HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 278, Issue 45, 44412-44416, November 7, 2003

This Article Abstract Full Text (PDF) All Versions of this Article: 278/45/44412    most recent C300376200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Shindo, K. Articles by Uchiyama, T. Search for Related Content PubMed PubMed Citation Articles by Shindo, K. Articles by Uchiyama, T. Social Bookmarking                      What's this?

The Enzymatic Activity of CEM15/Apobec-3G Is Essential for the Regulation of the Infectivity of HIV-1 Virion but Not a Sole Determinant of Its Antiviral Activity^*

Keisuke Shindo, Akifumi Takaori-Kondo, Masayuki Kobayashi, Aierken Abudu, Keiko Fukunaga, and Takashi Uchiyama

From the Department of Hematology and Oncology, Graduate School of Medicine, Kyoto University, 54 Shogoin-Kawaracho, Sakyo-ku, Kyoto 606-8507, Japan

Received for publication, August 22, 2003 , and in revised form, September 10, 2003.

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Human immunodeficiency virus, type 1 (HIV-1) Vif protein plays an essential role in the regulation of the infectivity of HIV-1 virion. Vif functions to counteract an anti-HIV-1 cellular factor in non-permissive cells, CEM15/Apobec-3G, which shares a cytidine deaminase motif. CEM15/Apobec-3G deaminates dC to dU in the minus strand DNA of HIV-1, resulting in G to A hypermutation in the plus strand DNA. In this study, we have done the mutagenesis analysis on two cytidine deaminase motifs in CEM15/Apobec-3G and examined their antiviral functions as well as the DNA editing activity. Point mutations in the C-terminal active site such as E259Q and C291A almost completely abrogated the antiviral function, while those in the N-terminal active site such as E67Q and C100A retained this activity to a lesser extent as compared with that of the wild type. The DNA editing activities of E67Q and E259Q mutants were both retained but impaired to the same extent. This indicates that the enzymatic activity of this protein is essential but not a sole determinant of the antiviral activity. Furthermore, all the deletion mutants tested in this study lost the antiviral activity because of the loss of the activity for dimerization, suggesting that the entire protein structure is necessary for the antiviral function.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
HIV-1 Vif protein plays a crucial role to regulate the virion infectivity (1, 2) and in vivo pathogenesis (3). Vif plausibly acts at a late stage of the viral life cycle to enhance the infectivity of progeny virions 10–100-fold. Viruses deficient in vif (vif) display their non-infectious phenotype when produced by primary human T cells and a restricted number of cell lines such as H9 and CEM. These cells are termed non-permissive, whereas many other cell lines, such as SupT1 and 293T, which support the production of infectious vif virions, are termed permissive (1, 2). Previous studies suggested that non-permissive cells possess certain cellular anti-HIV-1 factor(s) to suppress the virion infectivity, which is overcome by Vif (4, 5). Recently a candidate of this host factor, referred to as CEM15, has been identified (6), which turned out identical to Apobec-3G (7). Expression of CEM15/Apobec-3G in permissive cells could give non-permissive phenotype, suggesting that this protein is essential and sufficient for non-permissive phenotype in these cells (6).

CEM15/Apobec-3G is homologous to an RNA editing enzyme, Apobec-1, and belongs to the Apobec superfamily, which shares a cytidine deaminase motif and consists of Apobec-1 (8–10), AID (11, 12), Apobec-2 (13), and Apobec-3 (7, 14). This sequence similarity leads us to ask whether CEM15/Apobec-3G acts as an RNA editing enzyme to regulate the virion infectivity, although it has not been demonstrated to have any RNA editing activity. On the other hand, CEM15/Apobec-3G has been shown to act as a DNA mutator (14). In fact, several recent studies have revealed that CEM15/Apobec-3G deaminates dC to dU in the newly synthesized minus strand DNA of HIV-1, resulting in G to A hypermutation of the viral plus strand DNA (15–17). However, precise mechanisms how exactly the enzymatic activity of CEM15/Apobec-3G regulates the virion infectivity and how Vif protein overcomes the function of this protein remain unclear. Since point mutations in essential amino acids in a cytidine deaminase motif of Apobec-1 abolished a cytidine deaminase activity as well as RNA editing activity (18–20), we have examined the involvement of the enzymatic activity of CEM15/Apobec-3G in the regulation of the virion infectivity of HIV-1 using site-directed mutagenesis.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Expression Vectors and Molecular Clones—The human CEM15/Apobec-3G cDNA was amplified from H9 cDNA by reverse transcription-PCR method and cloned into pcDNA4/HisMax vector (Invitrogen) for expression of His-tagged CEM15/Apobec-3G (His-CEM15). pDON/EGFP¹ vector was created for expression of N-terminal EGFP fusion protein by cloning EGFP cDNA into pDON-AI vector (Takara Bio Inc., Otsu, Japan). Complementary DNA for CEM15/Apobec-3G was also cloned into pDON/EGFP for expression of EGFP-fused CEM15/Apobec-3G (EGFP-CEM15). Expression vectors for point mutants as shown in Fig. 2A and deletion mutants as shown in Fig. 4A were generated by PCR methods and cloned into pcDNA4/HisMax and/or pDON/EGFP vectors. pNL43-Luc was constructed from pNL4-3 (21) and pNL4-3.Luc.R^–E^– (22). pNL43/vif-Luc was constructed as described previously (2).

