JBC INTERFERin siRNA transfection reagent

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M306856200 on August 27, 2003

J. Biol. Chem., Vol. 278, Issue 45, 44153-44160, November 7, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/45/44153    most recent
M306856200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by McCracken, S.
Right arrow Articles by Blencowe, B. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by McCracken, S.
Right arrow Articles by Blencowe, B. J.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

An Evolutionarily Conserved Role for SRm160 in 3'-End Processing That Functions Independently of Exon Junction Complex Formation*

Susan McCracken{ddagger}, Dasa Longman§, Iain L. Johnstone||, Javier F. Cáceres§, and Benjamin J. Blencowe{ddagger}**

From the {ddagger}Banting and Best Department of Medical Research, C. H. Best Institute, University of Toronto, Toronto, Ontario M5G 1L6, Canada, the §Medical Research Council Human Genetics Unit, Western General Hospital, Edinburgh EH4 2XU, Scotland, United Kingdom, and the ||Wellcome Centre for Molecular Parasitology, University of Glasgow, Anderson College, Glasgow GI1 6NU, Scotland, United Kingdom

Received for publication, June 26, 2003 , and in revised form, August 20, 2003.


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
SRm160 (the SR-related nuclear matrix protein of 160 kDa) functions as a splicing coactivator and 3'-end cleavage-stimulatory factor. It is also a component of the splicing-dependent exon-junction complex (EJC), which has been implicated in coupling of pre-mRNA splicing with mRNA turnover and mRNA export. We have investigated whether the association of SRm160 with the EJC is important for efficient 3'-end cleavage. The EJC components RNPS1, REF, UAP56, and Y14 interact with SRm160. However, when these factors were tethered to transcripts, only SRm160 and RNPS1 stimulated 3'-end cleavage. Whereas SRm160 stimulated cleavage to a similar extent in the presence or absence of an active intron, stimulation of 3'-end cleavage by tethered RNPS1 is dependent on an active intron. Assembly of an EJC adjacent to the cleavage and polyadenylation signal in vitro did not significantly affect cleavage efficiency. These results suggest that SRm160 stimulates cleavage independently of its association with EJC components and that the cleavage-stimulatory activity of RNPS1 may be an indirect consequence of its ability to stimulate splicing. Using RNA interference (RNAi) in Caenorhabditis elegans, we determined whether interactions between SRm160 and the cleavage machinery are important in a whole organism context. Simultaneous RNAi of SRm160 and the cleavage factor CstF-50 (Cleavage stimulation factor 50-kDa subunit) resulted in late embryonic developmental arrest. In contrast, RNAi of CstF-50 in combination with RNPS1 or REFs did not result in an apparent phenotype. Our combined results provide evidence for an evolutionarily conserved interaction between SRm160 and the 3'-end cleavage machinery that functions independently of EJC formation.


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 
Individual steps in the transcription, processing, export, turnover, and translation of mRNA are closely coupled and coordinated with each other (1–3). The carboxyl-terminal domain of RNA polymerase II associates with pre-mRNA processing factors and is important for efficient capping, splicing, and 3'-end formation (cleavage and polyadenylation) in vitro and in vivo (4). Splicing can reciprocally stimulate transcription (5–7), and recognition of the cleavage and polyadenylation signal (AAUAAA) by cleavage factors is important for transcription termination (8). Independently of transcription, the formation of a 5'-end cap binding complex can facilitate efficient processing of the 5'-end-most introns as well the 3'-end processing of intronless transcripts (9–11). Also independently of transcription, the splicing of the 3'-end-most introns and 3'-end processing can influence each other. For example, poly(A) polymerase can increase the efficiency of splicing of an adjacent intron, and splicing of 3'-end-most introns increases the efficiency of 3'-end formation (12–18). The increased efficiency of 3'-end formation by splicing is one mechanism by which introns can increase the efficiency of gene expression.

The mechanism by which splicing components stimulate 3'-end formation is not well understood. Several studies have reported the involvement of different splicing factors in this process. For example, cross-linking of U1snRNP1 to cleavage and polyadenylation efficiency elements was observed to correlate with 3'-end processing efficiency (19). Consistent with these findings, it was subsequently reported that U1snRNP-A protein can interact with cleavage and polyadenylation specificity factor and stimulate 3'-end formation (20). Other studies have shown that binding of U1snRNP and the SR family protein SRp20 to an intronic splicing enhancer sequence in the calcitonin/calcitonin gene-related peptide gene correlates with increased 3'-end processing at an adjacent polyadenylation site (16). In other studies, it was shown that mutation of the polypyrimidine tract/3'-splice site-AG can prevent efficient 3'-end formation (12, 14, 17). Consistent with these results, binding of U2AF-65 (U2 snRNP auxiliary factor 65-kDa subunit) to the polypyrimidine tract-3' splice site sequence in the second (3'-end-most) intron of the human {beta}-globin gene has been implicated in the stimulation of 3'-end formation (17).

Recently, we have shown that SRm160 (the SR-related nuclear matrix protein of 160 kDa), a coactivator of constitutive and exon-enhancer-dependent splicing (21, 22), also functions in the stimulation of 3'-end formation (18). Increased levels of SRm160 in vitro and in vivo promotes transcript 3'-end cleavage, and this activity requires the PWIRNA binding domain located in the highly conserved N-terminal region of the protein (18, 23). SRm160 was more efficient in the stimulation of 3'-end cleavage of splicing-active pre-mRNA substrates than splicing-inactive substrates containing 5' or 3' splice site mutations, suggesting that it normally stimulates 3'-end cleavage coupled to splicing. These findings, together with the observation that SRm160 interacts with cleavage and polyadenylation specificity factor (18), indicated that SRm160 may be part of a protein-protein interaction network that is important for efficient 3'-end formation.

SRm160 normally associates with pre-mRNA at an early stage of splicing complex formation. This association is strongly dependent on U1 snRNP and is further stabilized by the binding of U2 snRNP and SR family proteins to transcripts (21, 22). After splicing, SRm160 remains bound to mRNA in an "exon-junction complex" (EJC) that resides 20–24 nt upstream of exon-exon junctions (24). Besides SRm160, the EJC contains the proteins REF, UAP56, RNPS1, Y14, Mago, and DEK (3, 25). UAP56 is a DExD-box putative RNA helicase that functions in splicing (26) as well as in mRNA export (27–30). REF has been identified as a chaperone that regulates the activity of bZIP transcription factors (31) and as an adapter for the mRNA export factor TAP (32–34), which is weakly associated with the EJC in vitro (35). RNPS1 is a splicing activator that functions to couple splicing to mRNA turnover by the nonsense-mediated decay pathway (36, 37). Y14 and Mago form a heterodimer that also activates nonsense-mediated decay (38–41). DEK has been identified in association with several different processes including chromatin remodeling, transcription, splicing, and DNA replication, although its precise cellular role is not known (42–45). Like TAP, its association with the EJC appears to be less stable than the other components (43, 46, 47). Although SRm160 was among the first proteins to be identified in the EJC, its role in this complex is not known.

