibody demonstrated that the NF-{kappa}B complex contained the p50 component of NF-{kappa}B (Fig. 4B). In addition, BCR ligation induced the nuclear translocation of c-Rel in wild-type B cells but not in PLC{gamma}2-deficient B cells (Fig. 4C). These data demonstrate that NF-{kappa}B transcription factors are downstream targets of PLC{gamma}2.

Enforced Bcl-2 Expression Promotes Survival of All Three PLC{gamma}2-deficient Splenic Subpopulations and Partially Restores Numbers of PLC{gamma}2-deficient Mature FO B Cells—To provide better evidence that the increased BCR-mediated apoptosis and impaired maturation of PLC{gamma}2-deficient B cells is in part a consequence of low levels of Bcl-2, we assessed whether enforced expression of Bcl-2 could rescue survival, proliferation, and maturation of PLC{gamma}2-deficient B cells. The Bcl-2 molecule was transduced into PLC{gamma}2-deficient bone marrow cells using a retrovirus that also expresses GFP by an internal ribosome entry site (IRES). In addition, PLC{gamma}2-transduced PLC{gamma}2-deficient bone marrow cells were used as a positive control in these experiments. We utilized bone marrow reconstitution (35) to efficiently transfer genes into PLC{gamma}2-deficient bone marrow cells, because of technical difficulties in achieving a high-level of gene transfer into primary murine B cells. Retrovirally transduced, PLC{gamma}2-deficient bone marrow cells were transplanted into sublethally irradiated JAK3-deficient mice, which lack B cells (43, 44); therefore, no endogenous B cells in JAK3-deficient recipient mice could interfere with the analysis of repopulated B cells derived from the transduced bone marrow. Re-population of the B cell lineage in JAK3-deficient recipient mice was assessed by the presence of B220-positive cells in the periphery and the efficiency of gene transfer was assessed by the presence of GFP-positive B cells. BCR-induced proliferation and apoptosis of GFP-positive B cell subsets were examined by assessment of [3H]thymidine incorporation and by TUNEL assay, respectively. Both PLC{gamma}2-transduced PLC{gamma}2-deficient transitional (IgMhigh: T1 and T2) and mature (IgMlow: FO) B cell subpopulations underwent BCR-induced apoptosis (Fig. 5, third column) and proliferation (not shown) to the same extent as did GFP-transduced wild-type B cell subpopulations (Fig. 5, first column). By comparison, GFP-transduced PLC{gamma}2-deficient B cell subpopulations still had dramatically increased BCR-induced apoptosis (Fig. 5, second column). Interestingly, both Bcl-2-transduced, PLC{gamma}2-deficient transitional and mature B cell subpopulations were resistant to BCR-induced apoptosis (Fig. 5, fourth column), yet failed to proliferate in response to BCR activation (not shown). Therefore, PLC{gamma}2 regulates cell survival and proliferation by different pathways, and expression of Bcl-2 prevents BCR-induced apoptosis. Moreover, the mature FO (IgMlowIgDhigh) population was partially developed in JAK3-deficient mice transplanted with Bcl-2-transduced PLC{gamma}2-deficient bone marrow (Fig. 6, fourth panel) relative to the JAK3-deficient mice transplanted with either GFP-transduced wild-type bone marrow (Fig. 6, first panel) or PLC{gamma}2-transduced PLC{gamma}2-deficient bone marrow (Fig. 6, third panel). By contrast, control JAK3-deficient mice receiving GFP-transduced PLC{gamma}2-deficient bone marrow had few mature FO B cells (Fig. 6, second panel). Therefore, expression of Bcl-2 appears to provide a survival signal for transitional (T1 and T2) cells to mature and/or for maintenance of mature FO B cells.