View larger version (47K): [in this window] [in a new window]   FIG. 2. The enzymatic activity of the C-terminal active site of CEM15/Apobec-3G is essential for its antiviral function. A, protein structure of CEM15/Apobec-3G and point mutants. B, E259Q and C291A mutants lost the suppressive effect on the virion infectivity, whereas E67Q and C100A mutants showed the similar, but slightly reduced, antiviral activity as compared with the wild type. We transfected pNL43-Luc (WT) or pNL43/vif-Luc (vif) together with a series of pDON/EGFP-based vectors for point mutants. Infectivity assay was done, and values are presented as described in the legend to Fig. 1.

View larger version (30K): [in this window] [in a new window]   FIG. 4. Deletion mutants lost the antiviral activity because of the loss of the activity for dimerization. A, protein structure of CEM15/Apobec-3G and deletion mutants. B, all the deletion mutants lost the antiviral activity on vif virions as well as WT virions. We transfected pNL43-Luc (WT) or pNL43/vif-Luc (vif) together with a series of pDON/EGFP-based vectors for deletion mutants. Infectivity assay was done, and values are presented as described in the legend to Fig. 1. C, analysis of homodimerization of point and deletion mutants by coimmunoprecipitation assay. We transfected pcDNA4/His-CEM15 together with pDON/EGFP-based vectors for wild type and mutants. Cell lysates were immunoprecipitated with anti-EGFP mAbs and subjected to immunoblotting with anti-His tag Ab.

View larger version (33K): [in this window] [in a new window]   FIG. 1. Expression of CEM15/Apobec-3G in permissive cells suppresses the infectivity of HIV-1 virions. We transfected pNL43-Luc (WT) or pNL43/vif-Luc (vif) together with pcDNA4/His-CEM15 (A) or pDON/EGFP-CEM15 (B) (an increasing amount of CEM15/Apobec-3G with the empty parental vector making up the balance) into HEK293T cells. Viruses from these cells were challenged to M8166 cells, and productive infection was measured by luciferase activity. Values are presented as percent infectivity relative to WT virus without expression of CEM15/Apobec-3G.

Cell Lines—HEK293T cells were maintained in Dulbecco's modified Eagle's medium (Invitrogen) containing 10% fetal calf serum and penicillin, streptomycin, and glutamine (Invitrogen). M8166 cells were maintained in RPMI 1640 (Sigma) containing 10% fetal calf serum and penicillin, streptomycin, and glutamine.

Infectivity Assay—Luciferase reporter viruses with or without Vif were prepared in HEK293T cells by cotransfection of pNL43-Luc or pNL43/vif-Luc together with a mock-vector or expression vectors for CEM15/Apobec-3G or its mutants by the calcium phosphate method. Viruses in the supernatants were collected after 48 h of transfection and virus titers were measured with an enzyme-linked immunosorbent assay kit for the p24 antigen (RETRO-TEK, ZeptoMetrix Corporation, Buffalo, NY). An adjusted amount of viruses was challenged to target cells, M8166. On day 2 postinfection, the cells were lysed in passive lysis buffer (Promega, Madison, WI), and the luciferase activity was measured with a Luminometer (EG&G Berthold, Bad Wildbad, Germany). Values were presented as percent infectivity relative to the value of wild type virus without expression of CEM15/Apobec-3G.