From the studies summarized above, it is apparent that the stimulation of 3'-end formation by factors that function in splicing could occur by several different mechanisms that function independently, or else they function in parallel and involve different interaction networks. Since SRm160 stimulates the 3'-end formation of unrelated transcripts (18) and is associated with splicing complexes as well as with the EJC, it was of interest to investigate at what stage of complex formation it functions to promote 3'-end formation. Using different experimental strategies, including in vivo and in vitro 3'-end cleavage assays as well as combinatorial RNAi, we provide evidence that the role of SRm160 in 3'-end formation is independent of its association with EJC components. Moreover, our results provide the first evidence that the interaction between SRm160 and the 3'-end cleavage machinery is conserved and important in a whole organism context.


   EXPERIMENTAL PROCEDURES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
RESULTS
 DISCUSSION
 REFERENCES
 
Antibodies—The following antibodies were used in this study: murine monoclonal B1C8 (anti-SRm160) (21, 48) and the rabbit polyclonals anti-SRm160 (gift of J. Nickerson, University of Massachusetts), anti-SRm300 (49), anti-Y14 and anti-REF (gift of E. Izaurralde, EMBL), anti-RNPS1 (gift of A. Mayeda, University of Miami School of Medicine), anti-UAP56 (gift of M. Green, Howard Hughes Medical Institute, University of Massachusetts Medical School), and anti-MS2 (gift of P. Stockley, University of Leeds, UK).

Plasmids—The pre-mRNA reporter plasmids dsx{Delta}E-{Delta}5'SS+3xMS2, dsx{Delta}E+3xMS2, dsx{Delta}E-{Delta}5'SS-(no MS2) and the expression plasmids pcDNA3-fMS2 and pcDNA3-fMS2-SRm160-WT have been previously described (23). pcDNA3-fMS2-UAP56 and -Y14 were constructed by insertion of the BamHI-XbaI or BamHI-EcoRI fragments, respectively, derived from the product of PCR amplification reactions of pBS UAP56 (gift of M. Green) and pcNY14 (gift of J. Steitz) using the following primers: UAP56 FWD, GGGGGGATCCAATGGCAGAGAACGATGTGGACAATG; UAP56 REV, GGGGTCTAGACTACCGTGTCTGTTCAATGTAGGAGG; Y14 FWD, CGGGATCCAATGGCGGACGTGCTAGATCTTCAC; and Y14 REV, GGAATTCTCAGCGACGTCTCCGGTCTGGACT. Plasmids pcN-MS2 RNPS1 and pcN-Ref2-I were a gift of J. Steitz.

RNA Reporters and RNase Protection Probes—The dsx pre-mRNA reporters, protection probes, and VA reporter have been described previously (18, 23, 50).

Transfections—Human 293 cells were grown in Dulbecco's modified Eagle's medium containing 10% fetal bovine serum to a density of 2 x 106 cells per 150-mm diameter plate prior to transient transfection using calcium phosphate precipitation. Transfections were typically performed with 5 µg of reporter plasmid, 10 µg of MS2-EJC fusion protein expression plasmid, or the corresponding empty vector. Each transfection contained 0.5 µg of the polymerase III-VA RNA reporter as an internal control for transfection efficiency as well as for recovery of RNA in the nuclear and cytoplasmic fractions. Following transfection, the culture medium was changed after 16 h, and the cells were harvested after 40 h.

RNA Preparation and Analysis—Nuclear and cytoplasmic RNA fractions from the transfected cells were prepared as previously described (18). In each experiment, 10% (2–5 µg) of the total amount of RNA recovered from each fraction was analyzed by RNase protection with gel-purified radiolabeled probes, as described (50), except that incubations with RNase were performed for 1 h. RNase protection products were quantified by using a Bio-Rad phosphor imager and software. Each RNA species was quantified following background subtraction and after normalization for VA signal and U content of the protected probe fragment.

Antibodies and Immunoprecipitation—Immunoprecipitation of SRm160-containing complexes from nuclear extract and from splicing/cleavage reactions was performed as described by Eldridge et al. (22). In Fig. 1, nuclear extract used for immunoprecipitation was preincubated for 15 min at 30 °C under splicing conditions (22) but with an RNase mixture (7 ng/µl; Roche Applied Science) and DNase. Immunoprecipitations shown in Fig. 1 were performed in the presence of phosphatase inhibitors (potassium fluoride, sodium pyrophosphate, and sodium {beta}-glycerophosphate).



View larger version (71K):
[in this window]
[in a new window]
  		FIG. 1.
EJC components associate with SRm160. Immunoprecipitates were collected from HeLa nuclear extract with monoclonal antibody anti-SRm160 (B1C8) (lane 4), rabbit polyclonal anti-SRm160 (lane 5), and rabbit polyclonal anti-SRm300 (lane 6) antibodies (see "Experimental Procedures") and with an excess of a control antibody (rabbit anti-mouse immunoglobulin) (lane 3). The immunoprecipitates were separated on a 12.5% SDS-polyacrylamide gel and immunoblotted with antibodies specific for UAP56, RNPS1, Y14, and REF. Total nuclear extract separated in lane 1 (60 µg) and lane 2 (15 µg) corresponds to 4 and 1%, respectively, of the input in each immunoprecipitation.

 

In Vitro Transcription and Cleavage Reactions—Transcription of RNase protection probes and substrates for in vitro splicing assays was performed essentially as described previously (18).

The templates for the MXSVL-41 and -17 derivatives were constructed by PCR amplification to generate transcripts that had 41 or 17 bases in the first exon downstream of a T7 promoter using the following oligonucleotides: MXSVL-17 FWD, TCC CCC GGG GGA TAA TAC GAC TCA CTA TAG GGT CGG CCT CCG AAC GGT AAG AGC C; MXSVL-41, TCC CCC GGG GGA TAA TAC GAC TCA CTA TAG GGG CCC ACT CTT GGA TCG GAA ACC C; and MXSVL REV, GGC TCT AGA AGG ATC AGC CAT ACC AC.