View larger version (47K):
[in this window]
[in a new window]
  		FIG. 5.
Restoration of survival of all subsets of PLC{gamma}2-deficient splenic B cells upon BCR ligation by enforced expression of Bcl-2 whereas preferential restoration of survival of PLC{gamma}2-deficient mature FO B cells upon BCR ligation by enforced expression of A1. Sublethally irradiated JAK3-deficient mice were reconstituted with wild-type BM transduced with a GFP containing retroviral vector (WT + GFP), PLC{gamma}2-deficient BM transduced with a GFP-containing retroviral vector (PLC{gamma}2-/- + GFP), PLC{gamma}2-deficient BM transduced with a GFP- and PLC{gamma}2 containing retroviral vector (PLC{gamma}2-/- + PLC{gamma}2), PLC{gamma}2-deficient BM transduced with a GFP- and Bcl-2-containing retroviral vector (PLC{gamma}2-/- + Bcl-2), or PLC{gamma}2-deficient BM transduced with a GFP- and A1-containing retroviral vector (PLC{gamma}2-/- + A1). Two months after the reconstitution, GFP+/B220+, GFP+/IgMhigh, or GFP+/IgMlow cells were sorted from splenocytes of the JAK3-deficient recipient mice. GFP+/B220+ were analyzed for apoptosis by TUNEL assays without anti-IgM stimulation (0 h time point). Sorted GFP+/IgMhigh or GFP+/IgMlow cells were stimulated with anti-IgM. At the indicated time points, cells were analyzed for apoptosis by TUNEL assays. B220+ cells contain all subsets of splenic B cells. IgMhigh cells contain transitional B cells (T1 and T2) whereas IgMlow contain mature B cells (FO). The figure shown is representative of six independent analyses.

 


View larger version (27K):
[in this window]
[in a new window]
  		FIG. 6.
Partial restoration of PLC{gamma}2-deficient mature FO B cell development by enforced expression of Bcl-2 or A1. JAK3-deficient mice were reconstituted with wild-type BM transduced with a GFP-containing retroviral vector (WT + GFP) or PLC{gamma}2-deficient BM transduced with a GFP-containing retroviral vector (PLC{gamma}2-/- + GFP), with a GFP- and PLC{gamma}2-containing retroviral vector (PLC{gamma}2-/- + PLC{gamma}2), with a GFP- and Bcl-2-containing retroviral vector (PLC{gamma}2-/- + Bcl-2), or with a GFP- and A1-containing retroviral vector (PLC{gamma}2-/- + A1). Two months after the reconstitution, splenocytes derived from the recipient mice were stained with antibodies to IgM and IgD. GFP positive lymphocytes were gated and analyzed. IgMhighIgD- cells include T1 B cells, IgMhighIgDhigh cells contain T2 B cells, and IgMhighIgDlow cells contain mature FO B cells. The percentages of cells in gated GFP+ cells are indicated. The figure shown is representative of six independent analyses.

 

Enforced Expression of A1 Preferentially Promotes Survival of PLC{gamma}2-deficient FO Mature B Cells and Partially Restores Numbers of PLC{gamma}2-deficient Mature FO B Cells—To determine the role of A1 expression induced by PLC{gamma}2-mediated signals during B cell maturation, we assessed whether enforced expression of A1 could rescue survival and maturation of PLC{gamma}2-deficient B cells. The A1 gene was transduced into PLC{gamma}2-deficient bone marrow cells with a retrovirus that also expresses GFP, as described above. GFP-transduced wild-type or PLC{gamma}2-transduced PLC{gamma}2-deficient bone marrow cells were transplanted into sublethally irradiated JAK3-deficient mice as positive controls, whereas GFP-transduced PLC{gamma}2-deficient bone marrow cells were transplanted into sublethally irradiated JAK3-deficient mice as negative controls. PLC{gamma}2-transduced PLC{gamma}2-deficient B cell subpopulations underwent BCR-induced apoptosis (Fig. 5, third column) to the same extent as did GFP-transduced wild-type B cell subpopulations (Fig. 5, first column). Surprisingly, among A1-transduced, PLC{gamma}2-deficient B cell subpopulations, mature B cells (IgMlow) but not transitional (T1 and T2) (IgMhigh) were resistant to BCR-induced apoptosis (Fig. 5, fifth column). Therefore, A1 expression preferentially provides a survival signal to mature B cells. Moreover, enforced expression of A1 partially restored the number of the PLC{gamma}2-deficient mature FO B cells (IgMlow IgDhigh) (Fig. 6, fifth panel) whereas re-introduction of PLC{gamma}2 fully restored the development of the PLC{gamma}2-deficient mature FO B cells (IgMlowIgDhigh) (Fig. 6, third panel). In contrast, enforced expression of GFP had no effect on the number of the PLC{gamma}2-deficient mature FO B cells (Fig. 6, second panel). Therefore, expression of A1 provides an important survival signal for maturation of FO B cells. Taken together, the PLC{gamma}2 pathway provides a survival signal via regulation of Bcl-2 in all splenic B cell subpopulations and via additional induction of A1 in mature FO B cells.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
Given the dramatic effect of PLC{gamma}2 deficiency on B cell apoptosis, the PLC{gamma}2 pathway appears to be the major route providing survival signals from the BCR. By contrast, studies in the chicken DT40 B cell line have suggested that PLC{gamma}2 induces, rather than prevents, apoptosis (30). Nonetheless, the studies presented here clearly demonstrate that PLC{gamma}2 provides a survival signal in vivo. The reason for this discrepancy is not resolved but likely reflects differences between B cell lines and primary B cells.