Coimmunoprecipitation Assay—To see protein-protein interaction in vivo, we performed an immunoprecipitation assay as described previously (23). In brief, an expression vector for His-CEM15 was cotransfected with EGFP-CEM15 and various mutants into HEK293T cells by calcium phosphate method. Two days after transfection, cells were lysed with lysing buffer. Cell lyates were immunoprecipitated with anti-EGFP monoclonal antibodies (mAbs) (kindly provided by Dr. A. Imura, Kyoto University) and protein G-Sepharose^TM beads and subjected to immunoblotting with anti-His tag Ab (Babco, Berkeley, CA). His-CEM15 was visualized by ECL detection system (Amersham Biosciences).

Detection of Hypermutation in the Viral DNA—Hypermutation of HIV-1 DNA was detected using endogenous reverse transcription as described previously (24). In brief, after treated with DNase I, viral stocks were incubated at 39 °C for 120 min. DNA was purified and amplified using the following primer pairs: op-6.4 (CCATGCTCCTTGGGATATTG) and op-29.10 (CCTCCTGAGGATTGCTTAAA). The PCR products were cloned into pT7-Blue (Novagen, Madison, WI), and the inserts of individual clones were sequenced.

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Expression of CEM15/Apobec-3G Is Sufficient for Non-permissive Phenotype—First, we transfected pcDNA4/His-CEM15 or pDON/EGFP-CEM15 together with pNL43/Luc (WT) or pNL43/vif-Luc (vif) into HEK293T cells, prepared viruses, and tested the infectivity. As shown in Fig. 1, transient expression of His-CEM15 or EGFP-CEM15 clearly suppressed the infectivity of vif virions in a dose-dependent manner as reported previously (6). This indicated that His- and EGFP-tagged protein could suppress the infectivity of vif virions and that expression of CEM15/apobec-3G was sufficient to give non-permissive phenotype to HEK293T cells. Interestingly, the infectivity of WT virions was also suppressed by CEM15/Apobec-3G in a dose-dependent manner to a lesser extent.

Site-directed Mutagenesis of CEM15/Apobec-3G—CEM15/Apobec-3G has sequence similarity with Apobec-1 that shares a conserved active site motif, designated as H-X-E-(X)_24–30-P-C-X-X-C, in which a histidine and two cysteines coordinate Zn²⁺ and a glutamate serves as a proton donor in the deamination reaction (Fig. 2A). Replacement of any of these four amino acids results in a catalytic mutant with the complete loss of its cytidine deaminase activity (18–20). Since CEM15/apobec-3G protein has two conserved active sites, we generated a series of point mutants as shown in Fig. 2A to determine whether the enzymatic activity is necessary for the regulation of the virion infectivity and which active site is involved in this antiviral function. First, we tested the antiviral function of His-tagged H257R. An H257R mutant did not suppress the infectivity of HIV-1 virions. However, expression level of this mutant was quite lower (about 1/10) than that of the wild type (data not shown). Because we also experienced poor expression of some mutants as His-tagged proteins, we instead generated these mutants as EGFP fusion proteins and obtained similar levels of expression of all the mutants (data not shown). We then examined the antiviral function of these mutants. As shown in Fig. 2B, E259Q and C291A mutants lost the suppressive effect on the infectivity of vif virions entirely, while E67Q and C100A mutants showed the similar, but slightly reduced, antiviral effect as compared with the wild type. This indicates that the enzymatic activity of the C-terminal active site containing Glu²⁵⁹ and Cys²⁹¹ is necessary for the antiviral function, while that of the N-terminal active site containing Glu⁶⁷ and Cys¹⁰⁰ dispensable, suggesting two possibilities as follows. One is that the N-terminal active site does not possess the catalytic activity itself. Another is that the activity of this site is dispensable for the antiviral function, although it possesses the enzymatic activity.

The DNA Editing Activities of E67Q and E259Q Mutants Were Both Retained but Impaired to the Same Extent—To address the above issue, we next examined the occurrence of hypermutation in the viral DNA induced by expression of these mutants, since recent reports showed that expression of CEM15/Apobec-3G introduced G to A hypermutation in the viral DNA in the absence of Vif protein (15–17). As shown in Fig. 3, the wild type CEM15/Apobec-3G clearly introduced G to A hypermutation in the viral DNA (Fig. 3A), but vector alone did not (data not shown), as described previously (15, 16). Surprisingly, this assay revealed that each of E67Q and E259Q mutants still retained the activity to introduce some mutations in the viral DNA, but the frequency of mutations was much lower than that of the wild type. (Fig. 3, B and C). These results suggest that both mutants retained some residual enzymatic activity; however, this residual enzymatic activity did not reflect the antiviral activity of these mutants. Interestingly, CEM15/Apobec-3G could introduce G to A mutations even in the viral DNA of WT virus to a lesser extent corresponding to the virion infectivity (Figs. 1 and 3D).