The PCR amplification products were digested with SmaI and XhoI and inserted into pSP72 digested with HincII and XhoI. All templates were linearized with DraI and transcribed with T7 RNA polymerase. MXSVL-WT (gift of S. Berget) was linearized with DraI and transcribed with SP6 RNA polymerase.

The cleavage reactions were performed essentially as described previously by Niwa et al. (12) for 1 h at 30 °C. Each reaction mixture contained 4.4 µl of nuclear extract and 1.5 mM MgCl2 (final concentration) and was incubated with 5'-cordycepin triphosphate.

RNAi in Caenorhabditis elegans—RNAi in C. elegans was performed as described previously (53, 54).


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
DISCUSSION
 REFERENCES
 
EJC Components Interact with SRm160 —Recent studies have demonstrated that SRm160 is a component of an exon junction complex (EJC) that forms 20–24 nucleotides upstream of spliced exon-exon junctions (24). This complex also contains REF, Y14, RNPS1, UAP56, Mago, and DEK proteins (see Introduction). Since the nature of the association of the various EJC components with each other and with the spliced mRNA is poorly understood, we asked in the present study whether SRm160 has the potential to form interactions with EJC components using available specific antisera (Fig. 1). Proteins were co-immunoprecipitated from HeLa nuclear extract pretreated to eliminate nucleic acids, using two different anti-SRm160 antisera: the murine monoclonal B1C8 (lane 4) and an anti-SRm160 rabbit polyclonal raised to amino acids 7–160 in the N-terminal region of the protein (lane 5). Immunoblotting of the immunoprecipitated proteins with available antisera specific to REF, Y14, RNPS1, and UAP56 revealed that each of these proteins can associate with SRm160, although to different extents. For example, RNPS1 and Y14 were more efficiently co-immunoprecipitated with SRm160 than UAP56 and REF. As we have reported previously (43), DEK also co-immunoprecipitated with SRm160, consistent with its detection in EJCs assembled in vitro (24) (data not shown). None of the proteins were immunoprecipitated to a significant extent by an antibody to SRm300, an SR-related protein that associates with SRm160 during splicing complex formation (49) but that is not known to form part of the EJC (Fig. 1, lane 6). Nevertheless, the anti-SRm300 antibody does specifically immunoprecipitate other factors present in HeLa nuclear extract.2 These results indicate that SRm160 specifically associates with multiple EJC components in nuclear extract. Since these interactions were not diminished following extensive pretreatment with nucleases, they most likely occur via protein-protein contacts.

SRm160 and RNPS1 Stimulate 3'-End Formation by Different Pathways—Given our previous results demonstrating that SRm160 can stimulate 3'-end formation (18) and the results above showing that SRm160 can interact with EJC components in the absence of RNA, we next asked whether EJC components other than SRm160 can participate in 3'-end formation (Fig. 2). The EJC components SRm160, REF, Y14, RNPS1, and UAP56 were N-terminally fused to the bacteriophage MS2 coat protein, which binds with relatively high specificity and affinity to a defined stem-loop sequence, the MS2 site (51). Expression plasmids for each MS2 fusion protein were transiently transfected into human 293 cells, along with a model pre-mRNA reporter containing sequences derived from exons 3 and 4 of the Drosophila doublesex gene and a downstream SV40 late 3'-cleavage and polyadenylation signal (see "Experimental Procedures"). Inserted into exon 4 are three tandem copies of the MS2 binding site, permitting tethering of the expressed MS2 fusion protein. Also co-transfected with each expression plasmid and reporter was an RNA polymerase III-driven VA-RNA plasmid, which serves as an internal control for transfection efficiency and RNA recovery. RNA isolated from each transfection was analyzed by RNase protection using a radiolabeled antisense probe spanning the cleavage site of the dsx reporter and with an antisense probe to the VA-RNA.



View larger version (38K):
[in this window]
[in a new window]
  		FIG. 2.
SRm160 and RNPS1 stimulate 3'-end cleavage by different interaction pathways. A, Western blot analysis of MS2-EJC fusion proteins expressed from transiently transfected plasmids. Total lysates from human 293 cells transiently expressing MS2-SRm160 (lane 2), MS2-UAP56 (lane 3), MS2-RNPS1 (lane 4), MS2-Y14 (lane 5), and MS2-REF (lane 6) were separated on a 12.5% SDS-polyacrylamide gel and immunoblotted with an anti-MS2 antibody. A lysate from cells transfected with a control, empty vector is shown in lane 1. B, RNase protection analysis of transcripts from human 293 cells transiently transfected with each MS2 fusion expression plasmid shown in A, the pre-mRNA splicing and 3'-end cleavage reporter plasmid dsx{Delta}E+3xMS2 (see diagram above the bar graph), and the polymerase III reporter plasmid pSPVA, which serves as an internal control for transfection efficiency and RNA recovery. Proportional amounts of RNA isolated from the nuclear (N) and cytoplasmic (C) fractions of the transfected cells were analyzed by RNase protection with a 3'-end protection probe specific for dsx{Delta}E+3xMS2 reporter transcripts. The identity of each RNA species is indicated. Quantification of the RNase protection analysis, representing values from three analyses is shown graphically on the right. The dsx{Delta}E+3xMS2 reporter and corresponding protection probe is illustrated above the bar graph. C, RNase protection analysis of RNA transcripts from human 293 cells transiently transfected as described in B except using instead the dsx{Delta}E-{Delta}5'SS+3xMS2 reporter plasmid. RNase protection analysis with a corresponding 3'-end protection probe was performed, also as in B. Quantification of the RNase protection analysis, representing values from three analyses, is shown graphically on the right. The dsx{Delta}E-{Delta}5'SS+3xMS2 reporter and corresponding protection probe is illustrated above the bar graph. D, quantification of RNase protection analysis of transcripts from human 293 cells transiently transfected with plasmids as described in B and C, except using instead the pre-mRNA reporter plasmid dsx{Delta}E-{Delta}5'SS. RNA was analyzed as in B and C. The data shown represent values obtained from three analyses. The dsx{Delta}E-{Delta}5'SS reporter and corresponding protection probe are illustrated above the bar graph.

 

The expressed MS2 fusion proteins were initially tested for activity using a version of the dsx pre-mRNA reporter containing wild type splice sites, "dsx{Delta}E+3xMS2." The five different MS2 fusion proteins were expressed at comparable levels in the transfected cells (Fig. 2A, compare lanes 2–6). Besides MS2-SRm160, MS2-RNPS1 was found to stimulate cleavage of this reporter pre-mRNA, resulting in an even higher ratio of cleaved to uncleaved RNA than MS2-SRm160 (Fig. 2B, compare lanes 3 and 4 and lanes 7 and 8 with lanes 1 and 2, and see adjacent bar graph).