PLC{gamma}2-mediated signals specifically maintain Bcl-2 levels and induce expression of the A1 gene in primary B cells. Bcl-2 plays a critical role in regulating B cell apoptosis (45). B cells in Bcl-2-deficient mice undergo massive apoptosis a few weeks after birth (38, 39). Although Bcl-2 is expressed throughout the process of B cell development, it is highly expressed in pro-B cells and mature B cells and down-regulated in death-susceptible pre-B and immature B cells (46, 47). PLC{gamma}2 deficiency results in reduction of Bcl-2 levels and increased BCR-mediated apoptosis in all splenic subpopulations. Enforced expression of Bcl-2 prevents BCR-induced apoptosis in all splenic PLC{gamma}2-deficient B cell subpopulations and partially restores numbers of PLC{gamma}2-deficient mature FO B cells. These findings demonstrate that the PLC{gamma}2 pathway provides a survival signal for the whole process of maturation by maintenance of Bcl-2 levels in all splenic B cell subpopulations. By contrast, A1 is expressed at low levels among all marrow and peripheral immature B cells, but increases dramatically as they become mature B cells (48). A1 expression is rapidly induced in T2 and mature B cells following BCR engagement (41) and protects B cells from BCR ligation-induced apoptosis (42). PLC{gamma}2 deficiency disrupts BCR-mediated induction of A1 expression. Interestingly, enforced expression of A1 in PLC{gamma}2-deficient B cells prevents BCR-induced apoptosis only in the mature FO B cells and partially restores numbers of PLC{gamma}2-deficient mature FO B cells. Thus, in addition to maintaining Bcl-2 levels, the PLC{gamma}2 pathway up-regulates A1 expression to provide a survival signal solely for mature FO B cells.

The dramatically decreased numbers of mature FO B cells in PLC{gamma}2-deficient mice could be due to an impaired transition from T2 to mature FO B cells and/or to increased apoptosis of FO B cells. The mechanism by which enforced expression of Bcl-2 partially restores development of PLC{gamma}2-deficient mature FO B cells could be fundamentally different from that by which enforced expression of A1 partially restores development of these cells. Enforced expression of Bcl-2 protects all three PLC{gamma}2-deficient splenic B cell subpopulations from BCR-induced apoptosis. Therefore, in addition to extending the half-life of FO mature B cells, expression of Bcl-2 might provide a survival signal for T2 B cells and restore their ability to differentiate into mature FO B cells. By contrast, enforced expression of A1 preferentially protects PLC{gamma}2-deficient FO mature B cells from BCR-induced apoptosis, thus leading to an extension of the half-life of this subset of B cells. Thus, different Bcl-2 family members appear to have distinct roles at different stages of B cell development. Bcl-2 plays an important role in the whole process of B cell maturation, whereas A1 is essential specifically in maintaining mature B cells.