View larger version (16K): [in this window] [in a new window]   FIG. 3. The DNA editing activity of E67Q and E259Q was retained but impaired to the same extent. DNA sequence analysis of the env region was examined using DNA synthesized in endogenous reverse transcription reactions. G to A mutations are shown above the sequence of pNL43, and other mutations are below that. The numbers in parentheses indicate the number of individual clones sequenced. A, vif virions with CEM15/Apobec-3G. B, vif virions with E67Q. C, vif virions with E259Q. D, WT virions with CEM15/Apobec-3G.

Deletion Mutants Lost Their Activity Due to the Loss of the Activity for Dimerization—We further generated a series of deletion mutants as shown in Fig. 4A to examine the possibility whether the C-terminal active site alone is enough for the antiviral function. However, as shown in Fig. 4B, all the deletion mutants lost the antiviral effect on vif virions as well as WT virions. Most of the known cytidine deaminases act as homodimers or homotetramers (25, 26), and deletion mutants of apobec-1 have lost their RNA editing actitvity due to the loss of dimerization activity (26). Hence, we suspected that deletion mutants had lost the antiviral activity because these might not form the homodimers. To test this possibility, we performed an immunoprecipitation assay to examine the protein-protein interaction between His-CEM15 and EGFP-mutants. As shown in Fig. 4C, EGFP-CEM15 (wild type) and EGFP point mutants coimmunoprecipitated His-CEM15 (lanes 2 and 7–9, respectively), but EGFP deletion mutants did not (lanes 4–6). This suggests that the deletion of this protein interfered the proteinprotein interaction between CEM15/Apobec-3G molecules but point mutation did not. Taken together, the entire protein structure of CEM15/Apobec-3G might be necessary for the antiviral activity and the loss of the ability for dimerization by deletion might lead to the loss of this function as reported with Apobec-1.

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
In this study, we demonstrated that the antiviral function of the C-terminal active site of CEM15/Apobec-3G is more potent than that of the N-terminal active site, even though both active sites have similar DNA editing activities. Based on mutagenesis studies on Apobec-1 (18–20), we generated a series of point mutants and examined their antiviral function as well as the DNA editing activity. There was the discrepancy between our data and those reported in the previous studies (15, 16). Zhang et al. (15) reported that point mutants such as C97A/C100A, H257A, and C288A/C291A, with the similarly reduced cytidine deaminase activity (about 10 to 25% of the wild type), showed the similarly impaired activity to induce G to A hypermutation as well as to suppress the infectivity of vif virion. Mangeat et al. (16) reported that point mutants such as E67Q, C100S, E259Q, and C291S showed the similarly impaired antiviral activity on vif virion. Both reports showed that point mutants in any of four critical amino acid residues of either active site lost their antiviral activities. However, we clearly demonstrated that the C-terminal active site is more potent for its antiviral activity, while the N-terminal active site is dispensable for this function. We also clearly demonstrated that point mutants in either active site still retained the DNA editing activity but impaired as compared with that of the wild type. These residual DNA editing activities of E67Q and E259Q mutants were similar, although an E67Q mutant was more potent than an E259Q mutant for its antiviral activity. These results suggest that both active sites possess the DNA editing activity and that the destruction of either active site by point mutation diminished, but still retained the DNA editing activity, which might originate from the other active site. Furthermore, each active site has a different potency to suppress the virion infectivity. We have considered several reasons for this discrepancy between our data and others. One major possibility is that our all mutants have N-terminal tags, while both reports by Zhang and Mangeat (15, 16) used C-terminal FLAG and hemagglutinin tag, respectively. The addition of C-terminal FLAG or hemagglutinin tag might abrogate the residual antiviral activity of point mutants in the N-terminal active site, or the addition of tag on the N terminus facilitates the antiviral effect of mutants in the N-terminal active site. The second possibility is that it was due to the discrepancy between the types of mutants we made (H257R, E67Q, E259Q, C100A, and C291A) and those they made (C97A/C100A, H257A, C288A/C291A, E67Q, C100S, E259Q, and C291S). C97A/C100A and C100S mutations might completely abolish the DNA editing activity.