In addition to stimulating 3'-end cleavage, MS2-SRm160 and MS2-RNPS1 also stimulated splicing activity of the reporter pre-mRNA, consistent with the known roles of these proteins as splicing (co-)activators (data not shown). In contrast, expression of the MS2 fusions of REF, Y14, and UAP56 did not result in a significant effect on splicing or cleavage activity (Fig. 2B, compare lanes 5, 6, and 9–12, and see adjacent bar graph). Similar ratios of cleaved to uncleaved RNA were observed for each of the MS2 fusion proteins after prolonged incubation (24 h) of the transfected cells with cycloheximide, indicating that the levels of the reporter transcripts were not altered by the nonsense-mediated decay pathway, which in other contexts can be activated by tethered RNPS1 or Y14 (data not shown) (37, 52).

Since the association of splicing factors with an adjacent intron can positively stimulate 3'-end cleavage levels, we next asked whether the 3'-end cleavage-stimulatory activity of MS2-RNPS1 is an indirect consequence of its ability to stimulate splicing or whether it can be attributed to a more direct effect that occurs independently of splicing of the adjacent intron. A version of the dsx pre-mRNA reporter described above containing a deletion in the 5'-splice site (dsx{Delta}E-{Delta}5'SS+3xMS2) was therefore tested next (Fig. 2C). As observed previously, expression of MS2-SRm160 resulted in a substantial increase in the ratio of 3'-end cleaved to uncleaved RNA from this reporter (23) (lanes 3 and 4). It is noteworthy that the absolute level of RNA from the reporter also increased, although this effect of expression of MS2-SRm160 was somewhat variable compared with the consistent increase in the ratio of cleaved to uncleaved RNA observed between experiments (e.g. refer to Fig. 2C in Ref. 23).

In contrast to the strong effect of MS2-RNPS1 in promoting 3'-end cleavage levels of the dsx{Delta}E+3xMS2 reporter containing wild-type splice sites, MS2-RNPS1 only had a modest effect on the 3'-end cleavage levels of the dsx{Delta}E-{Delta}5'SS+3xMS2 reporter (lanes 7 and 8; see the adjacent bar graph). As before, MS2-REF, -Y14, and -UAP56 proteins did not have a significant effect on the level of 3'-end cleavage of this reporter (lanes 5, 6, and 9–12). Moreover, with the exception of MS2-SRm160, none of the MS2-EJC fusion proteins significantly altered the 3'-end cleavage level of the corresponding reporter pre-mRNA lacking MS2 binding sites (dsx{Delta}E-{Delta}5'SS+3 (no MS2)) (Fig. 2D). These results suggest that the 3'-end cleavage-stimulatory activity of MS2-RNPS1 is an indirect consequence of its splicing activation function. SRm160 is therefore unique among the EJC components tested in that it can stimulate 3'-end cleavage independently of the splicing of a transcript. However, since SRm160 is normally only recruited to substrates via interactions with other splicing components (21, 22), its role in cleavage stimulation most likely occurs in the context of one or more SRm160-containing complexes assembled as a consequence of splicing complex formation. Overexpression of SRm160 or tethering it to pre-mRNA via the MS2 domain can, however, bypass the requirement of other splicing components for recruitment to pre-mRNA, allowing stimulation of 3'-end cleavage in the absence of splicing (18).

Formation of an EJC Does Not Significantly Alter 3'-End Cleavage Levels—Although SRm160 is unique among EJC components in its splicing-independent 3'-end cleavage-stimulatory property, it is conceivable that this activity could still function in the context of formation of the EJC. To directly test if the EJC functions in 3'-end formation, we asked whether the level of cleavage of a model pre-mRNA substrate in vitro is different in the presence or absence of an EJC assembled adjacent to the cleavage and polyadenylation signal (Fig. 3). A wild-type version and two shortened versions of a two-exon pre-mRNA substrate derived from adenovirus (MXSVL) (12), which contains an SV40 late cleavage and polyadenylation signal downstream of the 3'-exon, were compared for cleavage activity. The wild-type substrate (MXSVL-WT) contains a 5'-exon of 60 nt, whereas the shortened versions contain 5'-exons of 41 nt (MXSVL-41) or 17 nt (MXSVL-17). In agreement with previously published results (35), immunoprecipitation assays using the anti-SRm160 monoclonal antibody B1C8 revealed that the spliced MXSVL-WT and MXSVL-41 RNAs can assemble an EJC, whereas the 5'-exon of MXSVL-17 is too short to allow efficient formation of this complex, which resides 21–24 nt upstream of exon-exon junctions (Fig. 3A, compare the spliced plus uncleaved RNA products in the immunoprecipitation (IP) pellets in lanes 5 and 6 with the corresponding RNA species in the "totals" in lanes 1 and 2; data not shown). Notably, there was approximately a 5-fold increase in the level of spliced MXSVL-WT relative to spliced MXSVL-17 RNA immunoprecipitated by monoclonal antibody B1C8. A similar increase in the level of immunoprecipitation of spliced MXSVL-41 RNA was also observed, indicating the an EJC forms with comparable efficiency on MXSVL-WT and MXSVL-41 substrates (data not shown).



View larger version (23K):
[in this window]
[in a new window]
  		FIG. 3.
Assembly of an EJC adjacent to the cleavage/polyadenylation signal does not affect the efficiency of 3'-end cleavage. A, immunoprecipitation (IP) of splicing/cleavage complexes. Radiolabeled pre-mRNA substrates derived from Adenovirus sequences (MXSVL-WT; see "Experimental Procedures") with either a wild-type (WT) 5'-exon of 60 nt (MXSVL-WT, lane 1), or a truncated 5'-exon of 17 nt (MXSVL-17, lane 2) were incubated in splicing/cleavage reactions for 1 h in the presence of cordecypin. Complexes assembled on each RNA substrate and corresponding products were immunoprecipitated with the anti-SRm160 monoclonal antibody B1C8. Total RNA recovered from the splicing/cleavage reactions and RNA recovered following immunoprecipitation were analyzed by denaturing gel electrophoresis. *, the lariat-3'-exon intermediate. B, analysis of splicing and 3'-end cleavage efficiencies of MXSVL pre-mRNA substrates. Radiolabeled MXSVL-WT, MXSVL-41 (containing a 5'-exon of 41 nt), and MXSVL-17 pre-mRNA substrates were incubated in splicing and cleavage reactions for 1 h in the presence of cordecypin, and RNA recovered from the reactions was analyzed by denaturing gel electrophoresis. Quantification of the 3'-end cleavage efficiencies was determined by measuring the ratios of spliced plus cleaved RNA over total unspliced RNA (sum of unspliced plus uncleaved RNA and unspliced plus cleaved) for each MXSVL substrate (represented by black bars in the adjacent bar graph). Note, since the spliced plus uncleaved RNA is a very inefficient precursor to spliced plus cleaved RNA (13) (S. McCracken and B. J. Blencowe, unpublished observations) and does not significantly affect the relative ratios of 3'-end cleavage to total unspliced RNA, we did not include it in our ratio calculations. This RNA species does, however, allow an assessment of splicing efficiency independently of 3'-end cleavage. Accordingly, quantification of the splicing efficiency was determined by measuring the ratio of spliced plus uncleaved RNA to unspliced plus uncleaved RNA (gray bars in the adjacent bar graph) (12). The bar graph represents results and S.D. values from three independent experiments. *, the lariat-3'-exon intermediate.