Bcl-2 and A1 can prevent BCR-induced apoptosis but fail to promote cell proliferation in PLC{gamma}2-deficient B cells. Thus, PLC{gamma}2 regulates cell survival and cell cycle control through independent mechanisms. However, it is not clear whether the maturation arrest at T2 to FO mature B cell transition in PLC{gamma}2-deficient B cells is due to the absence of a BCR-mediated signal that is required to support B cell proliferation, differentiation, survival, or a combination thereof. The enforced expression of Bcl-2 or A1 fails to fully promote B cell maturation in PLC{gamma}2-deficient mice; therefore, simply providing a survival signal is not sufficient to support B cell maturation. Consistent with this notion, enforced expression of Bcl-2 fails to promote B cell development in RAG-1-deficient mice (49), which lack Ig heavy or light chain gene rearrangement (50, 51), However, enforced expression of Bcl-2 can restore B cell development in scid and µMT mice (49). The scid B cell precursors express pre-BCR-like receptors containing the Dµ chain and surrogate light chains, {lambda}5 and VpreB (52, 53), and a proportion of µMT B precursors express pre-BCR-like receptors containing {delta}, {lambda}5, and VpreB (54, 55). Thus, the preBCR-like receptors on scid and µMT B cell precursors appear to provide signals that are themselves not sufficient to support B cell development, but that can support B cell development when combined with the survival signal provided by Bcl-2. This notion is further supported by studies showing that co-expression of Bcl-2 and the µ heavy chain can restore B cell development in RAG-deficient mice (56). A survival signal plus differentiation and/or proliferation signal is required to support B cell development. Therefore, in addition to a survival signal, PLC{gamma}2 provides essential proliferation and/or differentiation signals for B cell maturation.

In addition to PLC{gamma}, engagement of the BCR also activates PI3K and MAPK. Although the significance of activation of the three MAPKs; ERK, JNK, and p38, in B cell development remains unclear, the PI3K pathway is essential for B cell development and mice lacking the p85{alpha} subunit of PI3K have defects in B cell development and function (57, 58). Although the PI3K pathway activates the serine/threonine kinase PKB/Akt, which can promote cell survival (59), p85{alpha}-deficient B cells have normal apoptosis after BCR ligation (58). Nonetheless, p85{alpha}-deficient B cells fail to proliferate in response to BCR ligation (57, 58).

The BCR ligation failed to activate NF-{kappa}B in PLC{gamma}2-deficient B cells and the activation of NF-{kappa}B/Rel has been very extensively implicated in lymphocyte proliferation and function (60–62). For example, B cells lacking various NF-{kappa}B/Rel family members, including p50, p52, p65, c-Rel, or RelB, fail to proliferate in response to BCR ligation (63). Thus, in addition to up-regulation of A1, NF-{kappa}B/Rel family transcription factors likely regulate other target genes, which are involved in cell cycle progression. Therefore, failure to normally activate NF-{kappa}B following BCR engagement may be the underlying cause of the defects in proliferation observed in PLC{gamma}2-deficient B cells.


   FOOTNOTES
 
* This work was supported in part by National Institutes of Health Grants CA87064 (to S. W. M.), AI52327 (to R. W.), and HL073284 (to D. W.), by American Cancer Society Grant RSG CCG-106204 (to D. W.), by the American Lebanese Syrian Associated Charities (ALSAC), St. Jude Children's Research Hospital, and by funds from the Blood Research Institute Foundation of the Blood Center of Southeastern Wisconsin. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

** To whom correspondence should be addressed: The Blood Research Institute, the Blood Center of Southeastern Wisconsin, Milwaukee, WI 53226. Tel.: 414-937-3874; Fax: 414-937-6284; E-mail: dwang{at}bcsew.edu.

1 The abbreviations used are: T1, transitional type 1; T2, transitional type 2; FO, follicular; BCR, B cell receptor; FACS, fluorescence-activated cell sorter; PBS, phosphate-buffered saline; TUNEL, terminal deoxynucleotidyltransferase-mediated dUTP nick end-labeling; GFP, green fluorescent protein; ITAM, immunoreceptor tyrosine-based activation motif; FITC, fluorescein isothiocyanate; PE, phycoerythrin; PLC, phospholipase C; MAPK, mitogen-activated protein kinase. Back