Deletion mutant study revealed that the entire protein structure is necessary for the function of CEM15/Apobec-3G. Previous studies on Apobec-1 demonstrated that deletion of even 10 amino acids at N terminus or 5 amino acid at C terminus diminished not only RNA-editing activity but also RNA binding activity and the ability for homodimerization, suggesting that homodimerization of Apobec-1 is necessary for its catalytic activity. In our study, deletion of even 20 amino acids at the N terminus or 99 amino acids at the C terminus abolished the antiviral activity as well as the ability for dimerization. This suggests that the loss of the ability for homodimerization leads to the loss of the antiviral function as in the case with Apobec-1.

Interestingly, CEM15/Apobec-3G also suppressed the infectivity of wild type virus to a lesser extent, which was also abolished in catalytic mutants. We have also shown that CEM15/Apobec-3G induced G to A mutations in the viral DNA of wild type HIV-1 (with Vif). These data suggest that CEM15/Apobec-3G acts on wild type virus to a lesser extent, even in the presence of Vif protein. This finding is compatible with that reported by Zhang et al. (15), in which the viral DNA of the wild type HIV-1 had hypermutations after several passages in non-permissive cells. If so, it remains unclear how wild type virus survives and evolves in vivo in primary T cells expressing CEM15/Apobec-3G.

Finally, our present study clearly showed that the enzymatic activity of CEM15/Apobec-3G is essential but not a sole determinant of its antiviral function. However, it still remains unclear how HIV-1 Vif protein counteracts and inhibits the function of CEM15/Apobec-3G to make infectious viruses from non-permissive cells. To elucidate this mechanism could give us deeper insights in the regulation of the virion infectivity by Vif protein and lead us to develop a novel therapeutic strategy for HIV-1 infection.

	FOOTNOTES

 
^* This work was supported in part by grants-in-aid from the Ministry of Education, Science, Sports, and Culture of Japan. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed: Dept. of Hematology and Oncology, Graduate School of Medicine, Kyoto University, 54 Shogoin-Kawaracho, Sakyo-ku, Kyoto 606-8507, Japan. Tel.: 81-75-751-3152; Fax: 81-75-751-4963; E-mail: atakaori{at}kuhp.kyoto-u.ac.jp.

¹ The abbreviations used are: EGFP, enhanced green fluorescent protein; HIV-1, human immunodeficiency virus, type 1; mAb, monoclonal antibody; Ab, antibody; WT, wild type.

	ACKNOWLEDGMENTS

 
We are very grateful to Dr. Akihiro Imura for providing anti-EGFP mAb. The following reagents were obtained through the AIDS Research and Reference Reagent program, Division of AIDS, NIAID, National Institutes of Health: pNL4-3 from Dr. Malcom Martin and pNL4-3.Luc.E^–R^– from Nathaniel Landau.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 