 

Under the in vitro conditions used to monitor processing of the MXSVL pre-mRNA substrates, which were identical to those described previously (12, 18), 3'-end cleavage and splicing are coupled, since they positively influence each other. Consistent with this, we observed a parallel relationship between the efficiency of splicing and the efficiency of 3'-end formation of the three MXSVL substrates. Reducing the length of the 5'-exon resulted in approximately a 1.5-fold decrease in splicing efficiency between MXSVL-WT and MXSVL-41 and a 2–3-fold decrease in splicing efficiency between MXSVL-41 and MXSVL-17 (Fig. 3B, compare lanes 1–3 and quantification of each reaction in the adjacent bar graph). The efficiency of 3'-end cleavage was similarly reduced (by ~2-fold) between each of these substrates. Thus, despite the decrease in association of SRm160 with spliced MXSVL-17 RNA compared with spliced MXSVL-WT and MXSVL-41 RNAs, the level of 3'-end cleavage of this substrate does not decrease to the same extent. More specifically, if formation of the EJC was contributing to the stimulation of 3'-end formation, we might have expected to observe a more pronounced difference in the level of cleavage between the MXSVL-41 and MXSVL-17 RNA. Rather, due to the coupled nature of the reactions and the observation that the splicing and 3'-end cleavage levels of the three MXSVL substrates closely parallel each other, the reduced 3'-end cleavage activity of the MXSVL-17 pre-mRNA may be due to its reduced splicing activity. Time course experiments comparing the yields and rate of production of the 3'-end cleaved and spliced products for the MXSVL-41 and MXSVL-17 substrates also did not reveal a significant difference in their cleavage activities that was independent of the difference in their relative splicing efficiencies (data not shown). These results support the conclusion that an EJC assembled adjacent to the cleavage/polyadenylation signal may not contribute significantly to the level of 3'-end cleavage of the MXSVL substrate. Together with the results described above, it is apparent that the cleavage-stimulatory function of SRm160 could operate at a step prior to EJC formation.

Interaction between SRm160 and the 3'-End Cleavage Machinery in the Development of C. elegans—So far, a role for SRm160 in cleavage stimulation has been demonstrated in mammalian in vitro and in vivo assays using model pre-mRNA substrates. It was therefore of considerable interest to determine whether interactions between SRm160 and cleavage components are physiologically relevant in a whole organism context. C. elegans provides a convenient model organism to address this question, since the C. elegans SRm160 orthologue (rsr-1; denoted as "CeSRm160" below) is highly conserved (48.0% identical and 39.3% similar to mammalian SRm160) (53), as are many C. elegans orthologs of mammalian proteins known to interact with SRm160, including SR family proteins and 3'-end cleavage factors. Furthermore, since CeSRm160 is a nonessential protein (54), it is possible to ask which other nonessential factors interact with it genetically using combinatorial RNAi. Using this approach, we demonstrated previously that there are multiple genetic interactions between CeSRm160 and CeSR family proteins that are required for proper development, which probably reflect the multiple physical and functional interactions between these proteins detected in the context of splicing complex formation in mammalian splicing assays (53) (see Introduction). In the present study, we have extended the combinatorial RNAi approach to determine whether interactions between SRm160 and cleavage components are also important in development (Fig. 4).



View larger version (77K):
[in this window]
[in a new window]
  		FIG. 4.
Combinatorial RNAi in C. elegans reveals a genetic interaction between SRm160 and CstF-50. RNAi of CeSRm160 was performed in combination with three different C. elegans orthologs of cleavage factors: CeCFIm-68, CeCFIIAm, and CeCstF-50. Only the combination of CeSRm160 and CstF-50 resulted in an apparent phenotype, corresponding to a late embryonic developmental arrest in F1 progeny (A–C; refer to Table II for a summary of all of the combinations tested). RNAi of CeSRm160 or of CeCstF-50 alone did not result in apparent phenotype. D, wild type worms at the 3-fold stage.

 


View this table:
[in this window]
[in a new window]
  		TABLE II
Combinatorial RNAi of C. elegans pre-mRNA processing factors

 
The results of a recent genome-wide RNAi screen (55), as well as RNAi experiments in another recent report (56), revealed that there are only three nonessential C. elegans orthologs of mammalian cleavage factors: CeCstF-50 (C. elegans cleavage stimulation factor-I 50-kDa subunit), CeCFIIAm (Clp1p), and CeCFIm-68 (C. elegans cleavage factor-I 68-kDa subunit), which is an ortholog of both mammalian CFIm-68 and CFIm-59 factors (Table I). RNAi of other C. elegans cleavage factors resulted in various developmental abnormalities and therefore were not included in our combinatorial RNAi screen (Table I). Simultaneous RNAi of CeSRm160 and CeCFIm-68 or CeSRm160 and CeCFIIAm did not result in an apparent phenotype (Table II). In contrast, simultaneous RNAi of CeSRm160 and CeCstF-50 resulted in arrest at a late stage of embryonic development, indicating a genetic interaction between CeSRm160 and this component of the cleavage machinery (Fig. 4, A–C; compare with wild type worms in D). It was recently reported that RNAi of CeRNPS1 and simultaneous RNAi of the three orthologs of mammalian REF (CeREFs1–3) resulted in a wild-type phenotype (57). Interestingly, RNAi of CeRNPS1 with CeCstF-50 or RNAi of CeREFs1–3 with CeCstF-50 did not result in any apparent phenotype; nor did RNAi of CeRNPS1 with CeCFIm-68 or with CeCFIIAm (refer to Table II). These results are further consistent with our results described above indicating that mammalian SRm160 and RNPS1 stimulate 3'-end cleavage by different pathways.