   ACKNOWLEDGMENTS
 
We thank Debra K. Newman and John L. Cleveland for critical review of this manuscript and for helpful discussion.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Loder, F., Mutschler, B., Ray, R. J., Paige, C. J., Sideras, P., Torres, R., Lamers, M. C., and Carsetti, R. (1999) J. Exp. Med. 190, 75-89[Abstract/Free Full Text]
  2. Martin, F., and Kearney, J. F. (2001) Curr. Opin. Immunol. 13, 195-201[CrossRef][Medline] [Order article via Infotrieve]
  3. Henderson, A., and Calame, K. (1998) Annu. Rev. Immunol. 16, 163-200[CrossRef][Medline] [Order article via Infotrieve]
  4. Hardy, R. R., and Hayakawa, K. (2001) Annu. Rev. Immunol. 19, 595-621[CrossRef][Medline] [Order article via Infotrieve]
  5. Healy, J. I., and Goodnow, C. C. (1998) Annu. Rev. Immunol. 16, 645-670[CrossRef][Medline] [Order article via Infotrieve]
  6. Goodnow, C. C. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 2264-2271[Abstract/Free Full Text]
  7. Rothstein, T. L. (1996) Curr. Opin. Immunol. 8, 362-371[CrossRef][Medline] [Order article via Infotrieve]
  8. Torres, R. M., Flaswinkel, H., Reth, M., and Rajewsky, K. (1996) Science 272, 1804-1808[Abstract]
  9. Martin, F., and Kearney, J. F. (2000) Immunity 12, 39-49[CrossRef][Medline] [Order article via Infotrieve]
  10. Lam, K. P., Kuhn, R., and Rajewsky, K. (1997) Cell 90, 1073-1083[CrossRef][Medline] [Order article via Infotrieve]
  11. Hartley, S. B., Crosbie, J., Brink, R., Kantor, A. B., Basten, A., and Goodnow, C. C. (1991) Nature 353, 765-769[CrossRef][Medline] [Order article via Infotrieve]
  12. Mason, D. Y., Jones, M., and Goodnow, C. C. (1992) Int. Immunol. 4, 163-175[Abstract/Free Full Text]
  13. Benhamou, L. E., Cazenave, P. A., and Sarthou, P. (1990) Eur. J. Immunol. 20, 1405-1407[Medline] [Order article via Infotrieve]
  14. Hasbold, J., and Klaus, G. G. (1990) Eur. J. Immunol. 20, 1685-1690[Medline] [Order article via Infotrieve]
  15. Pulendran, B., Kannourakis, G., Nouri, S., Smith, K. G., and Nossal, G. J. (1995) Nature 375, 331-334[CrossRef][Medline] [Order article via Infotrieve]
  16. Shokat, K. M., and Goodnow, C. C. (1995) Nature 375, 334-338[CrossRef][Medline] [Order article via Infotrieve]
  17. Hengartner, M. O. (2000) Nature 407, 770-776[CrossRef][Medline] [Order article via Infotrieve]
  18. Kurosaki, T. (1999) Annu. Rev. Immunol. 17, 555-592[CrossRef][Medline] [Order article via Infotrieve]
  19. Nishizumi, H., Taniuchi, I., Yamanashi, Y., Kitamura, D., Ilic, D., Mori, S., Watanabe, T., and Yamamoto, T. (1995) Immunity 3, 549-560[CrossRef][Medline] [Order article via Infotrieve]
  20. Chan, V. W., Meng, F., Soriano, P., DeFranco, A. L., and Lowell, C. A. (1997) Immunity 7, 69-81[CrossRef][Medline] [Order article via Infotrieve]
  21. Turner, M., Mee, P. J., Costello, P. S., Williams, O., Price, A. A., Duddy, L. P., Furlong, M. T., Geahlen, R. L., and Tybulewicz, V. L. (1995) Nature 378, 298-302[CrossRef][Medline] [Order article via Infotrieve]
  22. Cheng, A. M., Rowley, B., Pao, W., Hayday, A., Bolen, J. B., and Pawson, T. (1995) Nature 378, 303-306[CrossRef][Medline] [Order article via Infotrieve]