1. Simon, J. H., Sheehy, A. M., Carpenter, E. A., Fouchier, R. A., and Malim, M. H. (1999) J. Virol. 73, 2675–2681[Abstract/Free Full Text]
2. Simon, J. H., Miller, D. L., Fouchier, R. A., Soares, M. A., Peden, K. W., and Malim, M. H. (1998) EMBO J. 17, 1259–1267[CrossRef][Medline] [Order article via Infotrieve]
3. Desrosiers, R. C., Lifson, J. D., Gibbs, J. S., Czajak, S. C., Howe, A. Y., Arthur, L. O., and Johnson, R. P. (1998) J. Virol. 72, 1431–1437[Abstract/Free Full Text]
4. Simon, J. H., Gaddis, N. C., Fouchier, R. A., and Malim, M. H. (1998) Nat. Med. 4, 1397–1400[CrossRef][Medline] [Order article via Infotrieve]
5. Madani, N., and Kabat, D. (1998) J. Virol. 72, 10251–10255[Abstract/Free Full Text]
6. Sheehy, A. M., Gaddis, N. C., Choi, J. D., and Malim, M. H. (2002) Nature 418, 646–650[CrossRef][Medline] [Order article via Infotrieve]
7. Jarmuz, A., Chester, A., Bayliss, J., Gisbourne, J., Dunham, I., Scott, J., and Navaratnam, N. (2002) Genomics 79, 285–296[CrossRef][Medline] [Order article via Infotrieve]
8. Teng, B., Burant, C. F., and Davidson, N. O. (1993) Science 260, 1816–1819[Abstract/Free Full Text]
9. Navaratnam, N., Morrison, J. R., Bhattacharya, S., Patel, D., Funahashi, T., Giannoni, F., Teng, B. B., Davidson, N. O., and Scott, J. (1993) J. Biol. Chem. 268, 20709–20712[Abstract/Free Full Text]
10. Anant, S., MacGinnitie, A. J., and Davidson, N. O. (1995) J. Biol. Chem. 270, 14762–14767[Abstract/Free Full Text]
11. Muramatsu, M., Sankaranand, V. S., Anant, S., Sugai, M., Kinoshita, K., Davidson, N. O., and Honjo, T. (1999) J. Biol. Chem. 274, 18470–18476[Abstract/Free Full Text]
12. Muramatsu, M., Kinoshita, K., Fagarasan, S., Yamada, S., Shinkai, Y., and Honjo, T. (2000) Cell 102, 553–563[CrossRef][Medline] [Order article via Infotrieve]
13. Anant, S., Mukhopadhyay, D., Sankaranand, V., Kennedy, S., Henderson, J. O., and Davidson, N. O. (2001) Am. J. Physiol. 281, C1904–C1916
14. Harris, R. S., Petersen-Mahrt, S. K., and Neuberger, M. S. (2002) Mol. Cell 10, 1247–1253[CrossRef][Medline] [Order article via Infotrieve]
15. Zhang, H., Yang, B., Pomerantz, R. J., Zhang, C., Arunachalam, S. C., and Gao, L. (2003) Nature 424, 94–98[CrossRef][Medline] [Order article via Infotrieve]
16. Mangeat, B., Turelli, P., Caron, G., Friedli, M., Perrin, L., and Trono, D. (2003) Nature 424, 99–103[CrossRef][Medline] [Order article via Infotrieve]
17. Harris, R. S., Bishop, K. N., Sheehy, A. M., Craig, H. M., Petersen-Mahrt, S. K., Watt, I. N., Neuberger, M. S., and Malim, M. H. (2003) Cell 113, 803–809[CrossRef][Medline] [Order article via Infotrieve]
18. Navaratnam, N., Bhattacharya, S., Fujino, T., Patel, D., Jarmuz, A. L., and Scott, J. (1995) Cell 81, 187–195[CrossRef][Medline] [Order article via Infotrieve]
19. Yamanaka, S., Poksay, K. S., Balestra, M. E., Zeng, G. Q., and Innerarity, T. L. (1994) J. Biol. Chem. 269, 21725–21734[Abstract/Free Full Text]
20. MacGinnitie, A. J., Anant, S., and Davidson, N. O. (1995) J. Biol. Chem. 270, 14768–14775[Abstract/Free Full Text]
21. Adachi, A., Gendelman, H. E., Koenig, S., Folks, T., Willey, R., Rabson, A., and Martin, M. A. (1986) J. Virol. 59, 284–291[Abstract/Free Full Text]
22. He, J., Choe, S., Walker, R., Di Marzio, P., Morgan, D. O., and Landau, N. R. (1995) J. Virol. 69, 6705–6711[Abstract]
23. Takaori-Kondo, A., Hori, T., Fukunaga, K., Morita, R., Kawamata, S., and Uchiyama, T. (2000) Biochem. Biophys. Res. Commun. 272, 856–863[CrossRef][Medline] [Order article via Infotrieve]
24. Lecossier, D., Bouchonnet, F., Clavel, F., and Hance, A. J. (2003) Science 300, 1112[Free Full Text]
25. Lau, P. P., Zhu, H. J., Baldini, A., Charnsangavej, C., and Chan, L. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 8522–8526[Abstract/Free Full Text]
26. Navaratnam, N., Fujino, T., Bayliss, J., Jarmuz, A., How, A., Richardson, N., Somasekaram, A., Bhattacharya, S., Carter, C., and Scott, J. (1998) J. Mol. Biol. 275, 695–714[CrossRef][Medline] [Order article via Infotrieve]

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				H. P. Bogerd and B. R. Cullen Single-stranded RNA facilitates nucleocapsid: APOBEC3G complex formation RNA, June 1, 2008; 14(6): 1228 - 1236. [Abstract] [Full Text] [PDF]

				M.-A. Langlois and M. S. Neuberger Human APOBEC3G Can Restrict Retroviral Infection in Avian Cells and Acts Independently of both UNG and SMUG1 J. Virol., May 1, 2008; 82(9): 4660 - 4664. [Abstract] [Full Text] [PDF]

				S. K. Gandhi, J. D. Siliciano, J. R. Bailey, R. F. Siliciano, and J. N. Blankson Role of APOBEC3G/F-Mediated Hypermutation in the Control of Human Immunodeficiency Virus Type 1 in Elite Suppressors J. Virol., March 15, 2008; 82(6): 3125 - 3130. [Abstract] [Full Text] [PDF]