View this table:
[in this window]
[in a new window]
  		TABLE I
RNAi phenotypes of C. elegans 3'-end processing factors

RNAi phenotypes listed are from Refs. (55 and 61-63). adl, adult lethal; clr, clear, morphology defect, postembryonic; emb, lethal embryonic defect; lva, larval arrest, lethal growth defect, postembryonic (similar to lvl); lvl, larval lethal defect, postembryonic, similar to lva; rup, exploded, morphology defect, postembryonic; sck, sick, growth defect, postembryonic; slo, slow growth; ste, sterile; stp, sterile progeny; unc, uncoordinated, movement defect, postembryonic; wf, wild type.

 

In summary, our findings indicate that there is a specific genetic interaction between CeSRm160 and CeCstF-50 that is important for proper development in C. elegans. Moreover, the results support the conclusion that SRm160 has an evolutionarily conserved role in 3'-end formation that functions independently of EJC formation.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
REFERENCES
 
It is well established that the presence of an intron can increase the efficiency of expression of some genes, and recent studies have begun to elucidate the mechanisms responsible (3). For example, it has been demonstrated that splicing can stimulate coupled steps in mRNA metabolism, including transcription, 3'-end formation, export, and translation. The mechanism by which the splicing of 3'-end most introns increases the efficiency of 3'-end formation is not well understood (see Introduction). Several splicing factors have been implicated in this coupling, including U1 snRNP components (16, 19, 20), the SR family protein SRp20 (16), PTB (the polypyrimidine tract-binding protein) (58), and SRm160 (18). Since SRm160 associates with spliceosomal complexes as well as the postsplicing EJC, it was of interest to ask whether the EJC might participate in the stimulation of 3'-end formation.

By tethering each EJC protein to transcripts proximal to the cleavage and polyadenylation signal, we determined which of these proteins can stimulate 3'-end formation. Besides SRm160, RNPS1 also stimulated 3'-end formation, whereas the EJC components REF, Y14, and UAP56 did not. Stimulation of 3'-end formation by RNPS1 was strongly dependent on splicing of an adjacent intron, whereas, consistent with our previous observations (18), SRm160 was not. Assembly of an EJC adjacent to the cleavage and polyadenylation signal did not appear to significantly affect 3'-end cleavage levels, further suggesting that the activity of SRm160 in cleavage stimulation does not coincide with the formation of this complex on spliced mRNA. Simultaneous inactivation of CeSRm160 and CeCstF-50 (the cleavage polyadenylation factor 50-kDa subunit) resulted in a late embryonic arrest phenotype in C. elegans, demonstrating for the first time that an interaction between SRm160 and the cleavage machinery is important in a whole organism context. Simultaneous inactivation of CeCstF-50 and the orthologs of other EJC components, CeRNPS1 and CeREFs1–3, did not result in an altered phenotype, again arguing that SRm160 has an important and unique role in cleavage that is independent of its association with EJC components. The results of these experiments support the notion that SRm160-mediated stimulation of 3'-end formation primarily occurs during the prior assembly of splicing complexes. However, the results do not exclude the possibility that one or more factors associated with the EJC, including SRm160, might stimulate 3'-end processing in other contexts.

An interesting observation stemming from our studies is that a developmental defect was only observed when CeSRm160 was inactivated with CeCstF-50 and not when it was inactivated with CeCFIIAm or CeCFIm-68, a cleavage factor that contains a highly conserved RS domain (59, 60). The RS domains of SR family and SR-related proteins bind to each other and are important in the formation of protein-protein interactions required for the assembly of splicing complexes. Similarly, it has been proposed that the RS domain of CFIm-68 might provide a link to the splicing machinery, by forming interactions with one or more RS domains of splicing factors such as SRm160 and/or SR family proteins (59). Although it is possible that SRm160 and CFIm-68 are part of the same interaction network and that simultaneous inactivation of both of these components is redundant with a separate interaction network that functions in the splicing-dependent stimulation of 3'-end formation, the results are more consistent with our recent observation that the most RS-rich regions of SRm160 are not important for the stimulation of 3'-end formation2 and the finding that some RS domain proteins cannot substitute for the 3'-end cleavage-stimulatory activity of SRm160 (18). Thus, it is possible that SRm160 stimulates 3'-end formation via a domain or domains that are separate from those that are important for promoting splicing activity.

In summary, the results of the present study suggest that the 3'-end cleavage-stimulatory function of SRm160 operates independently of the formation of an EJC, most likely during the prior assembly of splicing complexes. The identification of a genetic interaction between SRm160 and CstF-50 that is important for the proper development of C. elegans indicates that the function of SRm160 in 3'-end formation is highly conserved.


   FOOTNOTES
 
* This work was supported by operating grants from the Canadian Institute of Health Research (CIHR) and National Cancer Institute of Canada (to B. J. B.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Back

Supported by the Medical Research Council (MRC) (UK). Back

** Recipient of MRC/CIHR Scholar and Premier's Research Excellence Awards. To whom correspondence should be addressed: Banting and Best Department of Medical Research, C. H. Best Institute, 112 College St., Toronto, Ontario M5G 1L6, Canada. Tel.: 416-978-3016; Fax: 416-978-8528; E-mail: b.blencowe{at}utoronto.ca.

1 The abbreviations used are: snRNP, small nuclear ribonucleoprotein; EJC, exon-junction complex; nt, nucleotide(s); RNAi, RNA interference. Back

2 S. McCracken and B. J. Blencowe, unpublished data. Back


   ACKNOWLEDGMENTS
 
We thank Susan Berget, Gideon Dreyfuss, Michael Green, Elisa Izaurralde, Akila Mayeda, Jeffrey Nickerson, Peter Stockley, and Joan Steitz for the generous gift of clones and antibodies. We thank John Calarco, Christine Misquitta, Emanuel Rosonina, and Henry Siu for helpful comments on the manuscript.