  23. Kerner, J. D., Appleby, M. W., Mohr, R. N., Chien, S., Rawlings, D. J., Maliszewski, C. R., Witte, O. N., and Perlmutter, R. M. (1995) Immunity 3, 301-312[CrossRef][Medline] [Order article via Infotrieve]
  24. Khan, W. N., Alt, F. W., Gerstein, R. M., Malynn, B. A., Larsson, I., Rathbun, G., Davidson, L., Muller, S., Kantor, A. B., Herzenberg, L. A., Rosen, F. S., and Sideras, P. (1995) Immunity 3, 283-299[CrossRef][Medline] [Order article via Infotrieve]
  25. Jumaa, H., Wollscheid, B., Mitterer, M., Wienands, J., Reth, M., and Nielsen, P. J. (1999) Immunity 11, 547-554[CrossRef][Medline] [Order article via Infotrieve]
  26. Pappu, R., Cheng, A. M., Li, B., Gong, Q., Chiu, C., Griffin, N., White, M., Sleckman, B. P., and Chan, A. C. (1999) Science 286, 1949-1954[Abstract/Free Full Text]
  27. Pogue, S. L., Kurosaki, T., Bolen, J., and Herbst, R. (2000) J. Immunol. 165, 1300-1306[Abstract/Free Full Text]
  28. Anderson, J. S., Teutsch, M., Dong, Z., and Wortis, H. H. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 10966-10971[Abstract/Free Full Text]
  29. Tan, J. E., Wong, S. C., Gan, S. K., Xu, S., and Lam, K. P. (2001) J. Biol. Chem. 276, 20055-20063[Abstract/Free Full Text]
  30. Takata, M., Homma, Y., and Kurosaki, T. (1995) J. Exp. Med. 182, 907-914[Abstract/Free Full Text]
  31. Coggeshall, K. M., McHugh, J. C., and Altman, A. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 5660-5664[Abstract/Free Full Text]
  32. Rhee, S. G., and Bae, Y. S. (1997) J. Biol. Chem. 272, 15045-15048[Free Full Text]
  33. Wang, D., Feng, J., Wen, R., Marine, J. C., Sangster, M. Y., Parganas, E., Hoffmeyer, A., Jackson, C. W., Cleveland, J. L., Murray, P. J., and Ihle, J. N. (2000) Immunity 13, 25-35[CrossRef][Medline] [Order article via Infotrieve]
  34. Wen, R., Wang, D., McKay, C., Bunting, K. D., Marine, J. C., Vanin, E. F., Zambetti, G. P., Korsmeyer, S. J., Ihle, J. N., and Cleveland, J. L. (2001) Mol. Cell Biol. 21, 678-689[Abstract/Free Full Text]
  35. Bunting, K. D., Sangster, M. Y., Ihle, J. N., and Sorrentino, B. P. (1998) Nat. Med. 4, 58-64[CrossRef][Medline] [Order article via Infotrieve]
  36. Oliver, A. M., Martin, F., Gartland, G. L., Carter, R. H., and Kearney, J. F. (1997) Eur. J. Immunol. 27, 2366-2374[Medline] [Order article via Infotrieve]
  37. Tsubata, T., Wu, J., and Honjo, T. (1993) Nature 364, 645-648[CrossRef][Medline] [Order article via Infotrieve]
  38. Nakayama, K., Negishi, I., Kuida, K., Sawa, H., and Loh, D. Y. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 3700-3704[Abstract/Free Full Text]
  39. Veis, D. J., Sorenson, C. M., Shutter, J. R., and Korsmeyer, S. J. (1993) Cell 75, 229-240[CrossRef][Medline] [Order article via Infotrieve]
  40. Lin, E. Y., Orlofsky, A., Berger, M. S., and Prystowsky, M. B. (1993) J. Immunol. 151, 1979-1988[Abstract]
  41. Su, T. T., and Rawlings, D. J. (2002) J. Immunol. 168, 2101-2110[Abstract/Free Full Text]
  42. Grumont, R. J., Rourke, I. J., and Gerondakis, S. (1999) Genes Dev. 13, 400-411[Abstract/Free Full Text]