				A. J. Schumacher, G. Hache, D. A. MacDuff, W. L. Brown, and R. S. Harris The DNA Deaminase Activity of Human APOBEC3G Is Required for Ty1, MusD, and Human Immunodeficiency Virus Type 1 Restriction J. Virol., March 15, 2008; 82(6): 2652 - 2660. [Abstract] [Full Text] [PDF]

				Y. Iwatani, D. S.B. Chan, F. Wang, K. S. Maynard, W. Sugiura, A. M. Gronenborn, I. Rouzina, M. C. Williams, K. Musier-Forsyth, and J. G. Levin Deaminase-independent inhibition of HIV-1 reverse transcription by APOBEC3G Nucleic Acids Res., December 18, 2007; 35(21): 7096 - 7108. [Abstract] [Full Text] [PDF]

				H. L. Wiegand and B. R. Cullen Inhibition of Alpharetrovirus Replication by a Range of Human APOBEC3 Proteins J. Virol., December 15, 2007; 81(24): 13694 - 13699. [Abstract] [Full Text] [PDF]

				E. Miyagi, S. Opi, H. Takeuchi, M. Khan, R. Goila-Gaur, S. Kao, and K. Strebel Enzymatically Active APOBEC3G Is Required for Efficient Inhibition of Human Immunodeficiency Virus Type 1 J. Virol., December 15, 2007; 81(24): 13346 - 13353. [Abstract] [Full Text] [PDF]

				M. Bonvin and J. Greeve Effects of point mutations in the cytidine deaminase domains of APOBEC3B on replication and hypermutation of hepatitis B virus in vitro J. Gen. Virol., December 1, 2007; 88(12): 3270 - 3274. [Abstract] [Full Text] [PDF]

				A. Mehle, H. Wilson, C. Zhang, A. J. Brazier, M. McPike, E. Pery, and D. Gabuzda Identification of an APOBEC3G Binding Site in Human Immunodeficiency Virus Type 1 Vif and Inhibitors of Vif-APOBEC3G Binding J. Virol., December 1, 2007; 81(23): 13235 - 13241. [Abstract] [Full Text] [PDF]

				S. Opi, S. Kao, R. Goila-Gaur, M. A. Khan, E. Miyagi, H. Takeuchi, and K. Strebel Human Immunodeficiency Virus Type 1 Vif Inhibits Packaging and Antiviral Activity of a Degradation-Resistant APOBEC3G Variant J. Virol., August 1, 2007; 81(15): 8236 - 8246. [Abstract] [Full Text] [PDF]

				K. Luo, T. Wang, B. Liu, C. Tian, Z. Xiao, J. Kappes, and X.-F. Yu Cytidine Deaminases APOBEC3G and APOBEC3F Interact with Human Immunodeficiency Virus Type 1 Integrase and Inhibit Proviral DNA Formation J. Virol., July 1, 2007; 81(13): 7238 - 7248. [Abstract] [Full Text] [PDF]

				J. L. Mbisa, R. Barr, J. A. Thomas, N. Vandegraaff, I. J. Dorweiler, E. S. Svarovskaia, W. L. Brown, L. M. Mansky, R. J. Gorelick, R. S. Harris, et al. Human Immunodeficiency Virus Type 1 cDNAs Produced in the Presence of APOBEC3G Exhibit Defects in Plus-Strand DNA Transfer and Integration J. Virol., July 1, 2007; 81(13): 7099 - 7110. [Abstract] [Full Text] [PDF]

				H. Muckenfuss, J. K. Kaiser, E. Krebil, M. Battenberg, C. Schwer, K. Cichutek, C. Munk, and E. Flory Sp1 and Sp3 regulate basal transcription of the human APOBEC3G gene Nucleic Acids Res., June 28, 2007; 35(11): 3784 - 3796. [Abstract] [Full Text] [PDF]

				B. Yang, K. Chen, C. Zhang, S. Huang, and H. Zhang Virion-associated Uracil DNA Glycosylase-2 and Apurinic/Apyrimidinic Endonuclease Are Involved in the Degradation of APOBEC3G-edited Nascent HIV-1 DNA J. Biol. Chem., April 20, 2007; 282(16): 11667 - 11675. [Abstract] [Full Text] [PDF]

				D. Derse, S. A. Hill, G. Princler, P. Lloyd, and G. Heidecker Resistance of human T cell leukemia virus type 1 to APOBEC3G restriction is mediated by elements in nucleocapsid PNAS, February 20, 2007; 104(8): 2915 - 2920. [Abstract] [Full Text] [PDF]