   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 EXPERIMENTAL PROCEDURES
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Hirose, Y., and Manley, J. L. (2000) Genes Dev. 14, 1415–1429[Free Full Text]
  2. Maniatis, T., and Reed, R. (2002) Nature 416, 499–506[CrossRef][Medline] [Order article via Infotrieve]
  3. Le Hir, H., Nott, A., and Moore, M. J. (2003) Trends Biochem. Sci. 28, 215–220[CrossRef][Medline] [Order article via Infotrieve]
  4. Bentley, D. (1999) Curr. Opin. Cell. Biol. 11, 347–351[CrossRef][Medline] [Order article via Infotrieve]
  5. Fong, Y. W., and Zhou, Q. (2001) Nature 414, 929–933[CrossRef][Medline] [Order article via Infotrieve]
  6. Furger, A., O'Sullivan, J. M., Binnie, A., Lee, B. A., and Proudfoot, N. J. (2002) Genes Dev. 16, 2792–2799[Abstract/Free Full Text]
  7. Kwek, K. Y., Murphy, S., Furger, A., Thomas, B., O'Gorman, W., Kimura, H., Proudfoot, N. J., and Akoulitchev, A. (2002) Nat. Struct. Biol. 9, 800–805[Medline] [Order article via Infotrieve]
  8. Proudfoot, N. (2000) Trends Biochem. Sci. 25, 290–293[CrossRef][Medline] [Order article via Infotrieve]
  9. Izaurralde, E., Lewis, J., McGuigan, C., Jankowska, M., Darzynkiewicz, E., and Mattaj, I. W. (1994) Cell 78, 657–668[CrossRef][Medline] [Order article via Infotrieve]
  10. Lewis, J. D., Izaurralde, E., Jarmolowski, A., McGuigan, C., and Mattaj, I. W. (1996) Genes Dev. 10, 1683–1698[Abstract/Free Full Text]
  11. Flaherty, S. M., Fortes, P., Izaurralde, E., Mattaj, I. W., and Gilmartin, G. M. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 11893–11898[Abstract/Free Full Text]
  12. Niwa, M., Rose, S. D., and Berget, S. M. (1990) Genes Dev. 4, 1552–1559[Abstract/Free Full Text]
  13. Niwa, M., and Berget, S. M. (1991) Genes Dev. 5, 2086–2095[Abstract/Free Full Text]
  14. Nesic, D., and Maquat, L. E. (1994) Genes Dev. 8, 363–375[Abstract/Free Full Text]
  15. Gunderson, S. I., Vagner, S., Polycarpou-Schwarz, M., and Mattaj, I. W. (1997) Genes Dev. 11, 761–773[Abstract/Free Full Text]
  16. Lou, H., Neugebauer, K. M., Gagel, R. F., and Berget, S. M. (1998) Mol. Cell. Biol. 18, 4977–4985[Abstract/Free Full Text]
  17. Vagner, S., Vagner, C., and Mattaj, I. W. (2000) Genes Dev. 14, 403–413[Abstract/Free Full Text]
  18. McCracken, S., Lambermon, M., and Blencowe, B. J. (2002) Mol. Cell. Biol. 22, 148–160[Abstract/Free Full Text]
  19. Wassarman, K. M., and Steitz, J. A. (1993) Genes Dev. 7, 647–659[Abstract/Free Full Text]
  20. Lutz, C. S., Murthy, K. G., Schek, N., O'Connor, J. P., Manley, J. L., and Alwine, J. C. (1996) Genes Dev. 10, 325–337[Abstract/Free Full Text]
  21. Blencowe, B. J., Issner, R., Nickerson, J. A., and Sharp, P. A. (1998) Genes Dev. 12, 996–1009[Abstract/Free Full Text]
  22. Eldridge, A. G., Li, Y., Sharp, P. A., and Blencowe, B. J. (1999) Proc. Natl. Acad. Sci. U. S. A. 96, 6125–6130[Abstract/Free Full Text]
  23. Szymczyna, B. R., Bowman, J., McCracken, S., Pineda-Lucena, A., Lu, Y., Cox, B., Lambermon, M., Graveley, B. R., Arrowsmith, C. H., and Blencowe, B. J. (2003) Genes Dev. 17, 461–475[Abstract/Free Full Text]
  24. Le Hir, H., Izaurralde, E., Maquat, L. E., and Moore, M. J. (2000) EMBO J. 19, 6860–6869[CrossRef][Medline] [Order article via Infotrieve]
  25. Dreyfuss, G., Kim, V. N., and Kataoka, N. (2002) Nat. Rev. Mol. Cell. Biol. 3, 195–205[CrossRef][Medline] [Order article via Infotrieve]
  26. Fleckner, J., Zhang, M., Valcarcel, J., and Green, M. R. (1997) Genes Dev. 11, 1864–1872[Abstract/Free Full Text]
  27. Luo, M. L., Zhou, Z., Magni, K., Christoforides, C., Rappsilber, J., Mann, M., and Reed, R. (2001) Nature 413, 644–647[CrossRef][Medline] [Order article via Infotrieve]
  28. Jensen, T. H., Boulay, J., Rosbash, M., and Libri, D. (2001) Curr. Biol. 11, 1711–1715[CrossRef][Medline] [Order article via Infotrieve]
  29. Gatfield, D., Le Hir, H., Schmitt, C., Braun, I. C., Kocher, T., Wilm, M., and Izaurralde, E. (2001) Curr. Biol. 11, 1716–1721[CrossRef][Medline] [Order article via Infotrieve]
  30. Strasser, K., and Hurt, E. (2001) Nature 413, 648–652[CrossRef][Medline] [Order article via Infotrieve]
  31. Virbasius, C. M., Wagner, S., and Green, M. R. (1999) Mol. Cell 4, 219–228[CrossRef][Medline] [Order article via Infotrieve]
  32. Strasser, K., and Hurt, E. (2000) EMBO J. 19, 410–420[CrossRef][Medline] [Order article via Infotrieve]
  33. Zhou, Z., Luo, M. J., Straesser, K., Katahira, J., Hurt, E., and Reed, R. (2000) Nature 407, 401–405[CrossRef][Medline] [Order article via Infotrieve]
  34. Rodrigues, J. P., Rode, M., Gatfield, D., Blencowe, B., Carmo-Fonseca, M., and Izaurralde, E. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 1030–1035[Abstract/Free Full Text]
  35. Le Hir, H., Gatfield, D., Izaurralde, E., and Moore, M. J. (2001) EMBO J. 20, 4987–4997[CrossRef][Medline] [Order article via Infotrieve]
  36. Mayeda, A., Badolato, J., Kobayashi, R., Zhang, M. Q., Gardiner, E. M., and Krainer, A. R. (1999) EMBO J. 18, 4560–4570[CrossRef][Medline] [Order article via Infotrieve]