  43. Nosaka, T., van Deursen, J. M., Tripp, R. A., Thierfelder, W. E., Witthuhn, B. A., McMickle, A. P., Doherty, P. C., Grosveld, G. C., and Ihle, J. N. (1995) Science 270, 800-802[Abstract/Free Full Text]
  44. Thomis, D. C., Gurniak, C. B., Tivol, E., Sharpe, A. H., and Berg, L. J. (1995) Science 270, 794-797[Abstract/Free Full Text]
  45. Strasser, A., Harris, A. W., Corcoran, L. M., and Cory, S. (1994) Nature 368, 457-460[CrossRef][Medline] [Order article via Infotrieve]
  46. Li, Y. S., Hayakawa, K., and Hardy, R. R. (1993) J. Exp. Med. 178, 951-960[Abstract/Free Full Text]
  47. Merino, R., Ding, L., Veis, D. J., Korsmeyer, S. J., and Nunez, G. (1994) EMBO J. 13, 683-691[Medline] [Order article via Infotrieve]
  48. Tomayko, M. M., and Cancro, M. P. (1998) J. Immunol. 160, 107-111[Abstract/Free Full Text]
  49. Tarlinton, D. M., Corcoran, L. M., and Strasser, A. (1997) Int. Immunol. 9, 1481-1494[Abstract/Free Full Text]
  50. Mombaerts, P., Iacomini, J., Johnson, R. S., Herrup, K., Tonegawa, S., and Papaioannou, V. E. (1992) Cell 68, 869-877[CrossRef][Medline] [Order article via Infotrieve]
  51. Shinkai, Y., Rathbun, G., Lam, K. P., Oltz, E. M., Stewart, V., Mendelsohn, M., Charron, J., Datta, M., Young, F., Stall, A. M., and Alt, F. W. (1992) Cell 68, 855-867[CrossRef][Medline] [Order article via Infotrieve]
  52. Pennycook, J. L., Chang, Y., Celler, J., Phillips, R. A., and Wu, G. E. (1993) J. Exp. Med. 178, 1007-1016[Abstract/Free Full Text]
  53. Schuler, W., Weiler, I. J., Schuler, A., Phillips, R. A., Rosenberg, N., Mak, T. W., Kearney, J. F., Perry, R. P., and Bosma, M. J. (1986) Cell 46, 963-972[CrossRef][Medline] [Order article via Infotrieve]
  54. Kitamura, D., and Rajewsky, K. (1992) Nature 356, 154-156[CrossRef][Medline] [Order article via Infotrieve]
  55. Kitamura, D., Roes, J., Kuhn, R., and Rajewsky, K. (1991) Nature 350, 423-426[CrossRef][Medline] [Order article via Infotrieve]
  56. Young, F., Mizoguchi, E., Bhan, A. K., and Alt, F. W. (1997) Immunity 6, 23-33[CrossRef][Medline] [Order article via Infotrieve]
  57. Fruman, D. A., Snapper, S. B., Yballe, C. M., Davidson, L., Yu, J. Y., Alt, F. W., and Cantley, L. C. (1999) Science 283, 393-397[Abstract/Free Full Text]
  58. Suzuki, H., Terauchi, Y., Fujiwara, M., Aizawa, S., Yazaki, Y., Kadowaki, T., and Koyasu, S. (1999) Science 283, 390-392[Abstract/Free Full Text]
  59. Kauffmann-Zeh, A., Rodriguez-Viciana, P., Ulrich, E., Gilbert, C., Coffer, P., Downward, J., and Evan, G. (1997) Nature 385, 544-548[CrossRef][Medline] [Order article via Infotrieve]
  60. Doi, T. S., Takahashi, T., Taguchi, O., Azuma, T., and Obata, Y. (1997) J. Exp. Med. 185, 953-961[CrossRef][Medline] [Order article via Infotrieve]
  61. Kontgen, F., Grumont, R. J., Strasser, A., Metcalf, D., Li, R., Tarlinton, D., and Gerondakis, S. (1995) Genes Dev. 9, 1965-1977[Abstract/Free Full Text]
  62. Sha, W. C., Liou, H. C., Tuomanen, E. I., and Baltimore, D. (1995) Cell 80, 321-330[CrossRef][Medline] [Order article via Infotrieve]
  63. Ghosh, S., May, M. J., and Kopp, E. B. (1998) Annu. Rev. Immunol. 16, 225-260[CrossRef][Medline] [Order article via Infotrieve]