				K. S. Stopak, Y.-L. Chiu, J. Kropp, R. M. Grant, and W. C. Greene Distinct Patterns of Cytokine Regulation of APOBEC3G Expression and Activity in Primary Lymphocytes, Macrophages, and Dendritic Cells J. Biol. Chem., February 9, 2007; 282(6): 3539 - 3546. [Abstract] [Full Text] [PDF]

				C. Noguchi, N. Hiraga, N. Mori, M. Tsuge, M. Imamura, S. Takahashi, Y. Fujimoto, H. Ochi, H. Abe, T. Maekawa, et al. Dual effect of APOBEC3G on Hepatitis B virus J. Gen. Virol., February 1, 2007; 88(2): 432 - 440. [Abstract] [Full Text] [PDF]

				S. R. Jonsson, G. Hache, M. D. Stenglein, S. C. Fahrenkrug, V. Andresdottir, and R. S. Harris Evolutionarily conserved and non-conserved retrovirus restriction activities of artiodactyl APOBEC3F proteins Nucleic Acids Res., November 14, 2006; 34(19): 5683 - 5694. [Abstract] [Full Text] [PDF]

				H. Muckenfuss, M. Hamdorf, U. Held, M. Perkovic, J. Lower, K. Cichutek, E. Flory, G. G. Schumann, and C. Munk APOBEC3 Proteins Inhibit Human LINE-1 Retrotransposition J. Biol. Chem., August 4, 2006; 281(31): 22161 - 22172. [Abstract] [Full Text] [PDF]

				M. D. Stenglein and R. S. Harris APOBEC3B and APOBEC3F Inhibit L1 Retrotransposition by a DNA Deamination-independent Mechanism J. Biol. Chem., June 23, 2006; 281(25): 16837 - 16841. [Abstract] [Full Text] [PDF]

				Y. Iwatani, H. Takeuchi, K. Strebel, and J. G. Levin Biochemical Activities of Highly Purified, Catalytically Active Human APOBEC3G: Correlation with Antiviral Effect. J. Virol., June 1, 2006; 80(12): 5992 - 6002. [Abstract] [Full Text] [PDF]

				S. Opi, H. Takeuchi, S. Kao, M. A. Khan, E. Miyagi, R. Goila-Gaur, Y. Iwatani, J. G. Levin, and K. Strebel Monomeric APOBEC3G Is Catalytically Active and Has Antiviral Activity. J. Virol., May 1, 2006; 80(10): 4673 - 4682. [Abstract] [Full Text] [PDF]

				M. Kobayashi, A. Takaori-Kondo, Y. Miyauchi, K. Iwai, and T. Uchiyama Ubiquitination of APOBEC3G by an HIV-1 Vif-Cullin5-Elongin B-Elongin C Complex Is Essential for Vif Function J. Biol. Chem., May 13, 2005; 280(19): 18573 - 18578. [Abstract] [Full Text] [PDF]

				M.-A. Langlois, R. C. L. Beale, S. G. Conticello, and M. S. Neuberger Mutational comparison of the single-domained APOBEC3C and double-domained APOBEC3F/G anti-retroviral cytidine deaminases provides insight into their DNA target site specificities Nucleic Acids Res., April 4, 2005; 33(6): 1913 - 1923. [Abstract] [Full Text] [PDF]

				G. Hache, M. T. Liddament, and R. S. Harris The Retroviral Hypermutation Specificity of APOBEC3F and APOBEC3G Is Governed by the C-terminal DNA Cytosine Deaminase Domain J. Biol. Chem., March 25, 2005; 280(12): 10920 - 10924. [Abstract] [Full Text] [PDF]

				M. J. Wichroski, K. Ichiyama, and T. M. Rana Analysis of HIV-1 Viral Infectivity Factor-mediated Proteasome-dependent Depletion of APOBEC3G: CORRELATING FUNCTION AND SUBCELLULAR LOCALIZATION J. Biol. Chem., March 4, 2005; 280(9): 8387 - 8396. [Abstract] [Full Text] [PDF]

				A. C. Ribeiro, A. Maia e Silva, M. Santa-Marta, A. Pombo, J. Moniz-Pereira, J. Goncalves, and I. Barahona Functional Analysis of Vif Protein Shows Less Restriction of Human Immunodeficiency Virus Type 2 by APOBEC3G J. Virol., January 15, 2005; 79(2): 823 - 833. [Abstract] [Full Text] [PDF]