  37. Lykke-Andersen, J., Shu, M. D., and Steitz, J. A. (2001) Science 293, 1836–1839[Abstract/Free Full Text]
  38. Le Hir, H., Gatfield, D., Braun, I. C., Forler, D., and Izaurralde, E. (2001) EMBO Rep. 2, 1119–1124[CrossRef][Medline] [Order article via Infotrieve]
  39. Kataoka, N., Diem, M. D., Kim, V. N., Yong, J., and Dreyfuss, G. (2001) EMBO J. 20, 6424–6433[CrossRef][Medline] [Order article via Infotrieve]
  40. Kim, V. N., Yong, J., Kataoka, N., Abel, L., Diem, M. D., and Dreyfuss, G. (2001) EMBO J. 20, 2062–2068[CrossRef][Medline] [Order article via Infotrieve]
  41. Fribourg, S., Gatfield, D., Izaurralde, E., and Conti, E. (2003) Nat. Struct. Biol. 10, 433–439[CrossRef][Medline] [Order article via Infotrieve]
  42. Fu, G. K., Grosveld, G., and Markovitz, D. M. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 1811–1815[Abstract/Free Full Text]
  43. McGarvey, T., Rosonina, E., McCracken, S., Li, Q., Arnaout, R., Mientjes, E., Nickerson, J. A., Awrey, D., Greenblatt, J., Grosveld, G., and Blencowe, B. J. (2000) J. Cell Biol. 150, 309–320[Abstract/Free Full Text]
  44. Hollenbach, A. D., McPherson, C. J., Mientjes, E. J., Iyengar, R., and Grosveld, G. (2002) J. Cell Sci. 115, 3319–3330[Abstract/Free Full Text]
  45. Waldmann, T., Eckerich, C., Baack, M., and Gruss, C. (2002) J. Biol. Chem. 277, 24988–24994[Abstract/Free Full Text]
  46. Lejeune, F., Ishigaki, Y., Li, X., and Maquat, L. E. (2002) EMBO J. 21, 3536–3545[CrossRef][Medline] [Order article via Infotrieve]
  47. Reichert, V. L., Le Hir, H., Jurica, M. S., and Moore, M. J. (2002) Genes Dev. 16, 2778–2791[Abstract/Free Full Text]
  48. Wan, K., Nickerson, J. A., Krockmalnic, G., and Penman, S. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 594–598[Abstract/Free Full Text]
  49. Blencowe, B. J., Bauren, G., Eldridge, A. G., Issner, R., Nickerson, J. A., Rosonina, E., and Sharp, P. A. (2000) RNA 6, 111–120[Abstract]
  50. Yankulov, K., Blau, J., Purton, T., Roberts, S., and Bentley, D. L. (1994) Cell 77, 749–759[CrossRef][Medline] [Order article via Infotrieve]
  51. De Guzman, R. N., Turner, R. B., and Summers, M. F. (1998) Biopolymers 48, 181–195[CrossRef][Medline] [Order article via Infotrieve]
  52. Kim, V. N., Kataoka, N., and Dreyfuss, G. (2001) Science 293, 1832–1836[Abstract/Free Full Text]
  53. Longman, D., McGarvey, T., McCracken, S., Johnstone, I. L., Blencowe, B. J., and Caceres, J. F. (2001) Curr. Biol. 11, 1923–1933[CrossRef][Medline] [Order article via Infotrieve]
  54. Longman, D., Johnstone, I. L., and Caceres, J. F. (2000) EMBO J. 19, 1625–1637[CrossRef][Medline] [Order article via Infotrieve]
  55. Kamath, R. S., Fraser, A. G., Dong, Y., Poulin, G., Durbin, R., Gotta, M., Kanapin, A., Le Bot, N., Moreno, S., Sohrmann, M., Welchman, D. P., Zipperlen, P., and Ahringer, J. (2003) Nature 421, 231–237[CrossRef][Medline] [Order article via Infotrieve]
  56. Macmorris, M., Brocker, C., and Blumenthal, T. (2003) RNA 9, 847–857[Abstract/Free Full Text]
  57. Longman, D., Johnstone, I. L., and Caceres, J. F. (2003) RNA 9, 881–891[Abstract/Free Full Text]
  58. Lou, H., Helfman, D. M., Gagel, R. F., and Berget, S. M. (1999) Mol. Cell. Biol. 19, 78–85[Abstract/Free Full Text]
  59. Ruegsegger, U., Blank, D., and Keller, W. (1998) Mol. Cell 1, 243–253[CrossRef][Medline] [Order article via Infotrieve]
  60. Boucher, L., Ouzounis, C. A., Enright, A. J., and Blencowe, B. J. (2001) RNA 7, 1693–1701[Abstract]
  61. Maeda, I., Kohara, Y., Yamamoto, M., and Sugimoto, A. (2001) Curr. Biol. 11, 171–176[CrossRef][Medline] [Order article via Infotrieve]
  62. Piano, F., Schetter, A. J., Morton, D. G., Gunsalus, K. C., Reinke, V., Kim, S. K., and Kemphues, K. J. (2002) Curr. Biol. 12, 1959–1964[CrossRef][Medline] [Order article via Infotrieve]
  63. Fraser, A. G., Kamath, R. S., Zipperlen, P., Martinez-Campos, M., Sohrmann, M., and Ahringer, J. (2000) Nature 408, 325–330[CrossRef][Medline] [Order article via Infotrieve]

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Virol.Home page
N. L. Maciolek and M. T. McNally
Serine/Arginine-Rich Proteins Contribute to Negative Regulator of Splicing Element-Stimulated Polyadenylation in Rous Sarcoma Virus
J. Virol., October 15, 2007; 81(20): 11208 - 11217.
[Abstract] [Full Text] [PDF]

Home page
 J. Virol.Home page
J. E. Wilusz and K. L. Beemon
The Negative Regulator of Splicing Element of Rous Sarcoma Virus Promotes Polyadenylation
J. Virol., October 1, 2006; 80(19): 9634 - 9640.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
C. Cheng and P. A. Sharp
Regulation of CD44 Alternative Splicing by SRm160 and Its Potential Role in Tumor Cell Invasion
Mol. Cell. Biol., January 1, 2006; 26(1): 362 - 370.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
S. McCracken, D. Longman, E. Marcon, P. Moens, M. Downey, J. A. Nickerson, R. Jessberger, A. Wilde, J. F. Caceres, A. Emili, et al.
Proteomic Analysis of SRm160-containing Complexes Reveals a Conserved Association with Cohesin
J. Biol. Chem., December 23, 2005; 280(51): 42227 - 42236.
[Abstract] [Full Text] [PDF]
<